Extended Abstract : Biology and Biodiversity

12th SCiUS Forum

Oral presentation
Biology and Biodiversity Group 4

Sunday August 28, 2022

No. Code Title Author School
Naresuan University
1 OB4_03_03 Expression of Anthracnose- Miss Nichanan Kanta Secondary
Demonstration School
related gene in mango Mr. Panat Kijsanayothin
Demonstration School
infected with Colletotrichum of Khon Kaen
University
gloeosporioides Demonstration School
Prince of Songkla
2 OB4_04_06 Molecular cloning of the Mr. Thakorn Namwongpisut University, Pattani
Campus
OsSKIPa gene from Oryza Mr. Surawat Boonlue PSU Wittayanusorn
Surat Thani School
sativa Linn. var. KDML 105
Chiang Mai University
3 OB4_16_02 Effect of friedelin extract Mr. Phusit Arunruang Demonstration School

from cannabis roots on Miss Nusrin Waesalaemae PSU.Wittayanusorn
School
cosmeceutical application

4 OB4_17_09 Isolation and Miss Naphamon Limranangkoon

Characterization of Probiotic Miss Pornnapa Prommanee

Bacteria from Local

Fermented Food

5 OB4_01_05 The antiproliferative effects Mr. Thanpapon Dhammajai

of crude extract from Citrus Miss Nantorn Yotbuntherng

medica L. var. Sarcodactylis Miss Satanan Sanpabopit

Swingle on human cancer

cell lines.

6 OB4_15_05 Selection of Probiotic Lactic Miss Natchayada Ponjorn

Acid Bacteria from Pickled Miss Aksarapak Chuabankoh

Wild Spider Flower

294

12th SCiUS Forum

Title : Expression of Anthracnose-related gene in Nam Dok Mai mango OB4_03_03
infected with Colletotrichum gloeosporioides

Field : Biology and Biodiversity
Author : Miss. Nichanan Kanta

Mr. Panat Kijsanayothin
School : Naresuan University Secondary Demonstration School
Advisor : Asst. Prof. Maliwan Nakkuntod Ph.d (Naresuan University)

Abstract
Mango is one of Thailand’s most economically important fruits, so the high quality and safety of

mangoes are required. The major plant disease of mango is anthracnose that gardeners should monitor carefully
after post harvesting. The purpose of this research was to study the expression of gene ß-1,3-glucanase in
mango fruit after infection. The results showed that RNA extraction from mango fruit after inoculation for 0,
0.5, 1, 2, 3 and 4 hours was found to be able to extract sufficient amount of RNA from Chang et al. (2016).
When digest DNA, the amount of RNA was decreased and the detection of amplified RNA by PCR could not
be detected the expression of ß-1,3-glucanase gene due to RNA can’t be converted to cDNA and primers can’t
be detected. The primer is not specific. Therefore, new specific primer design is important criteria, when it
success we will be develop anthracnose detection system in mango further to control mango quality before
export.

Keywords: Colletotrichum gloeosporioides, Anthracnose, gene expression, ß-1,3-glucanase gene, mango

Introduction
Nam Dok Mai mango (Mangifera indica Linn) is one of Thailand’s most economically important

fruits due to its flavor and bright yellow flesh, which is favored by consumers in both domestic and export
markets. Nam Dok Mai mango is a preferred product in many countries due to favorable characteristics such
as attractive skin color, pulp color, taste, and flavor.

One of the major constraints of Thai mango export is anthracnose disease caused by Colletotrichum
gloeosporioides that can infect all parts of a mango tree including the stem, leaf, flower, immature fruit, and
mature fruit. The symptoms of the disease do not express themselves in an infected unripe mango but appear
when the mango ripens. The symptoms were seen to be black spots or flecks on the skin of ripe mangoes.

In the infection by fungi, Plants have a gene expression in each phase of the infection. β-1,3-
Glucanases gene that regulate the synthesis of phenolics is expressed in growing tissue and when plant response
under environmental stress conditions as pathogens, overheating, injury, and hormone (Rodríguez et al., 2007).

OB4_03_03/1
295

12th SCiUS Forum

Because of the destructive of C. gloeosporioides it cause a lot damage on ripe mango. In order to
investigate the infection on mango, This study determined the expression level of β-1,3-Glucanases gene and
a period in Nam Dok Mai mango after infected with C. gloeosporioides.

Methodology
The experiments were divided into 3 parts as follows,

Part 1: Fungal isolation by tissue transplanting
Cut 0.5 × 0.5 cm. pieces of infected mango tissue.Then, surface-sterilized by dipping in 15%

sodium hypochlorite for 5 min and take the tissue on PDA for 5-7 days. Subculture for 3 times to identify
C. gloeosporioides.
Part 2: Primer design

Design primer for β-1,3-glucanase gene by Primer 3 Input program.

Design primer for Actin and GAPDH that used for gene reference.
Part 3: Detect β-1,3-glucanase gene expression

3.1 Find the optimal RNA extraction method from RNeasy Plant Mini Kit (Qiagen, Germany),
Thanikkul, 2012, Reddy et al., 2015, Djami et al., 2012, Chang et al., 2016 for extract RNA in Nam Dok Mai
mango fruit. We took the methods from RNA extraction kit and reference’s methods.

3.2 Inoculate the fungal, C. gloeosporioides from fungal isolation, under Nam Dok Mai mango
fruit skin about 1 cm. Next we cut samples 1 x 1 x 1 cm. around the area that was inoculated for 0.5, 1, 2, 3
and 4 hrs.

3.3 Gene expression detection, After the fungal inoculation in Nam Dok Mai mango fruit we
extracted the RNA from Nam Dok Mai mango fruit by the optimal RNA extraction method. Next, we treated
DNase in RNA extract to degrade DNA that contaminated in RNA extract and we took the RNA extract after
treat with DNase to synthesis cDNA. Finally, Semi-quantitative PCR was used for analysis the quantitative of
gene expression so we did PCR with cDNA and did gel electrophoresis with PCR product method for detect
gene expression.

Results
Morphological observations of fungi showed that in samples 1, 2 and 7, mycelium was white,

conidia were cylindrical in shape with a rounded tip and approximately 3 x 14 µm in size, consistent with the
study by Rungthip Sangphueak (2014) found that fungal conidia characteristics. The size of Colletotrichum

OB4_03_03/2

296

12th SCiUS Forum

gloeosporioides is approximately 3.23 x 13.4 µm. It is assumed that the fungi in samples 1, 2 and 7 were C.
gloeosporioides to be studied. The extraction method by Chang et al. (2016) is an appropriate method. DNase
Treatment from RNA samples are degraded because optimum condition for DNase or concentration of DNase
are not appropriate. RNA appear only lanes of mango because Actin and GAPDH is specific gene in mango.
So, Actin and GAPDH are gene reference because Actin and GAPDH is housekeeping genes and used for
compare with β-1,3-Glucanases gene. In semi-qPCR for β-1,3-Glucanases gene, RNA appear on lanes of
mango and C. gloeosporioides with varying sizes of apparent RNA. Indicating β-1,3-Glucanases gene is not
specific for RNA and unsuitable because RNA appear on lanes of C. gloeosporioides from pipette error that
make non-specific primer and problem from primer that make non-specific primer, multiple fragments and
generate in other organisms.

Conclusion
Classification of fungi by morphological characteristic from mango can be classified as

Colletotrichum gloeosporioides. RNA extraction from mango fruit after inoculation for 0, 0.5, 1, 2, 3 and 4
hours was found to be able to extract sufficient amount of RNA from Chang et al. (2016). When digest DNA,
the amount of RNA was decreased and the detection of amplified RNA by PCR could not be detected the
expression of ß-1,3-glucanase gene due to RNA can’t be converted to cDNA and primers can’t be detected.
The primer is not specific. Therefore, new specific primer design is important criteria, when it success we will
be develop anthracnose detection system in mango further to control mango quality before export.

Acknowledgements
This project was supported by Science Classroom in University Affiliated School (SCiUS). The

funding of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This
extended abstract is not for citation.

References
1. กลุ ธิดา ปานทยักษ์. การแยกยีนจากมะม่วงท่เี กย่ี วข้องกบั การติดเชือ้ รา Colletotrichum gloeosporioides. [วิทยานิพนธ์ระดับปริญญาตรี].

พษิ ณุโลก; มหาวทิ ยาลยั นเรศวร; 2564.
2. สวติ า สวุ รรณรตั น์, ปัฐวภิ า สงกมุ าร, และสมศิริ แสงโชต. การแสดงออกของยนี ที่เกย่ี วขอ้ งกบั เอนไซม์ cutinase และ endopolygalacturonase

ของเช้ือรา Colletotrichum capsici ในชว่ งการเขา้ ทาลายบนผลพริก. วารสารเกษตร. 2560; 33(3): 357 – 366.
3. Rajesh Kumar.et al. De novo assembly, differential gene expression and pathway analyses for anthracnose

resistance in chilli (Capsicum annuum L.). 2021
4. Rukmini Mishra, Satyabrata Nanda, Ellojita Rout, Subodh Kumar Chand,Jatindra Nath Mohanty & Raj Kumar

Joshi. Differential expression of defense-related genes in chilli pepper infected with anthracnose pathogen
Colletotrichum truncatum. India; 2017

OB4_03_03/3

297

12th SCiUS Forum

Title : Molecular cloning of the OsSKIPa gene OB4_04_06
from Oryza sativa Linn. var. KDML 105
Field :
Authors : Biology and Biodiversity

School : Mr. Thakorn Namwongpisut
Advisors :
Mr. Surawat Boonlue

Demonstration School of Khon Kaen University, Khon Kaen University

Asst. Prof. Dr. Preekamol Klanrit

Assoc. Prof. Dr. Pornthap Thanonkeo

Department of Biotechnology, Faculty of Technology, Khon Kaen University

Miss Lalida Wongbuth

Demonstration School of Khon Kaen University, Khon Kaen University

Abstract
Abiotic stresses, including drought, salt, and heat, are major limiting factors for crops' growth,

development, and productivity. A rice homolog of Ski-interacting protein (OsSKIPa) has been reported to
positively modulate cell viability and stress tolerance of rice. In this study, the OsSKIPa gene in Oryza sativa var.
Khao Dawk Mali 105 (KDML 105) was cloned and characterized. Genomic DNA was isolated from 14 -day-old
plantlets using a GF-1 plant DNA extraction kit. The extracted genomic DNA was employed as a template for
amplifying the OsSKIPa gene by polymerase chain reaction (PCR) using the specific primers designed based on
the nucleotide sequences of SKI-interacting protein A-like genes available in the NCBI database. The result
revealed a PCR product size of approximately 1.8 kb. This PCR product was purified and ligated into the pTG19-
T vector using the TA cloning strategy and transformed into Escherichia coli TOP10 using chemical
transformation. Based on blue-white colony selection, the recombinants (white colonies) were obtained and were
confirmed by restriction digestion analysis. DNA sequence analysis showed that the complete open reading frame
(ORF) of the OsSKIPa gene was 1,824 base pairs in length and encoded a protein of 607 amino acids with the
predicted molecular weight of 67.5 kDa. The putative amino acid sequence contained the conserved SNW/SKIP
domain with an S-N-W-K-N peptide signature, essential for cell viability under stress conditions. This finding
provides valuable information for future crop improvement using genetic engineering.

Keywords : TA cloning, OsSKIPa gene, PCR, Blue-White colony selection, KDML 105

Introduction
Drought and heat stress is considered a risk for successful crop production. Nowadays, the world’s

average temperature has increased considerably, while many plants cannot survivein high -temperature conditions.
More specifically, winter crops cannot survive when they gain immense heat. Unlike animals, sessile plants have
to adapt to environmental changes using internal molecular mechanisms, especially the identification of genes
responsible for cell viability under stress conditions is required. Rice (Oryza sativa) is an economic crop in

____________________________________________________________________________________
OB4_04_06/1

298

12th SCiUS Forum

Thailand and is relatively tolerant to high temperatures and other stress conditions. In addition, a homolog of Ski-
interacting protein in rice (OsSKIPa), belonging to a transcription factor group of proteins, has been repo rted to
protect the plant and increase cell viability under stress conditions, especially heat, and drought stress (Hou et al.,
2009; สภุ าวดี ง้อเหรียญ และคณะ 2016). Therefore, the OsSKIPa gene of the rice variety, Kao Dawk Mali 105 (KDML
105), was chosen for this study.

This study aims to clone a gene designated OsSKIPafrom Oryza sativa KDML105. In addition, molecular
characterization of the gene and putative protein were also determined. Information obtained in this study will be
helpful for further crop improvement.

Methodology
Plant preparation:

In this study, Oryza sativa KDML105 provided by Assoc. Prof. Dr. Paweena Pongdontri was used. The
rice seeds were surface sterilized using 15% (v/v) Clorox solution containing 2-3 drops of Tween-20 and shaken
for 15 min. After that, they were washed three times with sterile distilled water, transferred to Murashige & Skoog
(MS) medium, and cultivated at 25°C ± 2°C under a 16-h photoperiod. After 14 days of cultivation, the plantlets
were collected and subjected to genomic DNA isolation.

Gene cloning and characterization:
Genomic DNA was isolated from 14-day-old rice plantlets using a GF-1 plant DNA extraction kit

(Vivantis). The extracted genomic DNA was employed as a template for amplifying the OsSKIPa gene by
polymerase chain reaction (PCR) using the specific primers designed based on the nucleotide sequences of SKI-
interacting protein A-like genes available in the NCBI database. The PCR reaction was prepared accord ing to
manufacturer instructions. The PCR condition consisted of the initial denaturation step at 95°C for 5 minutes,
followed by 35 cycles of denaturation at 94°C for 15 seconds, annealing at 50°C for 1 minute, and extension at
68°C for 4 minutes. The resulting PCR product was purified using the GF-1 gel DNA recovery kit (Vivantis),
ligated into the pTG19-Tvector usingthe TA cloningstrategy, and transformed into Escherichia coli TOP10 using
chemical transformation. The recombinants were screenedusinga blue-white colony selectionandwere confirmed
by restriction digestion analysis.

The recombinant plasmid DNA was isolated from the selected recombinant colony using restriction
endonuclease and subjected to Dideoxy chain-termination DNA sequencing. The open reading frame of the
OsSKIPa gene was analyzed using the BioEdit program. The deduced amino acid sequence, molecular weight of
the putative protein and protein domain were analyzed using the BioEdit program.

Results
Based on the PCR amplification using gDNA isolated from a 14-day-old plantlet as a template and

specific primers for the OsSKIPa gene, a PCR product of approximately 1.8 kb was obtained (Fig. 1).

