Extended Abstract : Biology and Biodiversity

12th SCiUS Forum

reservoir of H. pylori., H. pylori is a well-known cause of gastric cancer through causing genetic changes in the DNA
mismatch repair gene (MMR). This lead us to believed that H. pylori may cause similar changes in human
cholangiocytes, leading to the development of CCA. This study, therefore, aimed to investigate mutations in
cholangiocytes cocultured with H. pylori.

Methodology
1. Cell lines and Culture
In this work, normal human cholangiocyte cell lines (H69) were used, which were kept in RPMI 1640 media with

10% fetal bovine serum, penicillin, and streptomycin. Placing 1 x 105 cells/35 mm in a culture plate then incubating
at 37 °C with 5% CO2. Every three days, the cells were trypsinized and passed.

2. Transfected plasmids pEGFP-CA12 and pEGFP-CA13 into cell lines
H69 cells (4 x 104) were seeded into 24 well culture plate and allowed to attach to the plate surface for 24 h. The
plasmids pEGFP-CA12 and pEGFP-CA13 were linearized by enzyme called Pvu I. Using jetOPTIMUS reagent, the
linearized vectors were transfected into H69 cells (Polyplus transfection). In a total amount of 50 µl serum-free media
RPMI 1640, solutions which contain 1 µg of plasmid and 1.2 µl of jetOPTIMUS reagent were mixed and incubated
for 10 minutes. Without adding FBS, after the cells were washed with 2 mL phosphate-buffered saline, diluted
solutions were added to the medium and continue the cultivation process for 18 hours. The medium was replenished
with RPMI 1640 containing 10% FBS 24 hours after the transfection. H69 cells which carry the pEGFP-CA12 plasmid
were detected 48 hours after transfection began by detecting GFP-positivecells using fluorescence microscopy, while
H69 cells containing the pEGFP-CA13 plasmid were identified by PCR amplification.
3. Bacterial coculture with H69 cells
H. pylori bacteria were grown in brain heart infusion (BHI) broth containing 8% fetal bovine serum (FBS) and
was incubated in microaerophilic conditions at 37 °C, 200 rpm using an orbital shaker for 3-4 days. Centrifuged H.
pylori was washed twice in PBS, and resuspended in antibiotic-free RPMI medium for cell culture before coculture
with pEGFP-CA13 transfected H69 cells. The bacterial counts were calculated using optical density (OD) data taken
at a wavelength of 625 nm. The same quantity of RPMI media was used in infected and non-infected cell culture
plates. For coculture control, E. coli bacteria were grown in Luria-Bertani broth at 37 °C, 200 rpm for 18 hours. The
steps in an infection cycle (coculture) were as follows:
1. pEGFP-CA13 transfected H69 cells (4 x 104 cells) were grown in 24 well culture plate, in medium with 10%

fetal bovine serum without antibiotics.
2. The media from the plates was withdrawn, and 500 µl of antibiotic-free RMPI growth medium was added to

control plates without bacteria or H. pylori suspensions in 500 µl of growth medium at MOI 100 or 1000.
The cocultures were incubated for 3 hours, after that, 2 mL of growth media was added, and the coculture
was developed for 48 hours.
Similar protocols were used for cocultures with E. coli. The coculture media, on the other hand, included
penicillin and streptomycin.

_____________________________________________________________________________________
OB4_04_01/2

244

12th SCiUS Forum

4. Detection of GFP-positive H69 cells and sequencing analysis
At 48 hours after coculture, the GFP-positive cells were detected using fluorescence microscopy and the DNA
was extracted for CA repeat region amplification. For plasmid construction, the CA repeat region was amplified using
EGFP-F: AGACCCAAG CTGGCTAGCG and CA13-R: AAGTCGTGCTGCTTCATGTG primers, which resulted
in the production of a 330 bp product. After gel electroporation, the PCR band was extracted, ligated and transformed
into competent E. coli cells. Single colonies of bacteria were selected and then plasmids were sequenced right after.
Results
1. Characterization of GFP plasmid transfected H69
After the plasmids pEGFP-CA12 and pEGFP-CA13 have been prepared and digested, they were transfected into H69
cells. The DNA from H69 transfected cells was collected, and the pEGFP-CA13 plasmids were confirmed in the cells
using PCR and gel electrophoresis.

Fig. 1 The figure displays H69 cells in three aspects, the control group, pEGFP-CA12 transfected, and pEFGP-CA13
transfected. GFP-positive cells can be observed only in H69 cells transfected with plasmids pEFGP-CA12, due to the
properties of plasmids pEFGp-CA12 which illuminate green fluorescent light in non-mutated cells.

1. Green fluorescent protein expression in H69-pEGFP-CA13 caused by H. pylori
After the CA13 cells have been cocultured with E. coli and H. pylori, the CA13 cocultured with E. coli,

control group, showed no signs of GFP-positive cells while the other group of CA13 cells that have been cocultured
with H. pylori significantly expressed higher number of cells with green luminous light.

Fig. 2 Cells cocultured with H. pylori and E. coli and transfected with pEFGP-CA13, whereas GFP-positive cells were
detected in cells cocultured alone with H. pylori.

_____________________________________________________________________________________
OB4_04_01/3
245

12th SCiUS Forum

2. Mutation in H69-pEGFP-CA13 cells inducing by H. pylori
Apart from others with no abnormalities, mutations were found in cells which cocultured with H. pylori

number #9 and #10. The type of mutations occurred in the cells were base deletions which also deleted the bases on
the CA repeated base pair.

Fig. 3 depicted the findings of the sequencing analysis, which revealed that base deletions existed in the pEGFP-CA13
region of the plasmids, indicating that mutations occurred in cells.

Conclusion
H. pylori can cause genetic changes in human cholangiocytes, which can raise the risk of H. pylori-associated

cholangiocarcinoma.

Acknowledges
This project was supported by Science Classroom in University Affiliated School (SCiUS). The funding of

SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This extended abstract is not
for citation.

References
1. Sripa B, Deenonpoe R, Brindley JP, Co-infections with liver fluke and Helicobacter species: A paradigm
change in pathogenesis of opisthorchiasis and cholangiocarcinoma? Parasitol Int. 2017 Aug;66(4):383-
389.
2. Boonyanugomol W, Chomvarin C, Sripa B, Bhudhisawasdi V, Khuntikeo N, et al Helicobacter pylori
in Thai patients with cholangiocarcinoma and its association with biliary inflammation and proliferation.
HPB (Oxford). 2012 Mar;14(3):177-84.
3. Yao Y, Tao H, Park DI, Sepulveda JL. Demonstration and Characterization of Mutations Induced by
Helicobacter pylori Organisms in Gastric Epithelial Cells. Helicobacter. 2006 Aug;11(4):272-86.

_____________________________________________________________________________________
OB4_04_01/4
246

12th SCiUS Forum

Title: Optimal condition of Bacillus sp. to inhibit Fusarium solani
causes root rot diseases in soybean.
OB4_17_02

Field: Biology and Biodiversity

Author: Miss Natwalan Phiromnok

Miss Rawisara Kongprom

School: Prince of Songkla University, Surat Thani Campus

PSU Wittayanusorn Surat Thani School

Advisor: Dr.Rapeewan Sowanpreecha

(Prince of Songkla University, Surat Thani Campus)

Miss Phimphanit Kongrueang

(PSU Wittayanusorn Surat Thani School)

Abstract: Soybean root rot is concerned because of the loss of agricultural product. Chemical fungicides are

a convenient method that they have many effects of production and environment. The biological method has

become to an alternative strategy to inhibit the growth of fungi that causes root rot in soybean. Bacillus sp. is

gram positive bacteria, heat resistant, endospores forming and secrete antimicrobial substances such as enzyme

chitinase, glucanase, and cellulase to control plant pathogenic fungi. The aim of this research was to examine

the efficiency of culture filtrate from RBFO525/2 at various conditions (culture medium, pH, temperature and

cultivation times). Nutrient Broth (NB), Luria Bertani (LB), and Tryptic Soy Broth (TSB) were used for

finding the optimal culture medium. The result showed that NB medium could inhibit Fusarium solani. as

65.52%. The optimal pH (pH 6, 7, 8, and 9) of RBFO525/2 in NB medium at pH 6 was illustrated the

percentage of inhibition as 73.33%. For the optimal temperatures (30, 37, and 40°C) and cultivation times, the

result demonstrated that RBFO525/2 in NB pH 6 at 37°C for 24h. had the highest inhibit F. solani up to

76.11%. Thus, the biological control could effectively control plant pathogenic fungi and might be developed

to sustainable agriculture.