____________________________________________________________________________________
OB4_04_06/2

299

12th SCiUS Forum
After purification, ligation into the pTG19-T vector and transformation into E. coli TOP 10, the recombinant
colonies were obtained based on a blue-white colony selection (Fig. 2).

Fig. 1 Agarose gel electrophoresis analysis of the PCR product of OsSKIPa gene in O. sativa KDML105.
1) and 2) are PCR products from gDNA sample 1, and 2, respectively, and M is DNA marker.

Fig. 2 Blue-white colony selection of the transformant colony of E. coli TOP 10 after gene transformation.
Sequencing analysis of the recombinant plasmid DNA isolated from the selected recombinant colony

revealed that the open reading frame of the OsSKIPa gene from O. sativa KDML 105 was 1,824 base pairs in
length, and encoded a protein of 607 amino acids (Fig. 3). The nucleotide sequence of the OsSKIPa gene in O.
sativa KDML105 was highly similar to that of O. sativa japonica type. The predicted molecular weight of the
putative OsSKIPa protein was 67.5kDa. The conserved SNW/SKIPdomain with an S-N-W-N-N peptide signature
was detected in the OsSKIPa protein based on the bioinformatic analysis.

Fig. 3 Nucleotide and amino acid sequences of the OsSKIPa gene from O. sativa KDML 105.
____________________________________________________________________________________

OB4_04_06/3

300

12th SCiUS Forum
Conclusion

The OsSKIPa gene of Oryza sativa KDML 105 was successfully cloned and characterized. The gene was
1,824 base pairs in length, encoding 607 amino acid residues with the predicted molecular weight of 67.5 kDa.
The S-N-W-K-N peptide signature essential for cell viability under stress conditions was detected in the amino
acid sequence of OsSKIPa protein. The expression analysis of this gene under various stress conditions may be
needed to clarify its biological function.
Acknowledgement

This project was supported by Science Classroom in University Affiliated School (SCiUS). The funding
of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This extended abstract
is not for citation.
References
1. สุภาวดี ง้อเหรยี ญ, พงศกร สรรคว์ ิทยากุล, ภรณี สว่างศรี, รุง่ นภา พทิ ักษต์ ันสกลุ , ภมุ รินทร์ วณชิ ชนานนั ท์, หทยั รตั น์ อไุ รรงค.์ Cloning and characterization
of OsSKIPa gene from rice (Oryza sativa Linn. Var. KDML 105). Thai Agricultural Research Journal 2016;34:13-
27.
2. Xin H, Kabin X, JialingY, Zhuyun Q, LizhongX. A homologof human ski-interactingprotein in rice positively
regulates cell viability and stress tolerance. PNAS 2009;106:6410-6415.

____________________________________________________________________________________
OB4_04_06/4

301

12th SCiUS Forum

Title : Effect of friedelin extract from cannabis roots OB4_16_02

Field : on cosmeceutical application
Biology and Biological Diversity

:Author Mr.Phusit Arunruang

School : Ms.Nusrin Waesalaemae
Demonstration School Prince of Songkhla University, Prince of Songkhla University

: ,Advisor Dr.Eaknarin Ruangrak Department of Science, Faculty Science and Technology,

Prince of Songkla University, Pattani Campus

:Abstract

Cannabis is a plant that has been used for several purposes from the past till now including leaves,
flowers, stems, and roots. The cannabis root is not very popular because it does not contain cannabinoids.
However, cannabis root contains the active ingredient in the triterpenoid group, friedelin. Many research had
reported that friedelin can reduce inflammation and also has the ability of antibacterial. Thus, this research
aimed to extract friedelin from cannabis roots and study comparative friedelin concentrations on inhibiting the
growth of Propionibacterium acnes bacteria. Friedelin extracted from cannabis roots was tested for TLC to
determine and analyze the primary purity of the resulting friedelin. Friedelin concentrations of 64, 256, and
1,024 micromolar were tested for inhibition of the growth of Propionibacterium acnes (P. acnes) bacteria by
the disc diffusion method. The result of the TLC test friedelin from cannabis roots has a single component and
a value similar to the standard friedelin with distilled water can confirm that friedelin from cannabis roots
is pure. For the result of inhibiting P. acnes bacteria of the Friedelin extract sample when compared with
standard antibacterial clindamycin at a dose of 0.002 mg had a diameter of 48.34±2.16 mm in the P. acnes
bacteria inactivation region but friedelin was ineffective with P. acnes bacteria, however, friedelin extract can
be applied as a product to reduce acne in the form of reducing acne inflammation, but not to inhibit the growth
of bacteria directly.

:Keywords cannabis root, friedelin

Introduction
cannabis root is not very popular because it contains cannabinoids, the commonly used substances

in small quantities. Cannabis root contains the active ingredient in the triterpenoid group, friedelin. Research
has shown friedelin can reduce inflammation and also has the ability of antibacterial(1). The study of friedelin
extract from cannabis roots is an interesting alternative. Our research aims to extract friedelin from cannabis
roots and study comparative friedelin concentrations on inhibiting the growth of Propionibacterium acnes

For internal use in the 12th SCiUS Forum only. Not for citation.

302

12th SCiUS Forum

bacteria. Cosmeceutical products that are free from harmful chemicals for sensitive skin, sensitive skin are
becoming more popular for the reason that acne is a skin problem that has received attention to be treated. To
take care of facial skin health and build confidence. But most of the cosmetics or acne products that are released
today do not use natural ingredients that contain chemicals that can damage sensitive skin. The researcher is
interested in applying friedelin extract in the field of cosmeceutical.

In our research, lead a less popular and often discarded cannabis root extract is often used in
cosmeceuticals. By being used to benefit in the form of a mask powder for acne. Therefore, using friedelin in
the form of a face mask that has properties for nourishing the face and treating acne will help nourish the inside
of the face and reduce acne problems as well.

Methodology
Friedelin extraction from cannabis roots

Takes the cannabis mold from the plant to dry. imported dry powder immersed in hexane solvent
for 5 days in a closed system at room temperature. Evaporate the extract with an Evaporator to separate hexane
from the extract. The extract was subsequently extracted with Silica gel chromatography, followed by a C18
solid phase extract column. The results of the friedelin extract were recorded. and prepare friedelin solutions
at concentrations of 1024.00, 512.00, 256.00, 128.00, and 64.00 μM. The next process is to send friedelin
extract to test TLC and HPLC.
Friedelin tests for antimicrobial properties with P.acne bacteria

by studying the antibacterial activity of Fridelin by Disc Diffusion method first take 1,000 mg of
64, 256 and 1024 µL and dissolve them with distilled water. then make the sample sterile by filtering
through a 0.2 um porous membrane and diluting the sample with an aseptic technique to obtain the sample.
with concentrations of 10, 100 ,1,000 mg/ml and undiluted. Samples 64, 256, and 1024 µL were used to test
the antibacterial activity against P. acnes bacteria by Disc Diffusion methods, In the test, 10 μl samples 64,
256, and 1024 µL were applied to a filter paper disc size 6 mm to obtain samples X, Y and Z doses of 0.1, 1,
10 mg and undiluted Test compared to standard Clindamycin 0.002 mg. Then take the P. acnes bacterial
suspension that has been adjusted turbidity to equal with 0.5 McFarland standards already spread the over the
surface of the BHI agar with Cotton Swab. Place the filter paper disc that has been sampled on the agar surface.
using a solvent that dissolves the sample into a negative control. Incubated in an incubator at 37±1°C for 48
hours in anaerobic conditions. Tested by measuring the diameter of the resulting bacterial inactivation region
in millimeters (mm).

Results, Discussion and Conclusion
The results of the extraction of friedelin from cannabis roots in the TLC test with the mobile phase of

n-Hexane/Ethyl acetate 4:1 and 1:1. To compare Standard friedelin extract with distilled water as a solvent, Standard
friedelin extract with DMSO as a solvent. and friedelin extract from cannabis root by using a visual examination
under UV light at a wavelength of 280 nm, it was found that all three substances consisted of only one concentrate
substance.

OB4_16_02/2

303

12th SCiUS Forum

The result showed that the standard friedelin extract with distilled water and friedelin extract from
cannabis root had similar displacement. The standard friedelin extract containing DMSO as the solvent had a short
displacement. It could be that standard fridelene is absorbed by the DMSO. The result found that friedelin
extracted from cannabis roots is pure.

In the HPLC analysis process, no sign of 95% standard fridelene was present because the DMSO
solvent was used in the standard friedelin dissolving stage. Block the signal of the standard friedelin. Only the signal
of the DMSO solvent was present at approximately 3-4 minutes period, during which the friedelin signal was
expected to appear, however, the extract from the cannabis root also no sign of friedelin as well.

figure 1 no sign of the 95% standard friedelin figure 2 no sign of friedelin from the cannabis root
extract

It could be that the extracted substance has a low friedelin concentration. As can be seen from the
results of the TLC treatment, it was found that friedelin is pure but still diluted, the HPLC analyzer cannot
detect substances in such low concentrations.

Table 1 antibacterial activity against P.acnes of friedelin extracts 64, 256, and 1024 µL and Clindamycin

Tested P.acnes inhibition region diameter (mm)

Sample quantity Plate 1 Plate 2 Plate 3 Mean±SD
(mg)

Not ND ND ND ND

dilute

64 µL 10 mg ND ND ND ND

1 mg ND ND ND ND

0.1 mg ND ND ND ND

Not ND ND ND ND

dilute

256 µL 10 mg ND ND ND ND

1 mg ND ND ND ND

0.1 mg ND ND ND ND

Not ND ND ND ND

dilute

1024 µL 10 mg ND ND ND ND

OB4_16_02/3

304

12th SCiUS Forum

1 mg ND ND ND ND

0.1 mg ND ND ND ND

distilled water

(Negative control) 10 mg ND ND ND ND

Clindamycin 0.002 mg 50.43 46.12 48.47 48.34±2.16
(Positive control)

*ND = Not detective
In the experiment to determine the concentration of frideline that inhibited the growth of acne-

causing bacteria, Propionibacterium acnes. The result is that Frideline extract does not inhibit this
bacteria. Unlike some triterpenoid compounds that have such properties. Some research has shown that
frideline inhibits the growth of some types of bacteria. Friedelin has a mechanism to destroy bacterial cell
membranes. It will create complexes with nucleophilic amino acids in proteins. This leads to the inactivation
of proteins within the cell membrane. and it can be assumed that the reason that friedelin is unable to inhibit
Propionibacterium acnes bacteria could be that because of this kind of bacteria produces biofilms that form the
extracellular matrix that protects cells from antibiotics and external damage and friedelin was unable to destroy
the biofilm. However, this reasoning is just the opinion of researchers. Because no research can determine the
mechanism which friedelin inhibits the growth of acne-causing bacteria P.acnes currently.

In the future, we planned to develop standardized production processes and make Friedelin-based
products, so we can get two products from this project including standard friedelin and friedelin base products
like acne mask powder. If use Friedelin in the acne mask power ingredient. The mask powder should have an
antiseptic to help inhibit the growth of bacteria with Frideline to help in the treatment of inflammatory acne, It
will make the product have a better quality of treatment

Acknowledgments
First of all, I would like to pay our gratitude to my advisor, Dr. Eaknarin Ruangrak for guidance

and lots of support to complete the project. Importantly, there would not have been this project without the
opportunity they had given to do this project. This project would not have been completed if there had not been
financial support from Science Classrooms in University-Affiliated schools supported by Ministry of Science
and Technology.

This project was supported by Science Classroom in University Affiliated School (SCiUS). The
funding of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This
extended abstract is not for citation.

References
1 . Kuete V, Nguemeving JR, Beng VP, Azebaze AG, Etoa FX, Meyer M, et al. Antimicrobial activity of the

methanolic extracts and compounds from Vismia laurentii De Wild (Guttiferae). Ethnopharmacology.
2007;109:372-379.

OB4_16_02/4

305

12th SCiUS Forum

Title : Isolation and Characterization of Probiotic Bacteria OB4_17_09
Field : from Local Fermented Food
Author : Biology and Biodiversity
Miss Naphamon Limranangkoon
School : Miss Pornnapha Prommanee
PSU. Wittayanusorn Suratthani School
Advisor : Prince of Songkla University, Surat Thani Campus
Asst. Prof. Dr. Patima Permpoonpattana
Miss Orathai Dangsawad
(Prince of Songkla University, Surat Thani Campus)
Miss Sitanun Yuwalaksanakun
(PSU. Wittayanusorn Suratthani School)

Abstract

This study aimed to isolate Bacillus sp. The five samples used were, plasom, budu, salted egg, plara and pickled
cabbage all of which were collected from Surat Thani. The species of Bacillus bacteria were identified using
morphological characteristics and biochemical tests. Probiotic properties of isolated Bacillus sp. such as acid and
bile salt tolerance, antimicrobial activity, hemolytic activity and antibiotics activity were examined. Results
revealed 34 strains of Bacillus sp. isolated from five examples of fermented food (gram-positive bacteria with
catalase-positive properties). However, there were only five isolated Bacillus sp. i.e. NPSN03, NPSN07, NPBH03,
NPRH03 and NPPH01 that showed a positive starch hydrolysis. All isolate showed non antibacterial activity
against Escherichia coli, Staphylococcus aureus and Pseudomonas aeruginosa. Moreover, the NPSN03, NPSN07,
NPBH03, NPRH03 and NPPH0 were sensitive to Ampicillin, Amoxicilin Cloxacilin and Tetracycline.
In conclusion, this is our study to show that five isolates Bacillus sp. isolated from fermented food have probiotic
potential, providing a better foundation for future use.

Keywords: Bacillus bacteria, Fermented food, Probiotics bacteria, Isolation

Introduction
Fermented food has been a staple of the human diet for thousands of years. The unique flavor and texture

of the fermented foods are contributed to by the presence of microorganisms and their byproduct produced during
fermentation. These microbes are referred to as “probiotics” Moreover, the previous research reported that
isolation of bacteria from fermented food can against foodborne pathogen and pathogenic bacteria. Plasom, Budu,
Salted egg, Plara and Pickled Cabbage are traditional fermented food widely consumed in Suratthani, Thailand.
Thus, in this study was to isolated bacteria from these food examples, to study the characteristics of bacteria with
probiotics properties and to investigate antagonistic activities of isolated bacteria to foodborne pathogen.

OB4_17_09 /1

306

12th SCiUS Forum

Methodology

The experiments were divided to 6 parts follows

Experiment 1: Bacterial Isolation
Bacteria was isolated from fermented food including Plasom, Budu, Salted egg, Plara and Pickled

cabbage from Suratthani, Thailand. Five grams of each sample were suspended in 0.85% w/v sodium cloride
solution Then, each samples was diluted with 0.85% sodium chloride at 10-1 to 10-6 In this experiment, Samples
were divided to 2 groups (First group 10-4 to 10-6 of dilution that no heated were spreaded on Nutrient Agar (NA);
Second group10-1 to 10-6 of dilution that heated were spreaded on Nutrient Agar (NA)). After incubating bacterial
colonies were count.

Experiment 2: Morphology and Biochemical test
The shape of the cells and gram of bacteria were investigated by gram straining. Then 6 biochemical tests

including catalase test, oxidase test, indole test, motility test and starch hydrolysis test were performed on Bacillus
sp. Isolated bacteria that performed on Bacillus sp. From morphology and biochemical test was selected for further
experiment.

Experiment 3: Antimicrobial susceptibility test
Bacterial culture was spread on Mueller Hinton Agar (MHA). Discs of ampicillin, amoxicillin, cloxacillin

and tetracycline were put on MHA and incubated at 37 degrees Celsius, for 24 hours. After that, Inhibition zone
was measure the diameter.

Experiment 4: Bacterial acid and Bile salt tolerance test
Bacteria was test an acid (pH 2, 3 and 4) and Bile salt (0.1%, 0.3% and 0.5%) tolerance test. Bacteria was

incubated for 3 hours and spread on NA. Two replicate plates were incubated for calculate percentage of bacterial
tolerance.

Experiment 5: Antagonistic Activities
Bacterial culture was treated in Luria Bertani (LB) and incubated in shacking incubator for 3 days. After

incubation, bacterial culture was centrifuged to get cell-free supernatant. Then, cell-free supernatant was drop on
Mueller Hinton Agar (MHA) that spread with Escherichia coli, Staphylococcus aureus and Pseudomonas
aeruginosa. Ciprofloxacin was used as positive control and Luria Bertani (LB) was used as negative control in this
experiment. After incubation, inhibition zone was measure the diameter.

Experiment 6: Hemolytic Activities
Bacteria was streak on Sheep Blood Agar and incubated at 37 degrees Celsius, for 24 hours.After

incubation, clear zone was observed. Escherichia coli, Staphylococcus aureus, Vibrio parahaemolyticus and
Bacillus subtilis were used as positive control.

OB4_17_09 /2

307

12th SCiUS Forum

Results

Experiment 1: Bacterial Isolation
36 different isolates of bacteria were selected from Plasom, Budu, Salted egg, Plara and Pickled Cabbage.

Experiment 2: Morphology and Biochemical test
From 36 isolates showed 16 gram-positive bacteria and Biochemical tests including Catalase test, Oxidase

test, Indole test, Motility test and Starch hydrolysis test were performed on Bacillus sp. 5 isolates including
NPSN03, NPSN07, NPBH03, NPRH03 and NPPH01 were assumed that these bacteria are Bacillus sp.

Table. 1 Morphological and Biochemical tests bacteria

Isolate Biochemical test

NPSN03 Shape Gram Catalase Oxidase Indole Motility Strach
NPSN07 Rod
NPBH03 Rod ++ - - ++
NPRH03 Rod
NPPH01 Rod ++ - - ++
Rod
++ - - ++

++ - - ++

++ - - ++

Experiment 3: Antimicrobial susceptibility test
Antimicrobial susceptibility test by Disc diffusion methods showed all isolates including NPSN03,

NPSN07, NPBH03, NPRH03 and NPPH01 and were sensitive to ampicillin, amoxicillin, cloxacilin and
tetracycline.

Table. 2 Antibiotic susceptibility of isolated bacteria

Isolated Inhibition zone (mm)
bacteria
Ampicillin Amoxicillin Cloxacillin Tetracycline
(10 µg/disc) (30 µg/disc) (1 µg/disc) (30 µg/disc)

NPSN03 21 mm. (S) 0 mm. (R) 0 mm. (R) 19 mm. (M)

NPSN07 13 mm. (M) 0 mm. (R) 10 mm. (R) 24 mm. (S)

NPBH03 49 mm. (S) 33 mm. (S) 32 mm. (S) 31 mm. (S)

NPRH03 14 mm. (M) 8 mm. (R) 11 mm. (R) 27 mm. (S)

NPPH01 11 mm. (R) 0 mm. (R) 8 mm. (R) 22 mm. (S)

S = Sensitive (diameter ≥ 20 mm), M = Moderate sensitive (diameter 12-19 mm), R = Resistance (diameter ≤ 11 mm)

Experiment 4: Bacterial acid and Bile salt tolerance test
From Morphology and Biochemical test an acid (pH 2, 3 and 4) and Bile salt (0.1%, 0.3% and 0.5%)

tolerance test showed all isolates including NPSN03, NPSN07, NPBH03, NPRH03 and NPPH01 as probiotics
resistant to low pH tolerance, High concentrate bile salt tolerance.

OB4_17_09 /3

308

12th SCiUS Forum

Experiment 5: Antagonistic Activities
Antagonistic Activities by Disc diffusion methods showed non antibacterial activity against Escherichia

coli, Staphylococcus aureus and Pseudomonas aeruginosa.
Experiment 6: Hemolytic Activities

For hemolytic activities, NPSN03 and NPRH03 showed gamma hemolysis activities. NPBH03 showed
alpha hemolysis activities. NPSN07 and NPPH01 showed beta hemolysis activities.

Conclusion
To conclude, isolation of Bacillus sp. From traditional fermented food. Total 36 isolate from five

examples. Isolated bacteria similar to Bacillus sp. 5 isolates (NPSN03, NPSN07, NPBH03, NPRH03 and
NPPH01). All isolated from local fermented foods as probiotics resistant to low pH tolerance, High concentrate
bile salt tolerance. Agar well diffusion showed no isolated revealing the antibacterial activity against Escherichia
coli, Staphylococcus aureus and Pseudomonas aeruginosa.

Acknowledgements
This project was supported by Science Classroom in University Affiliated School (SCiUS). The funding

of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This extended abstract
is not for citation.

References
Samedi L, Charles AL. Isolation and characterization of potential probiotic Lactobacilli from leaves of food plants

for possible additives in pellet feeding. Annals of Agricultural Sciences. 2019 Jun 1;64(1):55-62.
Edalati E, Saneei B, Alizadeh M, Hosseini SS, Bialvaei AZ, Taheri K. Isolation of probiotic bacteria from raw

camel's milk and their antagonistic effects on two bacteria causing food poisoning. New microbes and
new infections. 2019 Jan 1;27:64-8.
Saavedra L, Taranto MP, Sesma F, de Valdez GF. Erratum to “Home-made traditional cheeses for the isolation of
probiotic Enterococcus faecium strains”[Int. J. Food Microbiol. 88 (2003) 241–245]. International
Journal of Food Microbiology. 2004;2(97):231.
Anosike FC, Onyemah KO, Ossai CU, Ofoegbu JN, Okpaga FO, Ikpeama CC, Nkwegu FM, Nwankwo SC, Onyeji
GN, Inyang P, Ndifon EM. Probiotic potential and viability of bacteria in fermented African oil bean seed
(Pentaclethra macropyhlla): A mini review. Applied Food Research. 2022 Mar 30:100082.
Anosike FC, Onyemah KO, Ossai CU, Ofoegbu JN, Okpaga FO, Ikpeama CC, Nkwegu FM, Nwankwo SC, Onyeji

OB4_17_09 /4

309

12th SCiUS Forum

Title : The antiproliferative effects of crude extract from OB4_01_05
Citrus medica L. var. Sarcodactylis Swingle
Field : on human cancer cell lines.
Author : Biology and Biodiversity
Mr. Thanpapon Dhammajai
School : Ms. Nantorn Yotbuntherng
Advisor : Ms. Satanan Sanpabopit
Chiang Mai University Demonstration School
Prof. Prachya Kongtawelert, Ph. D.
Faculty of Medicine, Chiang Mai University

Abstract
Nowadays, cancer is the number 1 cause of all death. Higher rates of death than accidents and

heart disease (lung cancer, breast cancer and liver cancer) are accounting for liver and lung cancer are
most common in men while breast cancer is most common in women.

Finger Citron or Citrus medica L. var. sarcodactylis Swingle is a native plant of South and Southeast-
Asia. The fruit is a type of Citrus genus which has a different shape from others. It is commonly used for inhalers
or incense and Thai traditional medicine. In addition, finger citron contains important chemical constituents like
Flavonoids that can be found in the Citrus genus and have the effect of inhibiting the growth of human cancer cell
lines.

The extracts were tested for toxicity on A549 and Calu-01( lung cancer cells), MCF-7 and MDA-MB-
231 breast (cancer cells), HepG2 and HuH-7 (liver cancer cells). The crude extract extracted by ethanol solvent
was toxic to A549, MCF-7, HepG2, Calu-01 and HuH-7. While the one extracted by methanol solvent was toxic
to A549, MCF-7, HepG2, Calu-01 and HuH-7. The ethanolic crude extracts have an antiproliferation effect on
A549, Calu-01, MCF-7, and HepG2, meanwhile methanolic crude extracts have an antiproliferation effect on
Calu-01. The crude of Finger Citron extract does not have the cytotoxic effect but has an antiproliferation effect
on cancer cells.

Keywords : Finger Citron, Flavonoids, Human cancer cell lines, MTT assay.

Introduction
Cancer is the abnormal cell growth features and the ability to invade or spread to other parts of the body.

These characteristics are essential for cancer progression: cell proliferation and cell division without normal signal
stimulation, cell proliferation and cell division even with inhibitory signaling. Certain hallmarks of cancers are
having mechanisms to avoid normal cell death, the ability to divide indefinitely, abnormal angiogenesis, invasion
to neighboring tissues. And spread to distant sites. In 2012, approximately 14.1 million new cancers occurred
worldwide, causing 8.2 million deaths, or 14.6%. The most common type of cancer in men is lung cancer but in
women is breast cance

OB4_01_05/1
310

12th SCiUS Forum

A total of 3 types of cancer cells, two cell lines for each type were selected for the experiments.
For Type 1 lung cancer cells, A549 and Calu-01 were selected, while for type 2 breast cancer cells,
MDA-MB-231 and MCF-7, and Type 3 liver cancer cells, Hep-G2 and Huh-7 were selected respectively.

The selected plant was Fingers Citron, which is a citrus plant. Within the Fingers Citron, flavonoid
substances can help the inhibition of cancer cells.

Methodology
Cell lines and culture conditions

A549, MCF-7, MDA-MB-231, HepG2 and HuH-7 cell lines were cultured in DMEM supplemented with
10% FBS and Calu-01 was cultured in RPMI supplemented with 10% FBS. The cells were incubated 5% CO2
incubator at 37℃.
Preparing of crude extract

Fingers Citron were first cleaned with water and dried further at a moderate temperature of 60°C to make
them appropriate for grinding. These dried fruits were crushed into a fine powder. The powder (1.5 g) was then
dissolved with ethanol and methanol (7.5 mL). The solution was shaken overnight and filtered to remove
the precipitate. Then the solution was taken into the rotary evaporator to evaporate the ethanol and methanol.
And lastly, the extract was placed in a lyophilizer for drying by freeze-drying overnight.
Cell treatment

Calu-01, MDA-MB-231, MCF-7, HepG2, HuH-7 were seeded out 7,000 cells/well and A549 were
seeded out 5,000 cells/well then cells were treated with crude extract of Fingers Citron at various concentrations
(3.125,6.25,12.5,25,50,100 µg/ml ) for 24, 48 hours to detect cell viability.
Cell viability assay

The MTT assay was used to detect cell viability, add MTT reagent 20 µl/well and incubated for 2 hours
at 37℃ in a CO2 incubator. Then, the medium was removed and formazan crystals were dissolved by DMSO
(200 µl/well). Cell viability were measured at 540,620 nm in plate reader.

Results
Antiproliferation test

(Figure 1A, 1B, 1C and 1D) shows the result cell viability array of A549, MCF-7, HepG2, Calu-01,
MDA-MB-231 and HuH-7 treated with ethanolic extract and methanolic extract, respectively. At 48 hours
the growth of cancer cells consisting of A549, MCF-7, HepG2, Calu-01 and HuH-7 inhibited by the ethanolic-
extract were 64.69, 80.87, 81.06, 81.88 and 85.01 percentage of cell viability the methanolic extract reduced
the viability of A549, MCF-7, HuH-7, and Calu-01 by 82.63, 80.22, 85.99, and 84.73 percent, respectively

OB4_01_05/2

311

12th SCiUS Forum

A Non-aggressive cell B Non-aggressive cell

120 120

100 A549 100 A549
MCF-7 MCF-7
HepG2 HepG2

%Cell Viability 80 %Cell Viability 80

60 60

40 40

20 20

0 0

Control Med0ia.1%DMSO 3.125 6.25 12.5 25 50 100 Control Med0ia.1%DMSO 3.125 6.25 12.5 25 50 100
EtOH Crude extract (µg/ml) MeOH Crude extract (µg/ml)
Concentration of Concentration of

Aggressive cell Aggressive Cell

120 Calu-01 120 Calu-01
MDA-MB-231 MDA-MB-231
C HuH-7 D HuH-7
100 100
80
%Cell Viability 80 60%Cell Viability
40
60 20
0
40

20

0

Control Med0ia.1%DMSO 3.125 6.25 12.5 25 50 100 Co0n.tr1ol%DMMedSiOa
EtOH Crude extract (µg/ml) 3.125
Concentration of 6.25
12.5
25
50
100
Concentration of MeOH Crude extract (µg/ml)

Fig. 1 The Antiproliferation effect of ethanol and methanol crude extracts on non-aggressive cancer cell viability
(Figure 1A and 1B) and aggressive cancer cell viability (Figure 1C and 1D).

From the graphs (Figure2) showed the growth rates of cells treated with ethanolic extract and methanolic
extract. The results were compared at 0, 24, and 48 hours. The survival rate of cancer cells was not higher than the
survival of cancer cells not tested with the extract (control line). The rate of proliferation of the cancer cells were
lower when they were treated with the crude extracts, either ethanolic or methanolic extracts, comparing with the
untreated control.

A A549 with MCF-7 with HepG2 with C A549 with MCF-7 with
EtOH Crude extract EtOH Crude extract EtOH Crude extract MeOH Crude extract MeOH Crude extract
1.0 1.0 1.0
1.0 1.0
** 0.8 0.8
OD540/620 nm OD540/620 nm 0.8 0.8
(Relative Cell Number) 0.8 0.6 * 0.6 (Relative Cell Number)
Control Media 0.6 0.6 Control Media
0.6 0.4 * 100 100

0.4 0.2 0.4 0.4 0.4 Control Media
100
0.2 0.0 0.2 0.2 0.2
0 24 48
0.0 Time (hr.) 0.0 0.0 0.0
0 24 48 0 24 48 0 24 48 0 24 48
Time (hr.) Time (hr.)
Time (hr.) Time (hr.)