Keyword: Fusarium solani., Bacillus sp., biological method, pathogenic fungi

Introduction
Nowadays, soybean (Glycine Max) is one of the economic crops in Thailand because of high

exporting value (Keatinge et al., 2011). There are several ways of soybean usage as human food which can be
consumed directly or used as seasonings. Agriculturists have been through a lot of plant diseases caused by
Fusarium solani (Lafsah et al., 2013). Chemical fungicides are used to inhibit fungi. The effect of fungicide
can lead to poor quality products, residue in crops and environment and consumer health (Taylor and Baumert,
2014). The biological control is an alternative method to solve these problems. Bacteria from natural latex are
used to control the growth of fungi. The optimal condition of bacteria is an important role to produce an active
compound for inhibiting the growth of fungi. Thus, types, pH, temperature of culture media and cultivation
times are examined to find the efficacy of inhibition F. solani that caused root rot in soybean (Sowanpreecha
et al., 2018).

OB4_17_02/1

247

12th SCiUS Forum

Methodology
The experiment has 4 parts as follows,

Part 1: Preparation of Fusarium solani
F. solani was kindly provided by Department of Microbiology, Faculty of Science,

Chulalongkorn University, Thailand. F. solani was grown on Potato Dextrose Agar (PDA) at 30°C for 7 days.
Part 2: Preparation of Bacteria

Re-streak Bacillus sp. from natural latex was kindly provided by Ms. Tanyarat Sapcharoen,
a undergraduate student of Microbial Technology at Agricultural Science and Technology, Faculty of
Industrial Science and Technology, Prince of Songkla University Surat Thani Campus. Bacillus sp. was grown
on Nutrient agar (NA) at 37°C for 24 h.
Part 3: Culture filtrate

Bacillus sp. was cultured in Nutrient Broth (NB) incubated at 37°C with shaking at 150 rpm
for 24 h. The growth of bacteria was measured at OD600 of 0.5. Then, 1 ml inoculum was inoculated into NB
99 ml and incubated at 37°C with shaking at 150 rpm for 24 h. The cell culture was centrifuged at 8,000 rpm
for 15 min; the supernatant was filtered through a 0.2 µm membrane filter. The culture filtrate was mixed with
PDB ratio 1:1 and pour plate. After that F. solani was put into the center and incubated at 30°C for 7 days.
Part 4: Optimal conditions for bacteria to produce antifungal substance

Optimal culture medium: Bacillus sp. was cultured in three types of culture media, namely
Nutrient Broth (NB), Luria Bertani (LB), Tryptic Soy Broth (TSB) at 37°C with shaking at 150 rpm for 24 h.
The culture broth was sampled to test antifungal activity as described above.

Optimal pH: Bacillus sp. was cultured in NB medium with pH 6, 7, 8, and 9 at 37°C with
shaking at 150 rpm for 24 h. The culture broth was sampled to test antifungal activity as described above.

Optimal temperature: Bacillus sp. was cultured in NB pH 6 and incubated at three
temperatures, namely 30, 37, and 40°C with shaking at 150 rpm for 24 h. The culture broth was sampled to
test antifungal activity as described above.

Optimal incubation time: Bacillus sp. was cultured in NB pH 6 and incubated at 37°C with
shaking at 150 rpm. The culture broth was sampled every 3 h for 24 h. The culture broth was sampled to test
antifungal activity as described above.
Results, discussion and conclusion

RBFO525/2 was determined the efficacy of antifungal activity on F. solani at several factors
such as types, pH, temperature of culture media and cultivation times. For optimization in different medium
(NB, LB, and TSB), the results showed that RBFO525/2 in NB had the best inhibition (Figure. 1(A)), followed
by LB (Figure. 1(B)) and TSB (Figure. 1(C)) with percentage inhibition at 65.522.82%, 53.451.99% and
49.144.34%, respectively (Table 1).

OB4_17_02/2

248

12th SCiUS Forum

A BC D

Figure 1 Inhibition of bacteria isolate RBFO525/2 in NB (A), LB (B) and TSB (C) against

F. solani; when compared with the control (D)

Table 1. Percentage of inhibition by culture filtrate from F. solani at different variable factors.

Variable factors Conditions %Inhibition

NB, pH 7 65.522.82

Media LB, pH 7 53.451.99

TSB, pH 7 49.144.34

NB, pH 6 73.332.22

NB, pH 7 62.786.88

pH NB, pH 8 59.448.58

Temperature NB, pH 9 2.782.80
Incubated time NB, pH 6, 30°C 75.565.44
NB, pH 6, 37°C 76.112.80
NB, pH 6, 40°C 73.893.80
NB, pH 6, 37°C, 3 h.
NB, pH 6, 37°C, 6 h. 0
NB, pH 6, 37°C, 9 h. 51.280.89
NB, pH 6, 37°C, 12 h. 62.692.63
NB, pH 6, 37°C, 15 h. 70.384.24
NB, pH 6, 37°C, 18 h. 73.330.89
NB, pH 6, 37°C, 21 h. 73.462.63
NB, pH 6, 37°C, 24 h. 73.851.26
75.381.78

RBFO525/2 was cultured in NB medium with pH level at 6, 7, 8 and 9. The result
demonstrated that RBFO525/2 cultured in NB at pH 6 had the inhibition as 73.332.22% (Figure. 2(A)) which
was better than pH 7 (Figure. 2(B)), pH 8 (Figure. 2(C)) and pH 9 (Figure. 2(D)) with (62.786.88%,
59.448.58% and 2.782.80% inhibition, respectively (Table 1).

AB CDE

Figure 2 Inhibition of bacteria isolate RBFO525/2 in NB at pH 6 (A), pH 7 (B), pH 8 (C) and pH 9 (D)

against F. solani; when compared with the control (E)

OB4_17_02/3

249

12th SCiUS Forum

When RBFO525/2 cultured in NB pH 6 at different three temperatures; 30, 37, and 40°C ;
the highest inhibition activity was observed from the culture filtrate at 37°C with percentage of inhibition at
76.112.80% (Table 1) and (Figure. 3(B)

A BC D

Figure 3 Inhibition of bacteria isolate RBFO525/2 in NB pH6 at 30°C (A), 37°C (B), and 40°C (C) against

F. solani; when compared with the control (D)

A time-course experiment was displayed by culturing RBFO525/2 in NB of pH 6 at 37°C

for 24 h. The culture filtrate was sampled every 3 h to examine antifungal activity. The inhibition activity of

RBFO525/2 started from 6 h of growth (Figure. 4(B)), and reached the highest activity at 24 h, which yielded

an inhibition percentage of about 75.381.78% (Table 1) and (Figure. 4(I)).

AB C D E

FGHI

Figure 4 Inhibition of bacteria isolate RBFO525/2 in NB pH 6 at 37°C against F. solani every 3 h
for 24 h. 3h (A), 6h (B), 9h (C), 12h (D), 15h (E), 18h (F), 21h (G)and 24h (H); when compared with the

control (I)
In short, the cell-free supernatant of RBFO525/2 at the optimal conditions would be an alternative
approach in agriculture to control the growth of F. solani, the causal pathogen of root rot in soybeans.
Acknowledgments
This project was supported by Science classroom in University-affiliated School Project (SCiUS).
The funding of SCiUS is provided by Ministry of Higher, Science, Research, and Innovation. This extended
abstract is not for citation.
References
Keatinge, J. D. H., Easdown, W. J., Yang, R. Y., Chadha, M. L. and shanmugasundarum, S. (2011).
Overcoming chronic malnutrition in a future warming world: the key importance of mungbean and
vegetable soybean. Euphytica. 180: 129-141.
L.afsah, H., Jinap, S. and Hajeb, P. (2013). A review on Mycotoxins in food and feed: Malaysia case study.
feeding the minds that feed the world. Comprehensive reviews in Food science and Food safety. 629-
651.
Sowanpreecha, R., Kanchanabanca, C., Sangvanich, P. and Rerngsamran, P. (2018). Bacillus subtills N3 as a
biocontrol agent for Curvularia lunata and its antifungal protein propoties. International journal of
agriculture and biology. 20: 531-538.
Taylor, S. L. and Baumert, J. L. (2014). Encyclopedia of agriculture and food systems. Elsevier. 366-380.