B Calu-01 with HuH-7 with D Calu-01 with HuH-7 with

EtOH Crude extract EtOH Crude extract MeOH Crude extract MeOH Crude extract

1.0 1.0 1.0 1.0

OD540/620 nm 0.8 0.8 Control Media OD540/620 nm 0.8 0.8
(Relative Cell Number) 100 (Relative Cell Number)
0.6 *** 0.6
0.6 *** 0.6

*** 0.4 0.4 0.4

0.4

0.2 0.2 0.2 0.2

0.0 0.0 0.0 0.0
0 24 48 0 24 48 0 24 48 0 24 48

Time (hr.) Time (hr.) Time (hr.) Time (hr.)

OB4_01_05/3
312

12th SCiUS Forum

Fig. 2 The Antiproliferation effect of ethanol crude extract on A549, MCF-7, HepG2 (Figure 2A); Calu-01,
HuH-7 (Figure 2B) and The Antiproliferation effect of methanol crude extract on A549, MCF-7 (Figure 2C);
Calu-01, HuH-7 (Figure 2D).

Conclusion
The study, show that ethanol Crude extract was able to inhibit the growth of A549, MCF-7, HepG2,

Calu-01, and HuH-7 cancer cells. Methanol Crude extract can inhibit the growth of A549, MCF-7, Calu-01 and
HuH-7.

At the highest concentration of ethanol crude extract has the highest antiproliferation effect at 48 hours
on A549, and methanol crude extract has the highest antiproliferation effect at 48 hours on MCF-7.

Furthermore, it was discovered that ethanolic crude extracts inhibited the growth of each type of cell that
was selected more than methanolic crude extracts. In comparison to ethanolic crude extracts that had an effect in
four cancer cell lines (A549, MCF-7, HepG2, Calu-01), another crude extract had an effect in one cancer cell line
(Calu-01).

The ethanolic crude extracts have an antiproliferation effect on A549, Calu-01, MCF-7, and HepG2,
meanwhile methanolic crude extracts have an antiproliferation effect on Calu-01.

The Crude of Fingers Citron extract does not have the cytotoxic effect but has an antiproliferation effect
on human cancer cell lines.

Acknowledgments
This project was supported by Science Classroom in University Affiliated School (SCiUS). The funding

of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This extended abstract
is not for citation.

References
1. Denaro, M., Smeriglio, A., Xiao, J., Cornara, L., Burlando, B. and Trombetta, D. New insights into
Citrus genus: From ancient fruits to new hybrids. Food Frontiers 2020;1(3):305-328.
2. J. Chu, S. Li, Z. Yin, W. Ye, Q. Zhang. Simultaneous quantification of coumarins, flavonoids and
limonoids in Fructus Citri Sarcodactylis by high performance liquid chromatography coupled with
diode array detector. J Pharm Biomed Anal 2012;66:170-175.
3. Mondal M, Saha S, Sarkar C, Hossen MS, Hossain MS, Khalipha ABR, et al. Role of Citrus medica L.-
Fruits Extract in Combatting the Hematological and Hepatic Toxic Effects of Carbofuran. Chem
Res Toxicol 2021;34(8):1890-1902.

OB4_01_05/4

313

12th SCiUS Forum

Title: Selection of Probiotic Lactic Acid Bacteria OB4_15_05
from Pickled Wild Spider Flower

Field: Biology and Biodiversity

Author: Ms. Natchayada Ponjorn and Ms. Aksarapak Chuabankoh

School: PSU.Wittayanusorn school, Prince of Songkla University

Advisor: Assoc. Prof. Dr. Preeyanuch Bovornreungroj (Prince of Songkla University)

Abstract:
This experimental research aimed to study chemical composition and the number of lactic acid

bacteria isolated from pickled wild spider flower changing in fermentation process, select probiotic lactic acid
bacteria from the pickled wild spider flower, and identify probiotic bacteria selected from pickled wild spider
flower. The sample consisted of wild spider flower from Nakhon Si Thammarat province which are pickled
for 0, 24, 48 and 72 hours.

These samples were determined the chemical composition including organic acid, salt and reducing
sugar by using a pH meter, titration, salinity refractometer and DNS method respectively. The results
illustrated that the concentration of organic acid, salt and reducing sugar increased during the fermentation
process. Moreover, these samples were diluted to count the number of lactic acid bacteria by pour plate
technique, and there was the number of lactic acid bacteria between less than 2.5 x 103 and 1.1 x 106 CFU per
ml. Then, these lactic acid bacteria were isolated to 25 isolates by bacteria characterization. There were both
cocci and rod, and all of them were gram-positive and non-catalase enzyme producing bacteria. After that,
these lactic acid bacteria were tested for selecting probiotics by the study of gastrointestinal tract imitation and
the study of safety in humans. However, there were 5 isolates including WS24-05, WS48-05, WS72-07,
WS72-08 and WS72-11 which tended to be probiotics with acid and bile salt tolerance, alpha-hemolysis, and
4 of antibiotics recommended from European Food Safety Authority (EFSA) susceptibility. Finally, these 5
isolates were identified using MALDI-Biotyper as Weissella cibaria which was reported as probiotic bacteria.

The result showed that lactic acid bacteria isolated from pickled wild spider flower were probiotic
bacteria which were beneficial organisms for the human body. Therefore, the isolated lactic acid bacteria in
this study can be used as a starter for other fermented products. Furthermore, the finding might add value and
enhance pickled wild spider flower which is a local product in the South of Thailand.

Keywords: Wild spider flower, Fermented food, Lactic acid bacteria, Probiotics, Weissella cibaria

Introduction
Wild spider flower (Cleome gynandra L.) is an annual plant growing by the roadside over several

countries, also in Thailand. There are a lot of benefits in Thai medical terms. Wild spider flower is usually
pickled as a traditional product based on local wisdoms in South of Thailand. Additionally, it is reported to be
able to isolate lactic acid bacteria, which helps to break down potentially substances to ensure safety.1
Nevertheless, pickled wild spider flower were well-known among the elderly, unlike other pickles.

OB4_15_05/1
314

12th SCiUS Forum

Lactic acid bacteria are gram-positive bacteria and have both rod and cocci. A study has shown that
lactic acid bacteria isolated from pickled wild spider flower was able to inhibit pathogens due to the lactic acid
produced, which is one of the probiotic properties and are most likely probiotic bacteria.2 Probiotics were
recognized as beneficial microorganisms. Moreover, probiotic bacteria can be selected by testing the probiotic
properties, which are acid-base and bile salt tolerance, the ability to adhere to intestinal cells, and also test for
safety in humans such as antimicrobial susceptibility and degradation of blood cells.3

This significance brought to this study aimed to study the chemical composition changing during the
fermentation process, the amount of lactic acid bacteria, to select probiotic lactic acid bacteria and to identify
species of probiotic lactic acid bacteria from pickled wild spider flower. Consequently, this may improve the
local wisdom and develop into a healthy product.

Methodology
Part 0: Pickled wild spider flower sample preparing

Wild spider flower was collected from Nakhon Si Thammarat and added salt, cooked rice and water.
After that, stored it for 0, 24, 48 and 72 hours.
Part 1: Study of chemical composition changing in fermentation process

1.1 Determination of organic acid
Measured pH value with a pH meter. Following this, used a titration method to find the concentration
of organic acid by using 0.198 M Sodium hydroxide solution as a titrant. Then, pipetted the samples and
titrated to find an equivalence point.
1.2 Determination of salt concentration
Measured the salinity by using a salinity refractometer. In the beginning, placed the sample on the
prism, then looked through the eyepiece to find the amount of salt.
1.3 Determination of reducing sugar
Using the DNS method by preparing 0.0, 0.2, 0.4, 0.6, 0.8, and 1.0 mg/ml glucose solution. The
absorbance values were then measured with UV-VIS Spectrophotometer at wavelength of 520 nm, and the
graph was compared to the absorbance values from the samples.
Part 2: Study of the amount of Lactic acid bacteria changing in the fermentation process
Added 25 g of each sample and 225 ml of 0.1% peptone water, and mixed them together with a
stomacher. After that, dilute them with 0.1% peptone water to have a concentration from 10-4 to 10-2 for 0, 24
and 48-hour-sample and 10-6 to 10-4 for 72-hour-sample. Using the pour plate technique to count the total of lactic
acid bacteria. The characteristics of lactic acid bacteria were determined by Gram staining and catalase activity.
Part 3: Selection of probiotic bacteria from pickled wild spider flower
3.1 Acid-base tolerance
Selected 106 CFU/ml surviving lactic acid bacteria and cultivated into MRS broth at pH 2, 3, 4, 7,
and 8 adjusted with 1 N NaOH and 37% HCl. Following that, incubated at 37°C for 3 hours with 150 rpm and
used the pour plate technique to count the viable colonies.

OB4_15_05/2

315

12th SCiUS Forum

3.2 Bile salt tolerance
Selected 106 CFU/ml of the viable lactic acid bacteria and cultivated into MRS broth with 0.3, 0.6,
and 1.0 % of bile salts at 37°C for 3 hours and 150 rpm in a shaking incubator.
3.3 Hemolysis activity test
Hemolysis activity was performed by streaking lactic acid bacteria on blood agar with 5% sheep
blood and incubated at 37°C for 18-24 hours. The changes were observed in the clear zone around the colonies
and characterized the degradation.
3.4 Antibiotic susceptibility
The antibiotic activity was determined by Ampicillin (10 μg), Tetracycline (30 μg), Chloramphenicol (30 μg)
and Erythromycin (15 μg). Swabbed the bacteria on MRS agar. Then, placed the antibiotic disc. In the end, measured
the diameter of the clear zone and compared it with the Clinical and Laboratory Standards Institute (CLSI).
Part 4: Identification of probiotic bacteria selected from pickled wild spider flower
Streaked probiotic lactic acid bacteria on MRS agar and incubated at 37°C for 18-24 hours to select
a single colony. Following that, bacteria were sent to the Office of Scientific Instruments and Testing Prince
of Songkla University (OSIT) for identification using MALDI-Biotyper.

Results, Discussions and Conclusions
Firstly, from the study of chemical compositions changing during the fermentation process,

the results illustrated that there was a significant increase in the amount of organic acid considered by the
decrease of pH value measured by pH meter (5.1 ± 0.02 - 6.0 ± 0.02) and the increase of organic acid
concentration determined by titration (0.9 ± 0.00 - 2.9 ± 0.14%) during the fermentation process according to
the previous study reported that pH value of kimchi fermented for 1 to 8 weeks decreased while organic acid
concentration increased significantly.4 Also, the concentration of salt determined by salinity refractometer
increased during the fermentation process (3.9 ± 0.12 - 5.7 ± 0.12%). Moreover, there was an increase in the
concentration of reducing sugar determined by the DNS method (4.0 ± 0.02 - 10.1 ± 0.04 g/L) during the
fermentation process in accordance with the gluconeogenesis process that changes lactate to glucose.5 To conclude,
the chemical compositions were changing during the fermentation process according to the first hypothesis.

Secondly, from counting lactic acid bacteria growing in MRS agar and changing bromocresol purple
0.004% from purple to yellow, the result illustrated that there were between less than 2.5 x 103 and 1.1 x 106
CFU per ml. Furthermore, these lactic acid bacteria were isolated to 25 isolates, there are from 0-hour-sample
2 isolates, 24-hour-sample 5 isolates, 48-hour-sample 7 isolates and 72-hour-sample 11 isolates. All of these
25 isolates were characterized by Gram staining and catalase enzyme producing tests. The results illustrated
that there were both cocci and rod bacteria which were gram-positive bacteria, and there were none catalase
producing bacteria. Likewise, the previous experiment reported that lactic acid bacteria were both cocci and
rod bacteria, and they were gram-positive bacteria.6 Therefore, the number of isolated lactic acid bacteria was
changing during the fermentation process according to the second hypothesis.

After that, these 25 isolates were tested for selecting probiotic bacteria by acid and base tolerance,
bile salt tolerance, hemolytic activity and antimicrobial susceptibility testing. The results illustrated that there
were 5 isolates (WS24-05, WS48-05, WS72-07, WS72-08 and WS72-11) which tended to be probiotic
bacteria. They were capable of growing in acid-base and bile salt conditions in accordance with the previous

OB4_15_05/3

316

12th SCiUS Forum

study in 2014, Elavarasi V et al. reported that Weissella cibaria had the ability of acid and bile salt tolerance.7
Although there was a green clear zone occurring around colonies on blood agar in hemolytic activity testing
defined as alpha-hemolysis, Rebecca Buxton’s study in 2005 reported that the green clear zone was
Methemoglobin which is the hemoglobin oxidized by hydrogen peroxide produced by bacteria for inhibiting
the pathogen.8 In addition, from observing this reacted red blood cell under a microscope, it demonstrated that
there is no destruction of the red blood cell. As such, this green inhibition zone might not be hemolysis.
Besides, they were susceptible to 4 antibiotics which were recommended by EFSA consisting of Ampicillin,
Tetracycline, Erythromycin and Chloramphenicol. Likewise, Elavarasi V et al. reported that Weissella cibaria
was susceptible to these 4 antibiotics and 5 more.7 Consequently, there were isolates of lactic acid bacteria
that tended to be probiotic bacteria according to the third hypothesis.

Finally, these 5 isolates were sent to identify the species by MALDI-Biotyper. The results illustrated
that they were Weissella cibaria which had been reported as probiotic bacteria.9 In conclusion, the species of lactic
acid bacteria identified by MALDI-Biotyper is one of probiotic bacteria in accordance with the fouth hypothesis.

Acknowledgements
This project was supported by Science Classroom in University Affiliated School (SCiUS).

The funding of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation.
This extended abstract is not for citation.

References
1. Hayeeyusoh N et al. Amount and isolates of lactic acid bacteria in pickled local vegetables and fruits for
inhibition pathogenic bacteria. Yala: Science Technology and Agricultural; 2016.
2. Sansuk T and Pakdeedachakiat W. Isolation of lactic acid bacteria probiotic for inhibiting food pathogen.

Journal of Research and Development Buriram Rajabhat University 2014;9: 40-45.
3. Phapagrangkul P. Probiotics. Pathum Thani: Parbpim; 2020.

4. You SY. Changes in the Physicochemical Quality Characteristics of Cabbage Kimchi with respect to

Storage Conditions. Journal of Food Quality 2017: 1-7.

5. Thong-Eam J. Relationship of anaerobic performance among measured with wingate anaerobic test,

running base anaerobic sprint test and four 40 yards sprint test. Journal of sports science and technology 2016;16: 75-82.

6. Juntang P. Isolation and characterization of lactic acid bacteria phages from fermented fish products in
Thailand [dissertation]. Bangkok: Srinakharinwirot University; 2010.
7. Elavarasi V. screening and characterization of Weissella cibaria isolated from food source for probiotic

properties. International Journal of Computer Applications 2014: 29-32.
8. Buxton R. Blood agar plates and hemolysis protocols. American society for microbiology 2005: 1-8.

9. Lakra AK et al. Some probiotic potential of Weissella confusa MD1 and Weissella cibaria MD2 isolated

from fermented batter. Food science and technology 2020;5: 1-26.
OB4_15_05/4

317

12th SCiUS Forum

List of Science Projects 12th SCiUS Forum
Oral presentation

Biology and Biodiversity Group 5
Saturday August 27, 2022

No. Code Title Author School
PSU Wittayanusorn
1 OB5_17_08 Efficiency of herbal jelly Miss Wimonwan Saeueng Surat Thani School
Islamic Science
candy to inhibit oral bacteria Mr. Thanakorn Rakton Demonstration School
Naresuan University
2 OB5_19_01 Effects of cinnamon oil on Miss Wan-Aymee Saehdeng Secondary
Demonstration School
brain function Miss Fitdao Yueran
PSU.Wittayanusorn
3 OB5_03_06 Development of Loop- Miss Teewara Pudpoo School

Mediated Isothermal Miss Waratchaya Meeponsawan Demonstration School
of Khon Kaen
Amplification (LAMP) for University

disease detection on durian Islamic Science
Demonstration School
4 OB5_15_07 Investigation and isolation of Miss Jinnapat Sangkao
Surawiwat School,
medical rubber gloves Miss Pitchayaporn Kongdee Suranaree University of
Technology
degrading microorganisms
PSU.Wittayanusorn
from soil School
Surawiwat School,
5 OB5_04_07 Effect of essential oils against Miss Patcharida Arvonthom Suranaree University of
Technology
biofilm of antibiotic-resistant Miss Apitchaya Juwattanaprasert Princess Sirindhorn's
College
bacteria isolated from

Chronic Rhinosonisitis

patients

6 OB5_19_04 The Efficacy of Black Miss Farhana Buwaeyusoh

Glutinous Rice (Mhor 37)

Extract for Use in Plant

Chromosome Staining

7 OB5_18_03 Effect of Hydroxyapatite Mr. Nachaphon Maleewong

Nanoparticles on the Growth Mr. Burathat Khongsuk

of Green Oak (Lactuca Mr. Kanon Srijun

scariola) in Hydroponic

System.

8 OB5_15_01 Antibacterial efficacy of Miss Pawanrat Naphaphongsuriya

silver nanoparticles Miss Pemika Kesornsawat

9 OB5_18_01 Investigating Clinical Miss Issaree Kittisupaset

Correlation of Calcium Miss Tanyarat Anotaipaiboon

Activities in Liver Cancer Mr. Pantath Jaengbunjurdwong

10 OB5_12_02 Development of Rice on Miss Waranya Thongkam

Quality an Extension of Shelf Miss Warinyupa Weaweerakupt

Life with Chitosan

318

No. Code Title Author 12th SCiUS Forum

11 OB5_03_07 Analysis of aflatoxin B1 in Miss Rasita Soypetcasem School
Naresuan University
herbs and spices and Miss Chonlada Mueangsong Secondary
Demonstration School
exposure assessment Islamic Science
Demonstration School
12 OB5_19_03 Antifungal and antibiofilm Mr. Arnas Naengdam
Demonstration School
activity of denture soft liner Miss Nada Beraheng Prince of Songkla
University, Pattani
incorporated with ethanol Campus

extract of Melastoma PSU Wittayanusorn
Surat Thani School
malabathricum leaf

13 OB5_16_01 Effect of Chitin-Binding Miss Sasita Seh

Proteins from Para Rubber Miss Nihusna Nadaman

Seeds on Phytopathigenic

Fungi and Bioactivity

Enhancement

14 OB5_17_06 Development of edible Miss Warissara Nateetorn

coating from Gracilaria Miss Witsuta Noosing

fisheri and Tannin of banana

peel extracts for extending

shelf life of 'Nam Dok Mai'

mango fruit

319

12th SCiUS Forum

Title : Efficiency of herbal jelly candy to inhibit oral bacteria OB5_17_08

Field : Biology and Biodiversity
Author : Mr.Thanakorn Rakton

Ms.Wimonwan Saeueng
School : PSU Wittayanusorn Suratthani School & Prince of Songkla University, Suratthani Campus.
Advisor : Assoc.Prof.Dr.Somwang Lekjing (Prince of Songkla University, Surat Thani Campus)

Ms.Sitanun Yuwalaksanakun (PSU. Wittayanusorn Suratthani School)

Abstract :
Halitosis is a significant disease. Halitosis occurs when bacteria infects the oral cavity resulting to

bad breath and several other dental diseases. Thus, this study aimed to evaluate the efficiency of five herbal
extracts including Indian gooseberry, myrobalan wood, bellerica wood, mangosteen and chamomile to inhibit
oral bacteria using agar well diffusion method and to develop herbal jelly candy product that inhibits oral
bacteria. Four isolates (A01, A02, B01 and B02) that selected from the oral cavity were tested. The results
found that all five herbal extracts with the concentration of 250 mg/ml can inhibit only B01. Inhibition zones
of Indian gooseberry, myrobalan wood, bellerica wood, mangosteen and chamomile were 17.3 ± 2.5, 17.7 ±
1.2, 23.0 ± 3.0, 27.0 ± 3.5 and 16.3 ± 0.6 mm, respectively. Moreover, mangosteen extract which has shown
the best antimicrobial activity was then developed into herbal jelly candy fomula with appropriate odor and
taste and was accepted by consumers well. In experiment, mangosteen extract was evaluated in different
concentrations : 0 %, 5 %, 10 % and 15 % by weight. As for the physical properties of the herbal jelly candy,
the results showed that the color of the jelly candy increases with the increasing concentration of mangosteen
extract. As for the chemical properties, the amount of moisture are set as : 0 %, 5 %, 10 %, 15 % respectively.
Furthermore, the water activity (aw) ranging from 0.76 – 0.78. The 0 % of mangosteen extract received the
highest satisfaction score and followed by 5 % moisture. For sensory evaluation, was found that the 5 % of
mangosteen extract received the most acceptance. Moreover, herbal jelly candy with 5 % of mangosteen
extract will be developed in further studies.

Keywords : oral bacteria, herbal candy, bacterial inhibition

Introduction
The oral cavity is an important organ for humans. The people who have good oral hygiene are

perceived as people with good personality. However, most people have a problem about oral health such as
halitosis and tooth decay, which are caused by oral bacteria, this is because the oral cavity is a place of bacterial
accummulation. Moreover, the human oral cavity is different depends on eating habits and oral care.

Streptococcus mutans, Porphyromonas gingivalis, Staphylococcus aureus and Lactobacillus sp. were
usually found in human oral cavity resulting in stench and several dental diseases. As of today, there are many
commercial mouth sprays. Most of these products contain chemical agents which ingredients may cause
allergy to consumers. Therefore, herbs are one of the alternatives in this case. The previous research reported
that there are many herbs showing good antibacterial activity such as Indian gooseberry, myrobalan wood,

OB5_17_08/1

320

12th SCiUS Forum

belerica myrobalan, mangosteen and chamomile. These herbs have not been used to make jelly candy products
for reduction of oral bacteria and halitosis.

Therefore, this study aims to evaluate the efficiency of herbal extracts to inhibit oral bacteria and to
develop herbal jelly candy product inhibits oral bacteria.

Methodology
1. Isolation of the oral bacteria
Isolation of the bacteria within the oral cavity by swab and then inoculated onto Nutrient agar (NA)

and incubated at 37ºC for 16 - 18 hours. The different bacteria were observed and isolated.
2. Antimicrobial activity by agar well diffusion
2.1 Preparation of herbal extracts
250 mg of each of the five herb extracts including Indian gooseberry, myrobalan wood,

belerica myrobalan, mangosteen, and chamomile extract were dissolved with 10 % Dimethyl sulfoxide
(DMSO) for stock solution (250 mg/ml).

2.2 Agar well diffusion method
Bacterial colonies were suspended in Mueller Hinton broth (MHB) and incubated at 37°C
for 16 - 18 hours. Adjusted to a density equal to 0.5 McFarland standard (Bacterial suspension with a 1.5x108
CFU/ml). Then, bacterial suspension was swab on Mueller Hinton agar (MHA). Next, a hole is punched and
herbal extract is added from 2.1 into the well and incubated at 37°C for 24 hours. Diameters of the clear zones
were measured. A concentration of cefazolin at 100 µg/ml was used as positive control while MHB and 10 %
DMSO were used as the negative control.
3. Development of herbal jelly candy product
The herbal extract that showed the best antibacterial activity was selected for the jelly candy product.
Then, the ratio of herbal extracts was determined at 0, 5, 10, 15 % by weight. The ingredients contain gelatin,
xylitol, water, citric acid and herbal extracts. The product properties were examined including water activity,
color (L*, a*, b*) and moisture content properties. The sensory quality was tested using 9 - point hedonic scale
in terms of color, odor, appearance, taste, texture and overall liking by using 30 panelist, in which a score of
1 = dislike extremely; 5 = neither like nor dislike; 9 = like extremely (Meilgaard et al., 2006)
4. Statistical analysis
All statistical analyses were performed by using SPSS. Analysis of variance (ANOVA) was used to
evaluate the significance and was set to 5 % level (P < 0.05). The data were recorded using Microsoft Excel.

Results and discussion
Four isolates of bacteria were found, namely A01, A02, B01 and B02, all isolates are Gram – positive

bacteria in accordance with previous researches, they reported that Gram – positive bacteria are found in oral
cavity such as S. mutans, P. gingivalis, S. aureus and Lactobacillus sp. (Wang et al., 2019). These 4 isolates
were tested for antimicrobial activity by Agar well diffusion method. The results found that all five herbal
extracts can inhibit only B01. Moreover, mangosteen extract showed the best antimicrobial activity when
compared with other herbal extracts in this experiment. The data is shown in Table 1.

OB5_17_08/2

321

12th SCiUS Forum

Table 1 : The results of bacterial inhibition from herbal extracts

Clear zone (mm.)

Isolates Indian Myrobalan Beleric Mangosteen Chamomile Cefazolin MHB 10%

gooseberry wood myrobalan 100 µg/ml DMSO

A01 - - - - - 14.3±0.6 - -

A02 - - - - - 17.7±1.2 - -

B01 17.3±2.5a 17.7±1.2a 23.0±3.0a 27.0±3.5bc 16.3±0.6a 28.5±6.5c - -

B02 - - - - - 17.3±1.2 - -

Data are expressed as mean ± SD
Different lowercase letters within the same column indicate significant difference (P < 0.05)

From previous research, there has been a study of substances in the peel of mangosteen was

discovered to contain xanthones. Both Gram-positive and Gram-negative were inhibited by xanthones
(Tadtong, 2009)

The appearance of the candy is a dark brown from mangosteen extract with increasing concentration.

The texture is soft and flexible. However, the flexibility of samples decreased when the amount of mangosteen

extract increased as shown in Figure 1.

(A) (B) (C) (D)
Figure 1 : Appearance of candy product at 0 % (A) 5 % (B) 10 % (C) and 15 % (D) of mangosteen extract

concentration.

Evaluation sensory was using 9 - point hedonic scale (Table 2). The four formulas were not

statistically different in terms of odor (P < 0.05), and most panelists demonstrated satisfaction with the formula

containing 0 % of mangosteen extract in terms of odor, color, appearance, taste and overall liking, and followed

by containing 5 % of mangosteen extract. Therefore, the appropriate amount of mangosteen extract at 5 % is

the most suitable ingredient because the panelists received the highest satisfaction score.

Table 2 : Sensory scores of herbal jelly candy in various concentration of mangosteen extract

Attributes 0 % 5 % 10 % 15 %

Odor 7.70±1.55a 7.57±1.58a 7.17±1.49a 7.23±1.71a
Color 8.33±1.07c 7.67±1.35b 7.27±1.12ab 6.83±1.49a
Appearance 8.17±1.07b 7.80±1.35ab 7.67±1.11ab 7.43±1.43a

Taste 8.17±1.00c 8.00±0.93c 7.20±1.17b 6.10±1.58a

Texture 7.43±1.50c 7.47±1.50c 6.57±1.36b 5.60±1.98a

Overall liking 8.10±1.11c 7.77±1.05bc 7.27±1.09b 6.03±1.40a

Data are expressed as mean ± SD
Different lowercase letters within the same column indicate significant difference (P < 0.05)

OB5_17_08/3

322

12th SCiUS Forum

Physical and chemical properties of jelly candy products including the value of aw, surface color and

moisture content. The results are shown in Table 3. The characteristics of jelly candy products are indicated
as intermediate food mositure, it should have the value of aw at 0.60 – 0.85, table 3 showed the value of aw in
the range of 0.76 – 0.78. Therefore, bacteria and fungi was growth retardation.

Table 3 : Physical and chemical properties of mangosteen candy

Properties 0% 5% 10 % 15 %

Water activity (aw) 0.78±0.01b 0.76±0.00ab 0.76±0.01ab 0.76±0.00a

Color values

L* 72.99 ± 2.60d 42.97 ± 0.37c 45.93 ± 1.27b 49.23 ± 0.16a

a* -0.12 ± 0.80a 5.79 ± 0.49b 6.55 ± 0.38b 6.55 ± 0.32b

b* -3.86 ± 1.18a 13.41 ± 1.32b 15.98 ± 1.09c 11.16 ± 0.97d
Moisture content (%) 19.23 ± 1.04b 14.54 ± 0.76a 14.13 ± 2.24a 13.56 ± 1.02a

Data are expressed as mean ± SD
Different lowercase letters within the same column indicate significant difference (P < 0.05)

Conclusion
The efficiency of five herbal extracts inhibits oral bacteria using agar well diffusion method. Four

isolates (A01, A02, B01 and B02) that were extracted from the oral cavity were tested. The results found that
all five herbal extracts can inhibit only B01. Mangosteen extract showed the best antimicrobial activity. It was
added in the jelly candy product and was later developed into different concentrations. When considering by
sensory scores, it was found that the 5 % of mangosteen extract is the most preferred.

Acknowledgements
This project was supported by Science Classroom in University Affiliated School (SCiUS). The

funding of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This
extended abstract is not for citation.