OB4_17_02/4

250

12th SCiUS Forum

Title : Polyphenols content and antioxidant capacity OB4_02_01
of Thunbergia laurifolia leaves extract

Field : Biology and Biodiversity

Authors : Ms. Sanita Greethep
Ms. Tanatchaya Promraksa

School : Demonstration School University of Phayao, Phayao 56000, Thailand

Advisors : Asst.Prof. Dr.Payungsak Tantipaiboonwong
Asst.Prof. Dr.Komsak Pintha,
(School of Medical Sciences, University of Phayao, Phayao 56000, Thailand)

Abstract
Thunbergia laurifolia ( Rang Chuet) is a traditional Thai herb with detoxifying properties and

antioxidant capability. This study aims to compare hot water extract and ethanolic extract by analyzing total
phenolic content, total flavonoid content, and antioxidant capacity. The 20 grams of leaves were boiled at
90°C for 5, 10, and 15 minutes as hot water extract, then centrifuged and dried by lyophilizer. For ethanol
extraction, the leaves were soaked in the 400 ml of 95% ethanol for 4 hours, evaporated ethanol, and
lyophilized by lyophilizer. The result showed that all hot water extract had higher values than ethanolic extract.
The extract boiled for 5 min had the highest total phenolic content with 130.43 ± 5.34 mg gallic acid equivalent
(GAE)/ g extract, total flavonoid content with 93. 39 ± 4. 33 mg catechin equivalent (CTE)/ g extract and the
scavenging of DPPH radical with inhibition concentration (IC50) of 26.82 ± 0.67 µg/ml and the scavenging of
ABTS radical with IC50 of 10. 44 ± 0. 49 µg/ ml. This experiment is a preliminary study of the hot water
extraction time of Rang Chuet which can be applied in daily life without chemical extraction.

⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀
Keywords : Antioxidant, Flavonoid, Phenolic, Rang chuet, Thunbergia laurifolia

Introduction
Natural products are the good alternative food for healthy people because it contains many nutrients,

including phytochemical compounds that have antioxidant properties such as polyphenols, flavonoids and
carotenoids. It can be found in fruits and vegetables for example Ipomoea aquatica Forsk. [1], Lactuca sativa
[2] , Tiliacora triandra and Thunbergia laurifolia [3]

Free radicals are unpaired atoms or molecules that found in cell metabolism, air pollution, and
smoking. It can damage cells and lead to various diseases such as, cancer, aging, heart disease and high blood
pressure. Antioxidants are active substances that can reduce free radicals in the body and slow down the cell
damage. Thunbergia laurifolia or Rang Chuet has been used as a traditional medicine for long time in tropical
areas of Asia. It is mainly used to detoxify poisonous plants or animals, reduce the amount of ethyl alcohol in
the blood [4], and also can alleviate food poisoning [5]

OB4_02_01

251

12th SCiUS Forum

Therefore, the purposes of this study were to analyze the total phenolic and flavonoid contents of
water extracts compared to ethanol extract and to study the antioxidant activity of Thunbergia L. extract by
DPPH and ABTS method.

Methodology
Preparation of plant extraction⠀ ⠀ ⠀ ⠀ ⠀ ⠀ ⠀ ⠀ ⠀ ⠀ ⠀ ⠀ ⠀ ⠀ ⠀ ⠀ ⠀ ⠀ ⠀ ⠀ ⠀

The 20 grams of fresh Thunbergia laurifolia leaves were chopped to small pieces. Then, boiled in
200 ml of distilled water at 90 degrees Celsius for 5, 10 and 15 minutes respectively. The solutions were
filtered through cotton and re-filtered through 2 layers of cheesecloth. Following the filtration, the solutions
were centrifuged at 8000 round per minutes for 10 minutes at room temperature and dried by lyophilizer. The
hot water extractions were called TLB5, TLB10 and TLB15. For ethanol extraction or TLE, the 40 grams of
fresh leaves were blend thoroughly. Then, soaked in the 400 ml of 95% ethanol for 4 hours, evaporated ethanol,
and dried by lyophilizer.

Determination of total phenolic content
The total phenolic content was quantified using the Folin- Ciocalteu method 200 μl of extract was

added to 1000 μl of 10% Folin-Ciocalteu, 800 μl 75% sodium carbonate. The mixture was incubated at room
temperature in the dark for 15 minutes. Then, measure the absorbance at 765 nm with the spectrophotometer.
The total phenolic contents were calculated on the basis of the calibration curve of Gallic acid standard.

Determination of total flavonoid content
The total flavonoid content of extract was investigated using the aluminum chloride colorimetry

method. 200 μl of extract was added to 75 μl 5% sodium nitrite. The mixture was incubated in the dark for 6
minutes. 150 μl of 10% aluminum chloride was added and incubated in the dark for 5 minutes. After that 500
μl of 1M Sodium Hydroxide and 1525 μl of distilled water were added. Then, measure the absorbance at 510
nm with the spectrophotometer. The total flavonoid contents were calculated on the basis of the calibration
curve of Catechin standard.

Determination of Antioxidant Activity by DPPH Radical Scavenging Assay
The DPPH radical was prepared by mixing DPPH solution with 2.45 mM aqueous solution of

potassium persulfate at room temperature in the dark for 12 hours. Then, 100 µl of sample at different
concentration was mix with 900 µL of the DPPH radical solution. The mixture was then incubated at room
temperature for exactly 15 min in the dark. Then, measured the absorbance at 517 nm in Spectrophotometer.
Ascorbic acid was used as a reference standard.

Determination of Antioxidant Activity by ABTS Radical Scavenging Assay
The ABTS radical was prepared by mixing ABTS solution with 2.45 mM aqueous solution of

potassium persulfate at room temperature in the dark for 12 hours. Then, 10 µl of sample at different
concentration was mix with 990 µL of the ABTS radical solution. The mixture was then incubated at room
temperature for exactly 6 min in the dark. Then, measured the absorbance at 735 nm in Spectrophotometer.
Ascorbic acid was used as a reference standard.

OB4_02_01

252

12th SCiUS Forum

Results
Determination of total phenolic content

The result found that the extracts with ethanol and water for 5 minutes had the highest and similar
total phenolic content in the range of 130 – 133 mg GAE/ g extract. The extract with water for 10 and 15
minutes showed a decrease in total phenolic content in the range of 115 – 121 mg GAE/g extract.

Figure 1 Bar chart showed the determination Table 1 showed the determination of total phenolic content
of total phenolic content (mg GAE/g extract) (mg GAE/g extract)

Determination of total flavonoid content

The result found that the extracts with water for 5 minutes had the highest total flavonoid content is
93 mg CTE/ g extract. The extract with ethanol and water for 10 and 15 minutes showed a decrease in total
flavonoid content in the range of 81 – 84 mg CTE/g extract.

Figure 2 Bar chart showed the determination Table 2 showed the determination of total flavonoid content
of total flavonoid content (mg CTE/g extract) (mg CTE/g extract)

DPPH radical scavenging assay

The results showed that the highest antioxidant capacity was the ethanol extract than the water
extracts for 5,10 and 15 minutes, respectively. The DPPH radical inhibition of Thunbergia laurifolia extract
were ranged from 22.41-29.38 µg/ml.

Figure 3 Bar chart showed Figure 4 Bar chart showed Figure 5 Bar chart showed Figure 6 Bar chart showed
the DPPH radical scavenging of TLE the DPPH radical scavenging of TLB5 the DPPH radical scavenging of TLB10 the DPPH radical scavenging of TLB15

OB4_02_01
253

12th SCiUS Forum

ABTS radical scavenging assay
The results showed that the highest antioxidant capacity was extracted with ethanol and slightly

higher in performance compared to extract with water 5, 10 and 15 minutes. The ABTS radical inhibition of
Thunbergia laurifolia extract were ranged from 10.05-11.82 µg/ml.

Figure 7 Bar chart showed Figure 8 Bar chart showed Figure 9 Bar chart showed Figure 10 Bar chart showed
the ABTS radical scavenging of TLE the ABTS radical scavenging of TLB5 the ABTS radical scavenging of TLB10 the ABTS radical scavenging of TLB15

Conclusion

Table 3 showed the determination of total phenolic content (mg GA/g extract), total flavonoid content (mg CT/g extract), DPPH and ABTS radical scavenging

The results showed that TLB5, had the highest total phenolic content and antioxidant capacity
followed by TLB10 and TLB15 respectively. TLE, ethanolic extract, had total phenolic content similar to
TLB5 (130.43 and 133.27 mg GAE/ g extract). In contrast, total flavonoid content of TLB5 is higher than
TLE. Antioxidant activities both DPPH and ABTS of TLB demonstrated slightly lower than TLE.

Acknowledgements
This project was supported by Science Classroom in University Affiliated School (SCiUS). The

funding of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This
extended abstract is not for citation.

References
[1] Panumart R., Yaowapha J. and Chanon M. Effect of Folic Acid on Growth and Antioxidants of Kangkong

(Ipomoea aquatica Forsk.), 2017:59-71
[2] Thipawan I. and Paklao P. Study of Antioxidant Activity and Total Phenolic Compound from letture,

2017:926-929
[3] Jaruwan P. and Kwandaw J. Production of Tea with Antioxidants from Rang Jued and Yanang leaves,

2017:599-607
[4] Pimyada P. The efficiency of Thunbergia laurifolia lindl. and Bauhinia strychnifolia craib. on reduction

of blood alcohol concentration, 2019:71,48-53
[5] Chanthaporn M. (2020). The study of Thunbergia laurifolia Lindl. (Rang Jued) Usage as Antidote

OB4_02_01

254

12th SCiUS Forum

Title : Searching for bioactive compounds in Piper which OB4_18_02
inhibit the binding of TNF-alpha receptors.
Field :
Biology and Biodiversity

:Author Mr. Chanasit Phongphanit

School : Miss Nutticha Prawannago
Miss Bhornphat Sirijinda

Surawiwat school, Suranaree University of technology

:Advisor Prof. Dr. Montarop Yamabhi (Suranaree University of technology)

Assoc. Prof. Dr. Kiattawee Choowongkomon (Kasetsart University)

Abstract
Type I Hypersensitivity Reaction is the response of the immune system in which the body immediately

responds to allergens. The mechanism results in mast cell degranulation and releasing of mediators which then
leads to allergic rhinitis symptoms such as nasal itching and stuffiness, and increasing of mucus in nose and
throat. These illnesses can be relieved by various types of medication.

According to “Thai Ancient Homeopathy volume 3”[3], Black pepper or Piper, is considered to be
one of the medicine compositions containing the highest amount of amongst other herbs in asthma medical
recipe. From this fact, our project is aimed to study and search for bioactive compounds in Piper for inhibiting
the binding of TNF-alpha receptors, the critical cytokine receptors which stimulate the activities in the immune.

To probe this project, Molecular Docking is used to identify the binding of 3-dimensional structures
of bioactive compounds in Piper. Consequently, the result shows that Piperolein B gives the highest energy
value of -51.73 KJ/mol, in which its ability to lessen inflammation also referred from a previous scientific
research.

Keywords : TNF-alpha, Molecular Docking, Piperolein B

Introduction
Nowadays, Allergic Rhinitis, the inflammation of the nose caused by allergens such as pollen, dust

and animal fur, is still a symptom that cannot be completely cured. Therefore, searching for bioactive
compounds which can lessen the inflammation of the immune system is considerably essential. This project
began with the study from “ Thai Ancient Homeopathy vol.3” which has said that its asthma treatment recipe
has the ability to cure Allergic Rhinitis. We also observed that Piper was one of the ingredients in the recipe,
in which it contains 1000 grams in the total amount of 2200 grams. For this reason, we were interested in
Piper's ability to lessen the inflammation of Allergic Rhinitis.

In terms of the mechanism of Allergic Rhinitis, this illness belongs to Type-1 Hypersensitivity
Reaction, an immediate reaction which involves immunoglobulin E (IgE) mediated release of antibodies
against antigen, as the results of mast cell degranulation and the releasing of mediators such as Interleukin,
VegF and cytokine.

OB4_18_02/1

255

12th SCiUS Forum

In this work, the relation between the receptor of cytokine called TNFRc1 and bioactive compounds
in Piper was studied by means of Molecular Docking, a way of predicting the ability of protein binding with
other ligands through application, “Gold Suite 5.3” to analyze whether bioactive compounds have the best
stability to bind with TNF-alpha at the binding site or not.

Methodology
Materials and Websites :

The experiment studied the structure and the binding of TNF-alpha with bioactive compounds of
Piper. “Gold suite 5.3” (protein-ligand docking software), “Pymol” (3D molecular visualization system), and
“Biovia Discovery Studio 2021” (visualization tools) were used to help analyze data, and RCSB and PubChem
were used as protein databases.
1.Selecting of TNF-alpha structure

The 3-dimensional structure of TNF-alpha was found and selected amongst other protein structures
in order to study by “Molecular Docking”. In this study , the TNF-alpha must be approved by many resources.
TNF-alpha PDB with the code ”1FT4”[1] which was photochemically enhanced by the binding of a small
molecule, was chosen to be the study model. Also, there was sufficient data provided on ligands to study.
2. Self-Docking for finding parameters

Find the appropriate site for binding, and select the appropriate score function for 1FT4 and ligands,
by modeling the binding of TNF-alpha structure in normal situations. Consequently, observe the overlaying of
these protein-protein interaction then Self-Docking the binding of 1FT4 and its ligand at GLU56, GLY58,
SER59, LEU67, ARG68, HIS69, LEU71, SER72, CYS73, LYS75, ARG77, LYS78, GLU79, MET80 and
GLY81. The most effective binding structures were tested by adjusting various types of parameter and scoring
function, namely; GOLD, ASP,Chem and Chemplp, determined by the Root-mean-square deviation (RMSD)
and the amount of compound energy.
3. Selecting bioactive compounds for the experiment

Find and select the qualified bioactive compound structures in Piper from the database named
“PubChem” (https://Pubchem.ncbi.nlm.nih.gov) to find protein information and references for each compound
research .
4. Docking 1FT4 and bioactive compounds with Piper

Self-Docking was done by deleting the ligand of TNf-alpha. Subsequently, altogether 10 bioactive
compounds in Piper were binded with TNF-alpha at the binding site. Parameters from Self- Docking were used
to compare the results considered from the structures, binding positions and energy to obtain the best
conclusion.

Results
The result can be divided into 2 major parts; Self-docking of 1FT4 and testing the binding of bioactive

compounds in Piper with a TNF-alpha receptor.
Part 1 : Self-docking of 1FT4

OB4_18_02/2

256

12th SCiUS Forum

1.1 Scoring functions used in the experiment

The Self-docking of 1FT4 was done 3 times Scoring Function RMSD
through Gold, ASP and ChemPLP scoring Functions Gold 16.298
then the RMSD values were compared as in the table. ASP 16.493
According to the data in the given table, GOLD scoring Chem PLP 18.246
function gave the lowest value of RMSD (Root Mean
Squared Deviation), which means it was the most
accurate type of scoring function for the 1FT4 model.

1.2 Considering the nearby amino acids of 1FT4’s ligand Table 1: RMSD of each Scoring Function by GOLD 5.3
From the result of 1FT4 self-docking by

Discover Studio 2021 , the selected amino acids around 1FT4’s ligand which must be bonded with bioactive

compounds were GLU56 GLY58 SER59 LEU67 ARG68 HIS69 LEU71 SER72 CYS73 LYS75 ARG77

LYS78 GLU79 MET80 and GLY81

Part 2 : Testing the binding of bioactive compounds in Piper with a TNF-alpha receptor
This step was done through Gold suite 5.3. The Fitness scores illustrated by the Gold scoring function

are shown as follows:

According to table 2, a total of 10 Piper Fitness Ligand name Fitness Ligand name
active compounds were bonded to 1FT4. The binding 53.46 1FT4 43.17 1548912
efficiency was determined based on the energy. The 51.37 21580213 42.90 638024
result can be seen that Z21580213 (Piperolein B) gave
the highest Fitness score at 51.37 kJ/mol.

45.14 11141599 42.55 5320618

44.95 12985527 41.81 636537

44.39 90335471 40.40 10131321

Figure 1: the bonding of 1FT4 and Piperolein B.