References
Somsap OA, Piboonpol G, Payanglee K, Daengrot C. Antibacterial and Antioxidant Activity of Nam-Nam

Fruit Extract. Princess of Naradhiwas University Journal. 2019;11(2):156-67.
Nanasombat S, Kuncharoen N, Ritcharoon B, Sukcharoen P. Antibacterial activity of thai medicinal plant

extracts against oral and gastrointestinal pathogenic bacteria and prebiotic effect on the growth of
lactobacillus acidophilus. Chiang Mai J Sci. 2018;45(1):33-44.
Takeungwongtrakul S, Thavarang P, Sai-Ut S. Development of Strawberry gummy jelly with reduced sugar
content from strawberry syrup. International Journal of Agricultural Technology. 2020;16(5):1267-
76.

OB5_17_08/4
323

12th SCiUS Forum

Title : Effects of cinnamon oil on brain function OB5_19_01
Field :
Author : Biology and Biodiversity

School : Miss Fitdao Yueran
Advisor :
Miss Wan-aymee Saehdeng

Islamic Sciences Demonstrations School, Prince of Songkla University, Pattani Campus

Miss Rodiya Manor (Prince of Songkla University, Pattani Campus.)

Dr. Suparada Surapanthanakorn (Prince of Songkla University, Pattani Campus.)

Abstract
Cinnamon is a Thai herb that has a unique smell. It is widely used in health care and traditional medicine.

There are many benefits in antibacterial and antifungal properties. Moreover, It was claimed to reduce stress.
However, the study in brain function is still less. Therefore, this study was interested in effects of cinnamon oil on
brain activities. In this study, 10 participants were included. EEG and ECG were recorded during distilled water,
lavender oil and cinnamon oil inhalation. Each inhalation was operated by 3 minutes of eyes opened and 3 minutes
of eyes closed, respectively. At the end of the experiment, participants were asked to fill a satisfaction
questionnaire between the scents of cinnamon essential oil and lavender essential oil. In addition essential oils
compositions were analyzed using GC-MS. Main chemical composition of cinnamon essential oil is
cinnamaldehyde while lavender essential oil is linalool and linalyl acetate. Result of brain activities showed that
beta frequency significantly decrease during cinnamon oil inhalation with eyes closed. Furthermore, both lavender
oil and cinnamon oil inhalation tend to increase when compared with distilled water inhalation group. ECG can
be linked to the autonomic nervous system and the result did not show significant difference between groups.
Overall satisfaction revealed that participants liked scent of lavender more than cinnamon. This study can
concluded that cinnamon oil affected on beta frequency however it did not affect on autonomic nervous system.
Therefore, cinnamon oil may be produce anxiolytic effect on brain function due to the decreasing of beta wave
and smell preference is not directly related to changes in EEG and ECG.

Keywords : Cinnamon essential oil, EEG, ECG, GC-MS, Overall satisfaction

Introduction
In daily life many people face with stress and anxiety that are possible causes of mental illness.

Aromatherapy is alternative way to relieve stress or anxiety. Fragrance is a choice that people choose to reduce

OB5_19_01/1
324

12th SCiUS Forum

stress. Cinnamon is a herb that has a unique smell. Many cuisines use it as aromatic condiment and flavoring
additive. Cinnamon oil has sweet and warming scent. It is mixed in herbal inhaler and it was claimed to relieve
stress and anxiety. However, the study effects of cinnamon oil on brain function is still less.

Human brain contains billions of neurons. They are interconnected by transporting electrical particles
through cell to cell by stimulation from neurotransmitters and release electrically charged particles along the
nerve fibers. This electrical activities can be recorded using electroencephalography ( EEG) and it presents in
form of brain wave. EEG can be used to diagnose brain abnormality such as epilepsy. Interestingly, it can
evaluate brain activities during different conditions such as attentional test, different odors, different emotions.
Brain wave can be classified into 5 frequency that are delta wave ( 1-4 Hz) , theta wave ( 5-8 Hz) , alpha wave
( 9 - 1 3 Hz) , beta wave ( 14-32 Hz) and gamma wave ( 33-45 Hz) . Each frequency is dominant in different
conditions. Delta wave show during sleep, theta wave presents in drowsiness, alpha oscillation is dominant
during relaxed and passive attention. Furthermore, beta frequency is showed during stress, anxiety and external
attention. Finally, gamma band is powerful during concentration. Autonomic nervous system can be detected by
heart rate variability ( HRV) using electrocardiography ( ECG) . This study is focus on brain activities during
essential oils inhalation especially cinnamon oil. Furthermore, satisfaction of participants is also evaluated.

Methodology
The experiments were divided into 6 parts as follows,

Part 1: Preparation for EEG measurement
1.1 Measure the length of the head in the y-axis and the x-axis to mark the location of electrode

placement using 10-20 system.
1.2 O1 , O2 , P3 and P4 are the location to attach electrodes.
1.3 Clean each area with alcohol.
1.4 Place the electrodes on the scalp in the following locations: O1,O2,P3,P4 and mastoid .

1.5 Attach the wires on electrodes.
1.6 Tightly wrap around the head to prevent the electrodes reposition.
Part 2: Preparation for the ECG measurement
2.1 Clean right wrist, left and right ankle with alcohol. Then attach the electrodes and connect wires .
Part 3: Preparation of essential oils
3.1 Prepare a measuring cylinder of 60 ml of distilled water and place it in steamers.

OB5_19_01/2

325

12th SCiUS Forum

3.2 Drop 10 drops of each essential oil into separate steamer.
Part 4: EEG and ECG recording

4.1 Enable electrode and run the program on computer. The participant sit with relaxed.

4.2 EEG and ECG were recorded during distilled water, lavender oil and cinnamon oil inhalation. Each
inhalation was operated by 3 minutes of eyes opened and 3 minutes of eyes closed, respectively. Then analyze
EEG and ECG data.
Part 5: Overall satisfaction

5.1 participants were asked to fill a satisfaction questionnaire between the scents of cinnamon essential
oil and lavender essential oil.
Part 6: Analysis the composition using GC-MS

Results
Essential oils compositions were analyzed using GC-MS. Main chemical composition of cinnamon

essential oil is cinnamaldehyde while lavender essential oil is linalool and linalyl acetate
Percent total power of EEG signals showed significant different in beta frequency. Beta oscillation

decreased during cinnamon oil inhalation with closed eyes and others frequencies did not show significant
different. However, alpha band tend to increase in lavender and cinnamon oil inhalation during eyes closed
when compared with distilled water inhalation.

Figure 1: Changes in EEG spectral power of frequency range in left hemisphere
*P<0.05 compared with distilled water inhalation

OB5_19_01/3
326

12th SCiUS Forum

Heart rate variability (HRV) is used to study the effects of cinnamon oil on autonomic nervous
system. This study showed that both cinnamon oil and lavender oil did not significant different between
distilled water group.

Figure 2: Sympathetic activity during eyes opened and eyes closed
A comparative satisfaction questionnaire between cinnamon essential oil and lavender essential oil.
The result showed that participants are more pleasant lavender than cinnamon. However, the data did not
show significant difference.

Figure 3: Overall satisfaction during essential oils inhalation
Conclusion

Cinnamon oil is a productive essential oil . The main chemical compositions is cinnamaldehyde while
lavender oil is linalool and linalyl acetate. Cinnamaldehyde represented neuroprotective activity induced brain
injury via suppressing protein levels of inflammatory. Therefore, cinnamaldehyde may produce anxiolytic
effect. However, main composition of lavender oil is different from cinnamon oil. So ant i-anxiety and anti-
stress of both oils may be produce in different pathway.

Acknowledgements
This project was supported by Science Classroom in University Affiliated School (SCiUS). The

funding of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This
extended abstract is not for citation.

References
Reyhaneh Sohrabi, Nasim Pazgoohan, Hasan Rezaei Seresht, Bahareh Amin. Repeated systemic

administration of the cinnamon essential oil possesses anti-anxiety and anti-depressant activities in mice
[Iranian Journal of Basic Medical Sciences]. Sabzevar, Iran: Sabzevar University of Medical Sciences; 2017

OB5_19_01/4
327

12th SCiUS Forum

Title : Development of Loop-Mediated Isothermal OB5_03_06

Field : Amplification (LAMP) for disease detection on durian
Biology and Biodiversity

:Author Miss Teewara Pudpoo

School : Miss Waratchaya Meeponsawan
Naresuan University Secondary Demonstration School, Naresuan University

: ( )Advisor Asst. Prof. Dr. Maliwan Nakkuntod Naresuan University

:Abstract

Durian is an important cash crop in Thailand. Pests, especially fungi-caused plant diseases, are an
issue in Thailand's durian producing system. This has an impact on the quality and quantity of durian fruit It's
also a major issue throughout the planting process. Before and post harvest yielding periods. Gene
amplification technology is currently being developed to identify diseases. Polymerase chain reaction (PCR)
is the most well-known method for gene amplification. However, because this technology has limitations in
its use especially in the tool that is expensive. And it was reported in the year 2 0 0 0 that a method for gene
amplification using the methodology had been developed. Tsugunori Notomi et al. (2 0 0 0 ) invented loop-
mediated isothermal amplification (LAMP), which solved a significant difficulty in PCR procedures.
Therefore, this project aims to develop the technique Loop-Mediated Isothermal Amplification (LAMP) to
detect Fusarium sp. on durian. In this research, the efficient temperature and time for the reaction were
discovered to be 63 °C for 75 minutes., which could diagnose the disease in the early stages of infection. Even
with a small amount of DNA with a sensitivity of 50 nanograms per milliliter assay and can detect specific F.
solani without binding to other types of fungi. Therefore, the LAMP technique is an alternative method for
diagnosing the fungus that causes dry twig disease. In addition, it can diagnose with equipment and tools that
are not very expensive and can diagnose the infection accurately.

:Keywords LAMP, Fusarium, Twig blight disease

Introduction
Thailand is currently the world's largest exporter of durian, especially Mon Thong durian. (Durio

zibthinus murray) In 2018, the country's overall durian export volume was 530,226 tons, up 16,343 tons from
the same period in 2017. This demonstrates the growth of the Thai durian market, which now accounts for
80% of the global market share. Pests, particularly plant diseases caused by fungi, are another issue that
impacts the Thai durian production system, causing damage and affecting the quality and quantity of durian
production.

OB5_03_06/1
328

12th SCiUS Forum

Another genus suspected of causing dry twig disease is Fusarium spp. It has been identified as a
secondary fungal infection agent and a plant pathogenic fungus. It is most commonly found as a soil-borne
fungus that kills plants above ground. Underground stems can spread to any location on the planet, including
temperate, humid, and cold environments. Fungal data has been found to be compatible with reports of
Fusarium spp. in durian. Weeranee's report, for example, describes durian dieback with leaf apical twist, as
well as when the weather is hot. As a result, the tips and edges of the leaves are burned. The leaves fall to the
ground, the branches dry out, and the leaves spread to the lower branches. The durian tree will deteriorate if
the symptoms are severe.

To detect pathogens, numerous gene amplification approaches are currently being explored. The
PCR process is the most well-known method of gene amplification. The verification process will take 3–4
hours. It necessitates the use of specialized, high-precision tools, which are costly. Furthermore, certain
procedures are not appropriate for use in small laboratories or in the field. And it was reported in the year 2000
that a method for gene amplification using the methodology had been developed. T sugunori Notomi et al.
(2000) invented loop-mediated isothermal amplification (LAMP), which solved a significant difficulty in PCR
procedures.

The purpose of the project was to develop a LAMP technique for detecting Fusarium spp., which
causes durian dry twig disease. By directly detecting pathogens in diseased durian tissue, this test can be
utilized to diagnose anthracnose caused by Fusarium spp.

Methodology
8.1 Isolation of fungi that cause plant disease by Tissue transplant method
The diseased durian leaves are washed and cleaned with distilled water. Then only the areas with

the disease markings are cut into a 5 x5 millimeter square, which covers the disease and non-disease parts.
Soak it in 1 0 % Clorox for 3 - 5 minutes. It is rinsed in distilled water, autoclaved 3 times, and the diseased
plant parts are blotted on sterile tissues to dry. Then placed on Potato Dextrose Agar (PDA) formula and
incubated at 3 7 ± 2 °C for 3 - 7 days until the fungus produces mycelium. Then remove the end of the fungal
fibers that grow out of the plant parts. Place the PDA recipe on a new plate to isolate and purify it for use in
further experiments.

8.2 DNA extraction and fungal identification
Fungi from durian leaves were transplanted and cultured on PDA about 3-4 times until getting
pure isolates. The DNA of fungal mycelium was extracted. All DNA solutions were measured the
concentration via Nanodrop and tested the purity using agarose gel electrophoresis. After that, all DNA were
amplified in region of ITS using PCR method. The PCR products were purified and sequenced before fungal
species identification.
8.3 Primer design
Bring the nucleotide sequence of Fusarium spp. to the primary design with Primer Explorer
version 5 ( http://primerexplorer.jp/lampv5 e/index.html). The primer kit is designed to be specific to three
genes: tef1α. The primer is specific to the four locations of the target gene. It consists of outer pair primers
(B3, F3) and inner pair primers (BIP, FIP).
8.4 Improving the efficiency of the LAMP reaction

OB5_03_06/2

329

12th SCiUS Forum

To identify the most efficiently amplified condition, the LAMP reaction was performed at 60, 61,
62, and 63°C for 60 minutes. For the primer, the results were visually examined for discoloration within the
reaction tube. The positive reaction will be yellow, and the negative control sample will be pink.

8.5 Specific performance test by LAMP technique
Prepare the reaction mixture in a microcentrifuge tube. Using fungal DNA Fusarium spp. causing
durian dry twig disease. The reaction was then mixed with a vortex machine and incubated at an appropriate
temperature (according to clause 8.4). The results were then examined visually by looking at the discoloration
inside the reaction tube. and the effect of the reaction was confirmed by 1.5% agarose gel electrophoresis.
8.6 Sensitivity performance test by LAMP technique
Prepare the reaction mixture in a microcentrifuge tube. The DNA samples were diluted with 1 0
times distilled water, 7 dilutions. From 1 0 0 nanograms per microliter to 1 0 picograms per microliter. The
reaction was then mixed with a vortex apparatus and incubated at the appropriate temperature for primer. The
results were then visually examined for discoloration within the reaction tube and the effect of the reaction
was confirmed by 1.5% agarose gel electrophoresis.