The structure showed that Z21580213 44.15 101878852
binds to TNF-alpha. The binding position is as
follows: CYS73 LYS75 CYS76 LYS78 CYS88. Table 2 : Fitness energy score of each ligand from docking
1FT4 via Gold scoring function and Gold suite 5.3
Searching biological test results of Piperolein B
was found to have effects on tumor necrosis factor-
alpha (TNF-alpha)-induced death of hepatocytes.

OB4_18_02/3

257

12th SCiUS Forum

Discussion
Piperolein B and Piperine S should be studied in the laboratory as well, in order to confirm the ability

to bind with TNF-alpha coupled with the study from Molecular Docking. In addition, once the experiment has
been held, this might lead to further development in the future. In other words, the bioactive compounds could
be used as medicine to cure Allergic Rhinitis.
Conclusion

The study of a cytokine called TNF-alpha and the relationship between the binding with receptors was
thoroughly observed and analyzed by Molecular Docking. The bioactive compounds in Piper (Z5320618,
Z101878852, Z638024, Z1548912, Z10131321, Z12985527, Z90335471, Z11141599, Z21580213 and
Z636537) were used as ligands. In conclusion, Z21580213 (Piperolein B), gave the highest Fitness score and
the highest energy value of -51.73 KJ/mol. Moreover, Piperolein B is said to have the ability to lessen the
hepatic inflammation caused by the activity of TNF-alpha receptor[2], but there was still no evidence on where
the certain binding site was located. However, it could be seen from this project that the organic compound can
bind with TNF-alpha at CYS73, LYS75, CYS76, LYS78, and CYS88.

Acknowledgements
This project was supported by Science Classroom in University Affiliated School (SCiUS). The

funding of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This
extended abstract is not for citation.

References
1. Carter PH, Scherle PA, Muckelbauer JA, Voss ME, Liu RQ, Thompson LA, et al. Photochemically

enhanced binding of small molecules to the tumor necrosis factor receptor-1 inhibits the binding of TNF-
α. PNAS. 2001 Oct 9;98(21);11879-11884.
2. Hisashi M, Kiyofumi N, Toshio M, Daisuke Y, Itadaki Y, Masayuki Y. Hepatoprotective amide
constituents from the fruit of Piper chaba : Structural requirements, mode of action, and new amides.
Bioorg. Med. Chem.2009 Aug 19;17(22);7313-7323.
3. อำพนั กิตติขจร. คมั ภรี ์แพทยไ์ ทยแผนโบรำณ เล่ม 3. กรุงเทพมหำนคร: โรงพิมพอ์ ุตสำหกรรมกำรพิมพ;์ 2504.

OB4_18_02/4

258

12th SCiUS Forum

Title : Influence of multiple stresses on the growth and viability OB4_03_08
of yeast
Field : Environmental science and Ecology
Author : Kwandai Janpleng
Warinrada Sornso
School : Naresuan University Secondary Demonstration School
Advisor : Asst. Prof. Pongsanat Pongcharoen

Abstract
In the process of yeast fermentation, yeast will be subjected to a variety of stress factors besides

temperature. Stresses can damage the phospholipid cell membrane and lead to negative consequences such as
loss of minerals and water. In addition, yeast responds to the stress by becoming starvation to maintain its
intracellular metabolism. Oxidative stress, furfural oxidative stress and osmotic stress are main factors
causing yeast death .Therefore, the yeast used in ethanol production should be able to withstand the stress
conditions that occur during the ethanol production process. The objective was to study the effects of various
stresses including furfural, hydrogen peroxide, glucose and sodium chloride on the growth of yeast. The
stresses used were concentrations of glucose, sodium chloride, hydrogen peroxide and furfural. From the
results, it was found that the isolated yeast strains Pichia kudriavzevii and Candida tropicalis were more
resistant to stress than the yeast reference Saccharomyces cerevisiae TISTR 5606. Therefore, it can be
concluded that natural yeast is more resistant to stress when applied to the industrial system because the
environment in which the yeast live has a variety and high stress factors. By the way, each yeast has a
different ability to withstand stress. Therefore, if used in various industrial systems more research and
experimental studies should be done to determine whether the selected yeast can withstand the stress in the
desired environment.

Keywords: yeast, oxidative stress, furfural oxidative stress, osmotic stress

Introduction
Yeasts are indispensable organisms in various industrial processes, such as wine, cider, and beer

making and more recently, in biofuel production. During industrial fermentation brewing strains of yeast are

exposed to fluctuations in oxygen concentration, osmotic potential, pH, ethanol concentration, nutrient
availability, and temperature (Briggs et al., 2004). These stresses will affect the survival of the yeast. Stresses

can damage the phospholipid cell membrane and lead to negative consequences such as loss of minerals and
water. In addition, the yeast responds to the stress by becoming starvation to maintain its intracellular
metabolism. If it cannot tolerate external stresses, the yeast will die and give resulting in low yields. The

yeast mostly used for ethanol production in Thailand is Saccharomyces cerevisiae which is generally
intolerant to stress and high temperatures so the yeast will die when it is applied to the industrial system. A

OB4_03_08/1

259

12th SCiUS Forum

typical industrial solution is to use a cooling system that consumes a lot of costs. By the way, the stress that
affects yeast is not only temperature. In ethanol fermentation, yeast is exposed to various environmental
stress factors which affect yeast cell survival rate. Oxidative stress, Furfural oxidative stress, and osmotic
stress are the main factors causing yeast death and decreasing ethanol production.

Methodology
The experiments were divided into 3 parts as follows

Part 1: Preparation of yeast samples
1.1 Make YPD liquid medium by mixing 1% yeast extract, 2% glucose, and 2% peptones.
1.2 Inoculate 1 µL of yeast sample into 3 mL of YPD liquid medium and incubate in a shaking

incubator at 30°C for 14-16 hr.
Part 2: Preparation of YPD agar

2.1 Make YPD agar by mixed 1% yeast extract, 2% glucose, 2% peptones and 1.8 agars with different

stress

1. Glucose concentration 20% and 40%

2. NaCl 0.5 M, 1 M and 1.5 M

3. Hydrogen peroxide 40 mM and 60 mM

4. Furfural 15 mM and 30 mM

Part 3: Streaking plate

3.1 Write the name of the sample yeast isolated

on a plate for 20 isolates and write TISTR 5606 for every
plate.

3.2 Bring all 21 isolates of yeast to streak on the plate for each
strain, and incubate at 30 °C for 1-5 days.

Results
All 21 isolates of yeast couldn’t resist the stress at 60 mM of H2O2 concentration and 30 mM of

furfural concentration. We could classify yeasts into two groups that were highly tolerant to stress factors and
were similar.

Group 1: stress tolerance to glucose, H2O2, and NaCl. Under the stresses, yeast Pichia kudriavzevii
isolates CG-P1, Candida tropicalis isolates TI-P1, TI-P2, TI-P3, TI-P4, TI-P5, TI-P6, and TIP8 couldn’t grow
and were resistant to the stress at 30mM of Furfural concentration but could grow and be resistant at 15 mM
of Furfural concentration, 40% of Glucose concentration, 40 mM of H2O2 concentration, 1.5M of NaCl
concentration and was more resistant to stress than yeast standard, S. cerevisiae TISTR 5606.

OB4_03_08/2

260

12th SCiUS Forum

Group 2: stress tolerance to furfural, glucose, and NaCl. Under the stresses, yeast P. kudriavzevii
isolates CG-P3, CG-S1, CG-S2, KL-P1, and OR-J3 couldn’t grow and were resistant to the stress at 40 Mm of

H2O2 concentration but could grow and resistant at 15 mM of furfural concentration, 30 mM of furfural
concentration, 40% of Glucose concentration, 1.5 M of NaCl concentration and was more resistant to stress

than yeast standard, S. cerevisiae TISTR

5606.

Conclusion
From the research studied and the result can be analyzed that natural yeast is more resistant to stress

when applied to the industrial system because the environment in which yeast live has a variety and highly
stressful factors.

Each yeast has a different ability to withstand stress. Therefore, if it applies to use in various
industrial systems there should be more experimental research and study to determine that selected yeast can
withstand stress in its intended environment. and the 21 isolates of yeast used in the experiment were more
resistant to stress than yeast reference Saccharomyces cerevisiae TISTR 5606 which is currently used.

Acknowledgments
This project was supported by Science Classrooms in University Affiliated School (SCiUS) under

Naresuan University and Naresuan University Demonstration School. The funding of SCiUS is provided by
the Ministry of Higher Education, Science, Research and Innovation, which is highly appreciated. This
extended abstract is not for citation.

OB4_03_08/3

261

12th SCiUS Forum
References
1. Yasin Kitichantaropas. Cellular mechanisms contributing to multiple stress tolerance in,Saccharomyces
‘’’’’’’’’,,,’’’cerevisiae strains with potential use in high-temperature ethanol fermentation. 2016

2. Priyanka Saini. (2018). Response and tolerance of yeast to changing environmental

,,,,,stress during ethanol fermentation. Process Biochemistry. 1-12.
3. D'Amore, T., Panchal, C.J., Russeil, I. et al. (1988). Osmotic pressure effects and intracellular

accumulation of ethanol in yeast during fermentation. Journal of Industrial Microbiology. 2,
365–372

OB4_03_08/4

262

12th SCiUS Forum

Title: Finding multidrug-resistant Staphylococcus epidermidis: OB4_07_0

Field: Who wins or loses? 2
Biology and Biodiversity

Author: Jiranuch Kongkaem, Pritprapoan Wonkyai, Achira Charoenwattanamaneechai

School: Mahasarakham University Demonstration School (Secondary)

Advisor: Nuchsupha Sunthamala (Department of Biology, Faculty of Science, Mahasarakham University)

Abstract:
Coagulase-negative Staphylococcus epidermidis are resistant to various antibiotics. The infection of

this bacterial is a severe problem in the hospital, with a mortality rate of up to 10% per year. Moreover,
co-infection of antibiotics resistance S. epidermidis with SARS-COV-2 in COVID-19 patients also contributed
to the progression rate of severe COVID-19 patients. To understand and obtain information on antibiotics
resistance S. epidermidis in 2 groups, including high school (n=20) and college students (n=18), the bacteria
were collected by external nasal swab, disk diffusion and biofilm formation were performed. From the total,
72 strains were found positive for Staphylococcus spp. Forty-three strains (59.72%): high school students
(11 of 23 strains, 47.82%), college students (32 of 49, 65.31%). 38 out of 72 strains (52.78%) were identified
as S. epidermidis, including ten strains from high school students (43.48%) and 28 strains from college students
(57.14%). All 38 S. epidermidis strains were categorized as multidrug-resistant (MDR). Five strains were
found as methicillin resistance (MR). The methicillin resistance S. epidermidis was found in high school
students for two strains (2 of 23 strains, 8.70%) and college students for three strains (3 of 49 strains, 6.12%).
The biofilm formation was divided into four characteristics: non-adherent biofilm (1 strain from college
students), weak biofilm (total 34 strains, 10 strains from high school students, and 24 strains from college
students), moderate biofilm (2 strains from college students), and strong biofilm (1 strain from college
students). Interestingly, biofilm formation also relates to antibiotics resistance, especially in the moderate and
strong biofilm formation groups. The moderate biofilm was resistant to penicillin,
trimethoprim/sulfamethoxazole, and chloramphenicol. Strong biofilm showed a similar pattern to moderate
biofilm with the addition of erythromycin and clindamycin resistance. Thus, college students tend to find
higher antibiotic resistance and strong biofilm formation S. epidermidis than high school students. This
phenomenon might involve age and environmental factors.

Keywords: Staphylococcus epidermidis, Antibiotic resistance, disk diffusion, biofilm formation

Introduction
Bacterial infectious disease in the hospital was a significant problem in public health around the world

since bacteria had crucial roles in nosocomial infections Staphylococcus spp. was bacteria that can be found
on the skin and causes many diseases, for instance, urinary infection, respiratory infection, wound infection,
soft tissue infection and pericardium inflammatory (1). Staphylococcus epidermidis is gram-positive bacteria,
non-motile, facultative anaerobic and coagulase-positive (2). Moreover, S. epidermidis caused nosocomial

OB4_07_02/1

263

12th SCiUS Forum

infection and was found it can be made pericardium inflammatory by more than 15%, increase abscess in heart
rate by 38% and lethally rate by 24%. Currently, S. epidermidis resist several classes of antibiotics, which is
quite a severe problem in the hospital. The report showed in The United States, up to 100,00 people got infected
and died from infection as far as 10% per year (3). Furthermore, co-infection with antibiotic resistance in
hospital infection could help germs develop virulence factors in patients. Thus, our study recognizes this
considerable problem, which focused on the study of multidrug-resistant S. epidermidis in high school and
college students. This information might be used for protecting patients from co-infection with respiratory
tract diseases.

Methodology
1. Sample collection, bacterial culture, and isolating of Staphylococcus spp. strains
38 samples were collected by external nasal swab and cultured on Brain Heart-Infusion (BHI) broth and
Baird Parker Agar (BPA) at 37 °C for 24 h. For isolation of Staphylococci, the dark colonies were selected
from BPA by picking a colony to Tryptic Soy broth (TSB) and culture at 37 °C for 24 h.
2. Bacterial DNA extraction and identification of Staphylococcus
epidermidis
Total genomic DNA of bacteria was performed by using the GF-1 Bacterial DNA Extraction Kit (Vivantis)
to acquire pure DNA of every strain. Total genomic DNA of isolated Staphylococcus spp. was used as a
template for polymerase chain reaction (PCR). The specific primers of Staphylococcus spp. and
S. epidermidis were used in the PCR reactions. The amplification products were revealed by agarose gel
electrophoresis.
3. Antibiotics susceptibility tests
Antibiotics susceptibility tests were performed according to CLSI 2020 standard analysis. Antibiotics for
disk diffusion assay including CX-cefoxitin, P-penicillin, COT-trimethoprim/sulfamethoxazole, C-
chloramphenicol, LZ-Linezolid, CIP-ciprofloxacin, CT-tetracyclin, RIF-rifampin, GEN-gentamycin. For E-
erythromycin and CD-clindamycin susceptibility, the D-test was performed. The clear zone was interpreted
according to the CLSI standard and adjusted whether the strains were susceptible, intermediate or
resistant.
4. Biofilm formation
Isolated bacteria were seeded on a 96-well plate and cultured in TSB at 35 °C for 24 h. Then stain each well
with crystal violet and measure absorbance density at 595 nm.
5. Statistical analysis
The results were analyzed by using Fisher’s exact with two-way p-value analysis (Graphpad Prism).

Result, discussion, and conclusion
The samples were collected from volunteers, both males and females. The First group was aged between

16-18 years old (n=20), and the second group was aged between 19-22 years old (n=18). All volunteers had

OB4_07_02/ 2

264

Marker 12th SCiUS Forum
PStCaRpDhnyeMlgoSacTtio8vc8ec40us aureus
no sign of symptoms that indicated any illness. Samples were collected by external nasal cavity swab,
culture in Brain Heart-Infusion broth (BHI broth), then acquired 38 samples from 38 volunteers.

Sample cultured from the previous step extracted their DNA using GF-1 Bacterial DNA Extraction Kit
(Vivantis). The total DNA was tested PCR for Staphylococcus spp. (Figure 1A). From the total, 72 strains
were found positive for Staphylococcus spp. Forty-three strains (59.72%). Eleven of 23 strains (47.82%)
were identified as Staphylococcus spp. from high school students. 32 out of 49 strains (65.31%) were
positive for Staphylococcus spp. from college students (p-value = 0.53). Next, all the positive strains from
the previous PCR test were performed with a primer specific for Staphylococcus epidermidis. 38 of 72
strains (52.78%) were identified as Staphylococcus epidermidis, including ten strains from high school
students (43.48%) and 28 strains from college students (57.14%) (p-value = 0.66) (Figure 1B).

AB

PCR positive

Figure 1. Identification of Staphylococcus epidermidis strains by polymerase chain reaction (PCR) using
specific primers. (A) PCR product. (B) Percentages of Staphylococcus spp. and Staphylococcus epidermidis
strains in high school and college students.