Results
Fragments of the diseased durian leaves were analyzed for mycelial characterization on PDA

medium and incubated at 37°C for 7 days by purifying the fungi. Fungi were found to grow rapidly on PDA
agar. Fungi that grow on the surface of the PDA medium initially appear as white mycelium, over long periods
of time the mycelium turns gray. A total of 2 samples were collected and infected for this study, resulting in a
total of 12 samples: D1, D2, D3, D4.1, D4.2, D5.1, D5.2, D6.1, D6.2, DU1, DU2 and DU3. The results of
fungal DNA extraction and DNA amplification by PCR technique, when examined by ITS, showed that the
resulting DNA was approximately 600 bp.

The results of the identification of the three fungi were Du1: Fusarium chlamydosporum,
Du2: Phomopsis mali and Du3: Fusarium solani. Because this investigation collected two samples of
Fusarium spp., the experiments were performed on both samples, Du1 and Du3. And when the infection was
used to design a primer, The designed primer is the TEF1α gene with the following base sequences:

Table 1: The TEF1α gene base sequences
label Sequence
F3 AAGTCAAACCCTCATCGCG
B3 TCGATGTGGAATAGCAAGGC
FIP GTGACTGA TGAATACCCCGCCC-ATCTGCTTATCTCGGGTCGT
BIP ACTTGATCTACCAGTGCGGTGG-GTCACCAACCTTCTCGAACT

DNA from Fusarium spp. was isolated from the samples and quantified using the LAMP
technique at 60, 61, 62, 63, and 65 degrees Celsius for 60 minutes using a particular TEF1α gene. It was
discovered that the primer could only connect to one target gene. The product was effectively performed in
the Du1 sample when heated to 63°C for 60 minutes.

OB5_03_06/3

330

12th SCiUS Forum

The DNA extracted from the test cultures used for the assay was quantified by LAMP using an
initial DNA concentration of 50 ng/ml. the TEF1α gene that is specific to Fusarium solani was used and
incubated at 63°C for 75 min. The primer was able to bind to five target genes and when examined for product
formation with 1.5% agarose gel electrophoresis. It was shown that the product was produced in sample Du3,
which was Fusarium solani, and also in samples D1, D2, D5.1 and D5.2, possibly also Fusarium solani.

With the LAMP approach, a diagnostic susceptibility test of F. solani can detect pathogenesis in
durian. The DNA concentration was determined from 100 ng/mL to 10 picograms/mL, 10 times the sequence
dilution (1 0 fold serial dilution). The experiment revealed that not all concentrations of the product were
created. This might be the result of a technical error. The lowest concentration at which the primer could detect
fungi was 50 ng/ml.

Conclusion
This project is to study the analysis of F. solani for the rapid diagnosis of dry twig disease in durian.

The primers were selected and engineered using the translation elongation factor-1α (TEF-1α) gene region as
the target DNA sequence. Incubated at a constant temperature of 63 °C for 75 minutes, which can diagnose
the disease in the early stages of infection. Even with a small amount of DNA with a sensitivity of 50
nanograms per milliliter assay. In addition, the method can detect specific infection. Therefore, the LAMP
technique is an alternative method for diagnosing the fungus that causes dry twig disease. In addition, it can
diagnose with equipment and tools that are not very expensive and can diagnose the infection accurately.

Acknowledgements
This study turned out to be a success. Due to the kindness of Assistant Professor Dr. Maliwan

Nakkunthod, project advisor Miss Sunisa Luanglue, research assistant Miss Kanittha Chansri, and Mister
Aphisit Saenlee, who assisted in giving advice on conducting the experiment, giving advice, and taking the
time until this research was completed successfully. This project was supported by Science Classroom in
University Affiliated School (SCiUS). The funding of SCiUS is provided by Ministry of Higher Education,
Science, Research and Innovation. This extended abstract is not for citation.

References
1. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T. Nucleic Acids Res.

2000 Jun 15;28(12): E63. doi: 10.1093/nar/28.12.e63.
2. Kasikorn Research Center. Export value for Thai durian hits record high in May 2021; new record expected

for full-year 2021 with accelerated growth of 35 - 40 percent (Current Issue No.3233) [Internet]. Bankok:
Kasikorn Research Center ; 2021 [cited 2021 September 15]. Available from
https://www.kasikornresearch.com/en/analysis/kecon/business/Pages/Durian-z3233.aspx

OB5_03_06/4

331

12th SCiUS Forum

Title : Investigation and isolation of medical rubber OB5_15_07

Field : gloves degrading microorganisms from soil
Author :
Environmental Science and Ecology
School :
Advisor : Miss Jinnapat Sangkao

Miss Pitchayaporn Kongdee

PSU.Wittayanusorn School, Prince of Songkla University

Asst. Prof. Dr. Kamontam Umsakul from Prince of Songkla University

Mr. Surawut Saengmanee (PSU.Wittayanusorn School)

Miss Apinya Boonkhum (PSU.Wittayanusorn School)

Abstract :
The uses of medical rubber gloves have increased rapidly due to the epidemic situation of the novel

coronavirus disease (COVID-19). The problem of the disposal of medical rubber gloves has been a growing
concern. In this study, soil microorganisms with ability to decompose medical rubber gloves were isolated
from the buried gloves and soil samples. 7 isolates were selected and tested for their ability to degrade rubber
gloves by culturing in mineral salt medium (MSM) containing medical rubber gloves as a carbon source. After
2 weeks of incubation, the rubber gloves surface was thinner and covered with adhered microorganism. The
degradation of medical rubber gloves was also confirmed by staining with Schiff's reagent. Staining natural
rubber pieces containing actively growing colonies of microorganisms with Schiff’s reagent showed the
evidence for degradation of cis-1, 4-polyisoprene rubber hydrocarbon chain. All 7 isolates were gram-negative
and rod-shaped. Bacterial identification was determined using MALDI-TOF MS. Isolated bacteria were
identified as Ochrobactrum anthropi, Pseudomonas taiwanensis, Stenotrophomonas maltophilia,
Stenotrophomonas nitritireducens, Pseudomonas guariconensis, Providencia rettgeri and Pseudomonas
putida. This study showed the possibility of using microorganisms to degrade rubber gloves wastes.

Keywords : medical rubber gloves, microorganisms, gram staining, MALDI-TOF MS

_____________________________________________________________________________________

OB5_15_07/1
332

12th SCiUS Forum

Introduction
Nowadays, the uses of medical rubber gloves have increased rapidly due to the epidemic situation of

the novel coronavirus disease 2019. A problem in the disposal of used medical rubber gloves has become a
major concern. Therefore, the investigation of medical rubber gloves degrading microorganisms from soil was
studied.

Methodology
The experiments were divided into 2 parts as follows,

Part 1: Isolation of soil microorganisms decomposing medical rubber gloves.
1.1 Medical rubber gloves were buried in soil from different areas, which are
Mueang Nakhon Sri Thammarat district, Pak Phanang district, Chulabhorn
district and Cha-Uat district.
1.2 Observing the bacterial adhesion on buried
medical rubber gloves and isolating rubber

degrading bacteria by culturing on solid media containing latex as a carbon
source.
1.3 After incubation on solid media, microorganisms that grew on solid media
were taken and tested in liquid medium containing medical rubber gloves as a carbon source.
1.4 After incubation with rubber gloves for 2 weeks, rubber degrading
microorganisms were isolated and purified by spread plate method.
1.5 Observing the changes of the surface of medical rubber gloves after the
incubation with microorganisms.

1.6 Analysis of changes of biodegraded medical rubber gloves by Schiff’s reagent.

Part 2: Study the characteristics of microorganisms in soil that decomposed
medical rubber gloves.
2.1 Isolated microorganisms were primarily characterized by morphology observation

and gram staining.
2.2 Isolated microorganisms were identified using MALDI-TOF MS2.

Results
In this study the rubber gloves were buried in soil in various places to enrich to growth rubber glove

degrading bacteria. Rubber degrading bacteria were isolated by growing on the medium containing latex. It
showed that by using the enrichment method, there were many bacteria that were able to
grow using latex as a carbon source. These bacteria were then mixed and cultured in
minimal medium containing rubber gloves as a carbon source to test an ability to degrade
rubber gloves. After 2 weeks of incubation with medical rubber gloves, changes on
medical rubber gloves surface were observed clearly. 7 rubber degrading bacteria were
isolated and identified as shown in Table 1.
_______________________________________________________________________________________

OB5_15_07/2

333

12th SCiUS Forum

Table 1: Types and characteristics of 7 isolated rubber degrading bacteria

Area where medical rubber Types of microorganisms Gram stain Shape
gloves are buried identified using
MALDI-TOF MS

Chulabhorn District 1 Ochrobactrum anthropi Gram Negative Rod-shaped

Chulabhorn District 2 Pseudomonas taiwanensis Gram Negative Rod-shaped

Pak Phanang District 1 Stenotrophomonas Gram Negative Rod-shaped
maltophilia Rod-shaped
Pak Phanang District 2 Rod-shaped
Stenotrophomonas Gram Negative Rod-shaped
Mueang Nakhon Si nitritireducens Rod-shaped
Thammarat District 1
Mueang Nakhon Si Pseudomonas guariconensis Gram Negative
Thammarat District 2
Providencia rettgeri Gram Negative
Cha-Uat District
Pseudomonas putida Gram Negative

Changes of the surface of degraded medical rubber gloves were observed by using stereo microscope.
The surfaces of medical rubber gloves after the incubation with microorganisms were thinner and covered
with bacteria. The degradation of medical rubber gloves was also confirmed by Schiff's reagent. Staining
natural rubber pieces containing actively growing colonies of microorganisms with Schiff’s reagent showed
the evidence for degradation of cis-1, 4-polyisoprene rubber hydrocarbon chain. The purple color produced
on the rubber gloves surface was evidence of aldehydes react with Schiff's reagent1.

Conclusion
Among 7 isolated bacteria, Pseudomonas taiwanensis and Ochrobactrum anthropi from soil samples

in Chulabhorn district are the most effective microorganisms that were able to degrade medical rubber gloves.
This study showed the possibility of using effective microorganisms to degrade rubber glove wastes.

Acknowledgements
This project was supported by Science Classroom in University Affiliated School (SCiUS) under

Prince of Songkla University of PSU.Wittayanusorn School. The funding of SCiUS is provided by Ministry
of Higher Education, Science, Research and Innovation, which is highly appreciated. This extended abstract
is not for citation.

_____________________________________________________________________________________

OB5_15_07/3
334

References
1. Sheehan DC, Hrapchak BB. Theory and practice of histotechnology. 2nd ed. Columbus: Battelle Memorial
Institute; 1987.
2. Anhalt JP, Fenselau C. Identification of bacteria using mass spectrometry techniques. Anal Chem.
1975;47:219–25.

_____________________________________________________________________________________

OB5_15_07/4
335

12th SCiUS Forum

Title : Effect of essential oils against biofilm of OB5_04_07
antibiotic-resistant bacteria isolated from
Field :
Authors : Chronic Rhinosonisitis patients
School :
Advisors : Biology and Biodiversity

Miss Apitchaya Juwattanaprasert

Miss Patcharida Arvonthom

Demonstration School of Khon Kaen University

Asst. Prof. Dr. Sakawrat Kanthawong

Department of Microbiology, Faculty of Medicine, Khon Kaen University

Mrs. Janjira Saisaeng

Demonstration School of Khon Kaen University

Abstract
Chronic Rhinosinusitis (CRS) is long-term inflammation of sinuses that can be caused by the

infection of antibiotic-resistant bacteria. Moreover, biofilm development of infected microbes in CRS plays
an important role in antimicrobial resistance, which makes antibiotic treatment of CRS more difficult to treat.
Thus, the objective of this study was to find the novel anti-biofilm agent from five Thai herb essential oils
(EOs) against antibiotic-resistant bacteria isolated from CRS patients. Using transferable solid phase (TSP)
pin lid, holy basil EO displayed the highest killing activity against Pseudomonas aeruginosa grown as biofilm,
while kaffir lime was the most effective EO against Staphylococcus epidermidis based on IC90 values.
Furthermore, the biofilm-disrupting activity of the most effective EO against each bacteria was further
determined using AAA model. CLSM images of biofilms stained with FITC-ConA (biofilm) revealed the
reduction of both P. aeruginosa and S. epidermidis biofilm matrix after treated with holy basil and kaffir lime
EO, respectively when compared with untreated biofilm. Thus, Thai herb EOs might be clinically applicable
for alternative treatment of biofilm-associated CRS patients in the future.

Keywords : Chronic Rhinosinusitis, Essential oils, Anti-biofilm activity, Antibiotic-resistant bacteria

Introduction
The sinuses are the hollow cavities in the skull that serves to expel mucus to keep it clean and

pathogen-free. However, some conditions such as allergic can cause mucus blockage leading to the
inflammation and sinus infection (virus or bacteria) called rhinosinusitis. This disease can cause pain swelling
of sinus mucosa, nasal congestion, facial pain and decrease or complete loss sense of smell [1]. The
inflammation that persists more than 12 weeks is characterized as chronic rhinosinusitis (CRS). Recently,
several studies mentioned that biofilm development of infected microbes in CRS plays an important role in
antimicrobial resistance [2]. The most frequently isolated bacterial strains from CRS patient with evident of
biofilm were Staphylococcus aureus, Staphylococcus epidermidis, Pseudomonas aeruginosa and Klebsiella
pneumoniae [3]. Furthermore, biofilm may contribute to the relapse, persistence and severity of certain CRS
patients. Therefore, the novel therapeutic agents against microbial biofilm are required.

OB5_04_07/1
336

12th SCiUS Forum

Essential oils (EOs) are concentrated oil containing unique aromatic compound extracted from each
plant or flower. The components of EOs are a variety of chemicals that display several biological activities
including the antibacterial, antioxidant, antiviral, insecticidal and also can be used for the food preservation
[4]. EOs also have potential activity as antibiofilm activity in several steps of biofilm formation process and
show non-toxic to cells as well, which makes them excellent candidates for the discovery of new natural
treatments [5]. In this study, the anti-biofilm activity of five Thai herb essential oils (EOs) against antibiotic-
resistant bacteria isolated from CRS patients was determined. Moreover, the biofilm-disrupting effect of EOs
on biofilm matrix was also observed. The results of this study may reveal the antibiofilm potential of Thai
herb EOs toward bacterial biofilm that might be applicable as alternative treatment for CRS patients.