The antibiotics susceptibility was performed by disk diffusion assay. This assay was interpreted by
measuring the clear zone and comparing table 2A - 2I in CLSI M100-S24. The level of susceptibility to
antibiotics drug was categorized into three groups consist of S=susceptible, I=intermediate, and
R=resistance. Top 5 of antibiotics resistant consist of cefoxitin (R=5 I=0 S=33) and penicillin (R=38 I=0
S=0), tetracycline (R=21 I=0 S=17), erythromycin (R=15 I=3 S=20) and clindamycin (R=17 I=11 S=10)
(Figure 2A).

In addition, the susceptibility of inducible clindamycin resistance by erythromycin was performed by D-
test. The result found D-test positive 21 strains from a total of 38 S. epidermidis strains (55.36%), including
five strains from high school students (5 of 23 strains, 21.74%) and 16 strains from college students (16 of
49 strains, 32.65%) (p-value = 0.59).

Moreover, a total of 38 S. epidermidis strains were categorized as extensively drug-resistant (XDR) for 0
strains (0.00%), multidrug-resistant (MDR) for 38 strains (100.00%), and methicillin resistance (MR) for
five strains (13.16%) ((p-value = 1.00). In addition, the methicillin resistance Staphylococcus epidermidis
was found in high school students for two strains (2 of 23 strains, 8.70%) and college students for three
strains (3 of 49 strains, 6.12%) (p-value = 0.61).

38 S. epidermidis strains from 14 volunteers were cultured for biofilm formation. After 24 h of culture, the
biofilm formation was divided into four characteristics: non-adherent biofilm (1 strain from college students,

OB4_07_02/ 3

265

12th SCiUS Forum

p-value = 1.00), weak biofilm (total 34 strains, 10 strains from high school students, and 24 strains from
college students, p-value = 0.79), moderate biofilm (2 strains from college students, p-value = 1.00), and
strong biofilm (1 strain from college students, p-value = 1.00) (Figure 2B).

AB

Figure 2. (A) Antibiotics susceptibility test of Staphylococcus epidermidis strains. (B) Biofilm formation of
Staphylococcus epidermidis strains.

The result from disk diffusion data analysis and biofilm formation showed that the MDR strains were
found in four types of biofilm formation. Interestingly, biofilm formation also relates to antibiotics
resistance, especially in the moderate and strong biofilm formation groups. The moderate biofilm was
resistant to penicillin, trimethoprim/sulfamethoxazole, and chloramphenicol. Strong biofilm showed a
similar pattern to moderate biofilm with the addition of erythromycin and clindamycin resistance.

In conclusion, the college students tend to find higher antibiotic resistance and strong biofilm formation
S. epidermidis than high school students. This phenomenon might involve age and environmental factors.

Acknowledgment
This project was supported by Science Classroom in University Affiliated School (SCiUS). The funding

of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This extended
abstract is not for citation.

References
1. Safarpoor Dehkordi, F. Gandomi, H. Basti, A. Misaghi, A. Rahimi, E. (2017). Phenotypic and genotypic
characterization of antibiotic resistance of methicillin-resistant Staphylococcus aureus isolated from hospital
food. Antimicrobial Resistance and Infection Control, 6(1), 1-11.
2. Namvar, A. Bastarahang, S. Abbasi, N. Ghehi, G. Farhadbakhtiarian, S. Arezi, P. Hosseini, M.
Baravati, S. Jokar, Z. Chermahin, S. (2014). Clinical characteristics of Staphylococcus epidermidis: a
systematic review. GMS hygiene and infection control, 9(3), Doc23.
3. Chabi, R. Momtaz, H. (2019). Virulence factors and antibiotic resistance properties of the Staphylococcus
epidermidis strains isolated from hospital infections in Ahvaz, Iran. Tropical Medicine and Health, 47(1),
56.

OB4_07_02/ 4

266

12th SCiUS Forum

Title : The Study on Influence from Temperature and OB4_09_02
Acidity to Recombinant Bacteriocin Mechanism
Field : Biology and Biodiversity
Author : Mr. Chayut Keeratichaowanakul
Miss Chutikarn Viroonharat
School : Miss Karima Nisub
Advisor : Darunsikkhalai school Engineering Science Classroom (KMUTT)
Asst. Prof. Dr. Nujarin Jongruja
Mr. Witsanu Supundee

Abstract :
Currently, there have been many reports about side effects of antibiotics used in animals such as

increasing of drug resistance bacteria infection and drug residue effect. This phenomenon has a direct effect
on the animal feed industry. Consequently, many countries encourage to stop the use of antibiotics along with
supporting the use of antimicrobial peptides likewise bacteriocin. Leading to this research which studies
activity of bacteriocin produced by Streptococcus thermophilus KLDS 3.1003 as recombinant bacteriocin. The
recombinant bacteriocin obtained from S. thermophilus KLDS 3.1003 which is classified in class II bacteriocin
can be called as S.ther bacteriocin. The bacteriocin was tested for antimicrobial efficiency on Staphylococcus
aureus and Bacillus subtilis in different conditions of temperature at 50°C to 100°C for 30 minutes and acidity
at pH 3 to pH 12 by using spectrophotometric method. The results showed that S.ther bacteriocin has
antimicrobial activity on both pathogenic bacteria in conditions of temperature at 50°C to 100°C which has
most activity at 50°C as a result of class II bacteriocin property. Along with acidity conditions at pH 3 to pH
12 which has most activity at pH 4. The results suggested S.ther bacteriocin to have potential antimicrobial
activity despite being in high temperature. Moreover, this would become a future application prospect in the
animal feed industry.

Keywords : Streptococcus thermophilus / recombinant bacteriocin / antibiotics / antimicrobial peptides /
animal feed

Introduction
The use of antibiotics is increasing, especially in the animal feed industry. However, drug abuse could

lead to bacteria drug resistance infection and drug residue effect. This phenomenon has a direct effect on the
animal feed industry. Consequently, many countries have stopped using antibiotics. In particular, animal feed
producers are searching for another solution to inhibit the growth of pathogenic microorganisms. Numerous
research shows that using antimicrobial peptides could restrain the growth of pathogenic microorganisms
without drug residue. Generally, antimicrobial peptides are able to be used safely in the animal digestive
system. Antimicrobial peptides (AMPs) are small molecular peptides with less than 5 0 aminos and can be
found in many organisms including bacteriocin. Leading to this research which aims to study the activities of
bacteriocin to inhibit growth of pathogenic microorganisms in different environments. Provided that
bacteriocin from nature is unable to control production, genetic engineering is used to produce bacteriocin as

For internal use in the 12th SCiUS Forum only. Not for citation.
267

12th SCiUS Forum

recombinant bacteriocin. Recombinant bacteriocin produced by Escherichia coli BL21 DE3 which has
Streptococcus thermophilus KLDS 3.1003 bacteriocin-producing gene would be called S.ther later on in this

research. Subsequently, S.ther will be tested to inhibit growth of antimicrobials in the animal feed industry.

Methodology
Part 1 : Bacteriocin Production and Purification

1. Cultured 2% Escherichia coli BL21 (DE3) in SOB broth contained 0.1% ampicillin and incubated at
37°C for 3 hours.

2. Measured optical density (O.D.) by spectrophotometer at 6 0 0 nm wavelength. When O.D.
approximately equal 0 . 4 to 0 . 6 , 1 M Isopropyl Beta-D-1 - thiogalactopyranoside (IPTG) was added
and incubated at 16°C overnight.

3. Centrifuged at 3000 rpm for 5 min, then seperated protein from host cells by sonication method at 20
kHz frequency.

4. Purified S.ther bacteriocin by Ni-NTA column which was inserted into Fast protein liquid
chromatography (FPLC), then eluted column by 1 M imidazole elution buffer.

5. Adjusted concentration of imidazole by dialysis bag before investigation of gene expression by SDS-
PAGE.

Part 2 : Stability test of bacteriocin
1. Stability of bacteriocin to temperatures
Prepared S.ther bacteriocin in centrifuge tube, then tested bacteriocin on water bath at 50, 60, 70, 80,
90 and 100°C for 30 min. Temperature of samples had been decreased to room temperature before
they were tested by spectrophotometric method.

2. Stability of bacteriocin to pH values
Prepared S.ther bacteriocin in test tube which was adjusted to several pH values include pH 3.0, 4.0,
5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0 and 12.0 at 37°C for 2 hours, then tested bacteriocin by
spectrophotometric method.