Methodology
Bacterial Strains and growth condition
Two bacterial isolates, Staphylococcus epidermidis and Pseudomonas aeruginosa isolated from CRS patients
at Srinagarind hospital, Khon Kaen University, Khon Kaen, Thailand were selected based on the high
incidence of biofilm determinants in clinical isolates from CRS patients [3]. Staphylococcus epidermidis and
Pseudomonas aeruginosa were cultured overnight at 37oC for 16-18 hours in biofilm-stimulating media.
Determination of killing activity of essential oil
The killing activity of essential oils (EOs) against bacteria grown as biofilm were evaluated using transferable
solid phase (TSP) pin lid. Each bacterial strain (107 CFU/ml) was added to 96 wells plate and covered with the
plate with the TSP peg lid (Nunc-TSP, Denmark) and incubated at 37oC for 24 hours. After that, preformed-
biofilm on TSP pin surface were washed and then challenged with five Thai herb EOs including turmeric,
basil, holy basil, kaffir lime and lemongrass with a concentration range from 0.0016% to 3.2% at 37oC for 24
hours. A medium without EO was used as control. After 24 hours, the viability of bacteria in biofilm was
observed using plate count technique on NA plate. The percentage killing was calculating using formula [1 −
(CFU sample/CFU control)] × 100%. The IC90 value which is the concentration of EO required for 90%
inhibition was calculated using linear regression of plots. This experiment was performed in duplicate of three
independent experiments.
Determination of biofilm-disrupting activity of essential oil
The effect of the most effective EO on the biofilm matrix of each bacterial isolate was further determined
using the Amsterdam Active Attachment Model (AAA-model). 1.5 mL of bacterial suspension (108 CFU/mL)
were added to 24-well plate, a sterile stainless-steel lid that contain round coverslips was placed and incubated
at 37oC for 24 hours. After that, biofilm formed on AAA lid were washed and then challenged with the most
effective EO against each bacterial isolate at 37oC for 24 hours. A well without EO was used as control. After
treated, biofilms were washed three times and fixed with 2.5% glutaraldehyde. The fixed-died bacterial biofilm
was stained with FITC-ConA (Alexa Fluor® 448, Invitrogen, USA) for 30 min, which stained to
exopolysaccharide matrixes of the biofilm. The stained cells were photographed using CLSM (TCS SP8-Leica
Microsystems) at excitation/emission; 495/519 nm. The fluorescent intensity was measured using COMSTAT
analysis (BioCentrum-DTU, Denmark). This experiment was performed in duplicate of three independent
experiments.

OB5_04_07/2

337

12th SCiUS Forum

Statistical Analysis
The fluorescent intensity of biofilm biomass is shown as mean ± standard deviation (SD). Comparisons
between the average of each EO and control were analyzed using one-way ANOVA. The statistical testing
was done using the SPSS software, version 28.0.

Results
The effect of essential oils against bacterial biofilm and biofilm matrix

The IC90 of five Thai herbs EOs against P. aeruginosa and S. epidermidis grown as biofilm are shown
in Table 1. The most effective EO against P. aeruginosa grown as biofilm was holy basil with IC90 value of
0.003% and kaffir lime also exhibited the strongest anti-biofilm activity against S. epidermidis with IC90 of
0.003%.

Table 1. Inhibitory concentration (IC90) values of five Thai herb EOs against P. aeruginosa and
S. epidermidis grown as biofilm.

Essential oils IC₉₀ (% v/v)

Holy basil P. aeruginosa S. epidermidis
Kaffir lime
Basil 0.003 0.013
Lemongrass
Turmeric 0.4 0.003

0.4 0.003

0.8 0.1

>3.2 >3.2

A P. aeruginosa Fig 1. Effect of essential oils on biofilm
mass. The 24 h preformed-biofilm of
B S. epidermidis (A) P. aeruginosa and (B) S. epidermidis
were incubated with essential oils for 24
h. Biofilms were stained with FITC-
ConA. Intensity was analyzed using
COMSTAT program and values are
presented as mean ± SD in duplicate of
three independent experiments. *P<0.05.
Scale bar indicate 10 μm.



OB5_04_07/3

338

12th SCiUS Forum

Moreover, the biofilm-disrupting activity of the most effective EO on biofilm matrix of each bacterial
isolate was determined by the Amsterdam Active Attachment (AAA) model. Using confocal laser scanning
microscopy (CLSM), holy basil and kaffir lime markedly reduce the exopolysaccharide of P. aeruginosa and
S. epidermidis biofilm matrix, respectively when compared with untreated biofilm (Fig 1). To confirm the
biofilm-disrupting activity of the EOs, the fluorescent intensity was measured. There was statistically
significant reduction of either EOs tested (P<0.05) against P. aeruginosa and S. epidermidis biofilm matrix.

Conclusion
Holy basil and kaffir lime exhibited strong antibacterial activity against P. aeruginosa and S.

epidermidis grown as biofilm, respectively. Moreover, both EOs can disrupt exopolysaccharide of bacterial
biofilm matrix. These results suggested that holy basil and kaffir lime EO may have potential application as
an alternate or adjunctive treatment for CRS patients.

Acknowledgements
This project would not have been accomplished without help and encouragement from our advisors,

Asst. Prof. Dr. Sakawrat Kanthawong and Mrs. Janjira Saisaeng. This project was supported by Science
Classroom in University Affiliated School (SCiUS) and Faculty of Medicine, Khon Kaen University. The
funding of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This
extended abstract is not for citation.

References
1. Fokkens W, Lund V, Bachert C, Clement P, Helllings P, Holmstrom M, et al. European position
paper on rhinosinusitis and nasal polyps. Rhinology. 2005;23(23):1-87.
2. Dlugaszewska J, Leszczynska M, Lenkowski M, Tatarska A, Pastusiak T, Szyfter W. The
pathophysiological role of bacterial biofilms in chronic sinusitis. European Archives of Oto-Rhino-
Laryngology 2016; 273(8): 1989-94
3. Foreman A, Boase S, Psaltis A, Wormald P-J. Role of bacterial and fungal biofilms in chronic
rhinosinusitis. Current allergy and asthma reports 2012; 12(2): 127-35.
4. Solórzano-Santos F, Miranda-Novales MG. Essential oils from aromatic herbs as antimicrobial
agents. Current opinion in biotechnology. 2012;23(2):136-41.
5. Sharifi A, Mohammadzadeh A, Zahraei Salehi T, Mahmoodi P. Antibacterial, antibiofilm and
antiquorum sensing effects of Thymus daenensis and Satureja hortensis essential oils against
Staphylococcus aureus isolates. Journal of applied microbiology. 2018;124(2):379-88.

OB5_04_07/4

339

12th SCiUS Forum

Title: The Efficacy of Black Glutinous Rice (Mhor 37) OB5_19_04
Extract for Use in Plant Chromosome Staining

Field: Biology and Biodiversity

Author: Miss Farhana Buwaeyusoh

School: Islamic Science Demonstration School, Prince of Songkla University

Advisor: Assoc. Prof. Dr. Sitthisak Jantarat

Abstract

Black glutinous rice Mhor 37 is one of the plants that contain anthocyanin. Which is a naturally
occurring pigment and will be able to change color according to the pH value. The efficacy of Black glutinous
rice Mhor 37 extract was studied using a solvent of acetic acid and ethanol at concentrations of 30%, 45%,
and 60% at a ratio of 1:1 (g/ml) for 12 and 24 hr., pH was adjusted to 1.5, 3.0, 4.5, 6.0 and 7.5. It was found
that extraction using 30% acetic acid solvent for 12 hr. at pH 1.5 was effective in the chromosome staining at
the onion roots, the most behavior of chromosomes in each cell division stage can be observed. Reduce the
use of chemicals in chromosome staining. Reduce chemical contamination of the environment and reduce the
budget for the purchase of expensive chemicals.

Keywords: Black glutinous rice, Anthocyanin, Solvent extraction, Chromosome staining, Chromosomal dyes

Introduction

The study of cell division and the behavior of chromosomes in plant cells is critical in genetics
biology. For example, study to observe abnormalities both inside and outside the cell, study the evolution of
plants, study to improve plant species or increase economic value, etc. In the study of the cell division of
plants, chromosome staining was performed. Most of them use imported chemical paints that are expensive
and it can also cause chemical contamination to the environment. Therefore, the extraction of natural dyes
from various plants was initiated to reduce the budget and reduce the use of chemicals in chromosome staining.
A pigment that can be stained with chromosomes is anthocyanin. It is in the group of phenolic compounds.
polyphenol group as shown in figure 1. It has good water solubility but is insoluble in solvents that do not
contain hydroxyl groups. Easily decomposed by heat, therefore unstable and will change color according to
pH. If the acidity is high, it will be red and when it becomes more alkaline, it becomes blue as shown in figure
2. This pigment can be found in many common plants such as black glutinous rice seeds, red thorns, and
dragon fruit rinds. Roselle flower, butterfly pea flower (วั น เ พ็ ญ , 2558). This project uses black glutinous rice
Mhor 37, which is native rice from Phatthalung Province. It was extracted as a natural dye and studied its
efficacy in chromosome staining. This is to reduce chemical contamination in the environment and reduce the
budget on chromosome dyes.

_________________________________________________________________________________________________________________________________________________
_

OB5_19_04/1

340

12th SCiUS Forum

Figure 1: The chemical structure of anthocyanin. (กาญจนา และคณะ, 2562)

Figure 2: the chemical structure of anthocyanin in high acidic conditions and high alkalinity.

Methodology
Part 1: Extraction of pigments from Black glutinous rice Mhor 37

The black glutinous rice Mhor 37 seeds were extracted with acetic acid and ethanol solvents at
concentrations of 30%, 45%, and 60% by soaking black glutinous rice Mhor 37 seeds at a ratio of 1:1 (g/ml)
at room temperature for 12 and 24 h. Then filtered with a thin white cloth and filtered again with filter paper
Part 2: The chromosome staining of the onion root tip with Mo. 37 black glutinous rice extract

Use the extract to chromosome staining at the onion root tips by using the squash technique, starting
by cutting off only the cloudy white root tip of the onion root tip soaked in 70% ethanol solution. Then placed
on a slide of 1–2 roots, rinsed with distilled water and then blot-distilled water with tissue paper. Then drop 1
N hydrochloric acid on the root parts and leave for 5 min. After the time is up, rinsed with distilled water
again, then blot-distilled water with tissue, and then drop the extract from the black glutinous rice 37 at the tip
of the onion root were left for 10 min and use the tip of the needle handle to rub the cells to spread. closed
with glass slides. Then, repeat all 12 types of extracts and look at them under a microscope. Observe the color
attachment on the chromosome at the tip of the onion root, take pictures and save the results.

_________________________________________________________________________________________________________________________________________________

OB5_19_04/2

341

12th SCiUS Forum

Part 3: Adjusting the pH of the extract
The pH value of the extract of black glutinous rice extracted with 30% acetic acid for 12 h was

adjusted to 1.5, 3.0, 4.5, 6.0, and 7.5, then stained on the chromosome at the tip of the onion root. Then,
observe the color fixing efficiency to compare the experimental results with the aceto-orcein chemical dye,
photograph and record the results.

Result and Discussion
The natural dyes were extracted from black glutinous rice Mhor 37 by using 2 types of solvents,

acetic acid, and ethanol, at concentrations of 30%, 45%, and 60% at a ratio of 1:1 (g/ml) for 12 and 24 h at
room temperature, it was found that all extracts could be used to dye all aromatic root tip chromosomes.
However, the concentration of extracts obtained and the efficacy of chromosome staining were not very
different. Therefore, the extracts were extracted with a 30% acetic acid solution for 12 h with the lowest
concentration of chemical impurities and less time to prepare the extract as an extract. Best of all 12 extraction
formats Then, after 12 h, the extract from black glutinous rice Mhor 37 extracted with 30% acetic acid was
adjusted to 1.5, 3.0, 4.5, 6.0, 7.5 for comparing the efficiency of chromosome staining. with aceto-orcein paint,
found that the extracts adjusted for pH to 1.5, which had the highest acidity in this experiment. It was most
effective in staining the chromosomes at the tip of the onion root at each cell division stage most clearly with
less color staining in the cytoplasm than extracts that had not been adjusted for pH as shown in figure 3. It is
also effective in chromosome staining comparable to that of synthetic dyes such as aceto-orcein as shown in
figure 4. This is consistent with the research by อารนี า และอัยมี่ (2564) studied the efficacy of dye from red dragon
fruit in chromosome staining of aromatic roots. concluded that Pigment extraction from red dragon fruit by
60% acetic acid solvent at 1.5 pH, but extracted at a ratio of 10:1 g: ml. for a period of 24 h, the chromosomes
can be stained clearly and have similar efficacy to aceto-orcein dyes. This is also consistent with the research
of รจุ ริ า และคณะ (2560) to study the efficacy of plant chromosome dyes with pigments extracted from purple
sweet corn. From the experiment, it was found that dye extraction from purple sweet corn by using a solvent
of 45% acetic acid with a pH 2, the chromosome staining from the mitosis of the onion root tip was the best
method of extraction.

AB
B

Figure 3: Comparison picture of extract extracted with 30% acetic acid solvent for 12 hours at a
ratio of 1:1 before adjusting pH (picture A) and the extracts were adjusted for pH at 1.5 (picture B)

_________________________________________________________________________________________________________________________________________________

OB5_19_04/3

342

12th SCiUS Forum

A B C DE

Figure 4: Comparison picture of chromosome staining efficiency at different stages of aceto-
orcein dyes. Which was synthetic color (upper picture) with the extract from black glutinous
rice Mhor 37 extracted with 30% acetic acid solvent for 12 h, adjusted pH to 1.5 (bottom picture),
A = interphase, B = Prophase, C = Metaphase, D = Anaphase, E = Telophase, respectively.

Conclusion
The natural dye extraction from Mhor 37 black glutinous rice with a 30% concentration of acetic acid

solvent at a ratio of 1:1 (g/ml) for 12 h at pH 1.5 was effective in dyeing and the most clearly observed
chromosomes close to synthetic aceto-orcein making it possible to save costs. Reduce the use of chemicals
and reduce the harm to users in plant chromosome staining.

Acknowledgements
This project was supported by Science Classroom in University Affiliated School (SCiUS). The

funding of SCiUS is provided by Ministry of Higher Education Science. Research and Innovation. This
extended abstract is not for citation.

References
1. Kanjana Sueaman, Samaiporn Paksee, Aphinya Arpsuwan1, Rapikorn Chalongsuppunyoo, Pornpat Sam-
ang, Panatda Jannoey, Kulwadee Pinwattana. DETERMINATION OF ANTIOXIDANT CAPACITY OF
RICEBERRY AND KHAO DOK MALI 105 CULTIVARS. PSRU Journal of Science and Technology
2019;4:95-108.
2. Rujira Thongsrisuk, Yodchai Chuaykern, Alongkoad Tanomtong, Sayun Punsomboon. Application of a
natural dye from purple sweet corn (Zea mays saccharata) for plant cell mitosis studies. Koch Cha Sarn
Journal of Science 2017;39:34-44.

_________________________________________________________________________________________________________________________________________________

OB5_19_04/4

343