Part 3 : spectrophotometric method
1. Pipetted 50 µl S.ther bacteriocin which tested in different conditions and 50 µl pathogenic bacteria in
96-well plate, repeat for each pathogenic bacteria.
2. Brought 96-well plate into a spectrophotometer at 600 nm wavelength to measure O.D. and compared
with control. The lower O.D. value, the less the number of bacteria remaining.

OB4_09_02/2

268

12th SCiUS Forum

Results
S.ther bacteriocin which had taken temperature tests at 50, 60, 70, 80, 90 and 100 °C for 30 minutes

showed their antimicrobial activity (Figure 1). It could activate against B. subtilis and S. aureus at 50°C to
100°C. Observing from low O.D. value. It also showed maximal capacity at 50°C as its optimal condition.

Figure 1 : Influence of temperature on bacteriocin activity in B. subtilis and S. aureus inhibition.

S.ther bacteriocin which had taken acidity tests at pH 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0 and
12.0 for 2 hours showed their antimicrobial activity. It could activate against B. subtilis at pH 3 to pH 12 while
its optimal condition was at pH 3 to pH 4 (Figure 2). It was also active against S. aureus at pH 3 to pH 12
except pH 5 while its optimal condition was at pH 4 (Figure 3).

Figure 2 : The influence of acidity on bacteriocin Figure 3 : The influence of acidity on bacteriocin
activity in B. subtilis inhibition. activity in S. aureus inhibition.

Discussion
Nayab’s research showed that class II bacteriocin was active at high temperature conditions. The

results of this research were consistent with our results which is S.ther bacteriocin activity. S.ther bacteriocin
is a recombinant bacteriocin which its gene comes from Streptococcus thermophilus. Since bacteriocin
produced by S. thermophilus is classified in class II bacteriocin, S.ther bacteriocin as Class II bacteriocin is
still potential at high temperature conditions. S.ther bacteriocin was active against both bacteria at 50°C to
100°C and at pH 3 to pH 12 except the pH 5 condition which it didn’t show antimicrobial activity on

OB4_09_02/3

269

12th SCiUS Forum

Staphylococcus aureus. This phenomenon occurred when bacteriocin became a neutral form at a specific pH
condition and eventually lost its ability to perform antimicrobial activity. Consequently, S.ther bacteriocin
couldn’t activate against S. aureus at pH 5 As it was S.ther bacteriocin specific pH condition.
Conclusion

The experiment showed that S.ther bacteriocin was able to inhibit the growth of both B. subtilis and
S. aureus. S.ther is able to inhibit B. subtilis and S. aureus at 50°C to 100°C with optimal conditions at 50°C.
Also, S.ther bacteriocin was able to inhibit B. subtilis at pH 3 to pH 12 with optimal conditions at pH 3 and pH
4 and inhibit S. aureus at pH 3 to pH 12 with optimal conditions at pH 4.
Acknowledgements

This project was supported by Science Classroom in University Affiliated School (SCiUS) under King
Mongkut's University of Technology Thonburi and Engineering science classroom. The funding of SCiUS is
provided by Ministry of Higher Education, Science, Research and Innovation. This extended abstract is not for
citation.
References

1. Hassan MU, Nayab H, Rehman TU, Williamson MP, Haq KU, Shafi N, et al. Characterisation of
Bacteriocins Produced by Lactobacillus spp. Isolated from the Traditional Pakistani Yoghurt and
Their Antimicrobial Activity against Common Foodborne Pathogens. Biomed Res Int.
2020;2020:8281623.

2. Negash AW, Tsehai BA. Current Applications of Bacteriocin. Int J Microbiol. 2020;2020:4374891.

OB4_09_02/4

270

12th SCiUS Forum

Title : Efficacy of Bacillus spp. which inhibit Phytophthora palmivora and OB4_13_02

Lasiodiplodia theobromae causal agent of fungal rotten roots and rotten fruit disease
in durian (Durio ziberthinus Murr.)
Field : Biology and Biodiversity
Author : Mr. Panitan Kunpai, Mr. Thanapat Phona and Mr. Ittikorn Samma
School : Piboonbumpen Demonstration School, Burapha University, Chon Buri
Advisor : Dr. Piyanoot Jaihan, Science Classrooms in University-Affiliated School Project, Faculty of
Science, Burapha University, Chon Buri
Abstract :
Rotten roots and rotten fruit disease are the main causes of lost productivity in durian. Using chemical
substances to control and prevent mentioned diseases are causing various health issues to both agriculturist and
consumer. The aims of this study were to evaluate the antifungal efficacy of Bacillus spp. against P. palmivora
and L. theobromae isolated from durian disease using dual culture method. Samples of diseased roots and fruits
from 3 different breeds of durian which are Mhon-tong, Chani and Kradum at Sompoch farm, Trat province
were collected. Isolation in total of 8 isolates of P. palmivora and L. theobromae fungus which are the cause of
rotten roots and rotten fruit disease by using tissue transplanting technique. The 10 isolates of Bacillus spp.
were screened for antagonistic activity to inhibit the mycelial growth six isolates of P. palmivora and two
isolates of L. theobromae by the dual culture method. The results showed that a total of 10 isolates of Bacillus
spp. could inhibit the fungal mycelial growth of P. palmivora and L. theobromae in the range of 3.33-66.35%
and 5.81–55.27% respectively. Moreover, the results revealed that Bacillus subtilis isolate SF1-3 had the best
inhibitory effect on all the isolates of P. palmivora with 19.66-66.35% and L. theobromae with 52.17–55.27%.
Therefore, these results suggest that B. subtilis isolate SF1-3 is a potential candidate, with antagonistic activity,
for use as a source of antifungal agents to control rotten roots and rotten fruit disease in durian.
Keywords : Antagonistic activity, Biological control, Rotten roots and rotten fruit disease
Introduction

Durian is an important economical fruit by durian is considered as an important fruit that besides being
consumed in the country, it can also export makes a lot of income to the country each year. Nowadays, the
productivity of durian farmers are not fully yielded because of many factors that affect the yield to lower than

OB4_13_02

271

12th SCiUS Forum

expected, by the main factor is the threat of pests, and plant disease is one of the most damaging pests in the
cultivation process and harvesting agricultural products. Most of the problem that farmers encounter in durian
cultivation is the durian fruit tends to rot before harvesting about one month. The durian fruit rot was caused by
P.palmivora and L. theobromae (Thompson, 1934 ; Tsao, 1974) These fungus cause disease in various part of
durian such as roots, stems, branches, leaves and fruits (Zemtmyer, 1983) They can damage durian in every
stages of growth. Therefore, in this research, the idea was to test the efficacy and selected the useful Bacillus
spp. species for use as an antagonist against P. palmivora and L. theobromae that cause fruit rot disease in durian
under in vitro conditions to reduce the use of toxic chemicals. Lastly, to be the one of the methods for finding
effective microorganisms to control root rot and fruit rot effectively.
Methodology
1. Sample collections: Sampling of diseased roots and fruits from 3 breeds of durian including Mhon-tong,
Chani and Kradum each of which had five samples were collected at Sompoch farm, Trat province.
2. Isolation of plant pathogenic fungi: The samples that were collected from Sompoch farm then had
plant pathogenic fungi isolated by the tissue transplanting method. The infected durian fruits were washed with
sterile distilled water and sectioned into five pieces. The samples were cut 0.5 x0. 5 cm and surface sterilized
by dipping in 10% NaOCl for 2-5 min, after that the sample was rinsed several times with sterile distilled water
before being transferred onto the surface of a potato dextrose agar (PDA) plate. The plate was incubated at 28
°C for 7 days. The mycelium growing out of the plant pathogenic fungi tissue was sub-cultured on PDA meduim
and incubated at 28 °C and examine the fungus appearance under a microscope.
3. Isolation of P. palmivora and L. theobromae causal agent of rotten roots and rotten fruit disease in
durian: The plant pathogenic fungi P. palmivora and L. theobromae were isolated from infected durian fruits
with typical disease symptom using the tissue transplanting method as described in 2. The fungal was identified
based on spore morphological characteristics and then confirmed by carrying out pathogenicity tests in strict
conformity with Koch’s postulates.
4. Morphological characteristics of Bacillus spp.: Ten isolates of Bacillus spp. which was supported by Dr.
Piyanoot Jaihan Project, Burapha University, were streak cultured on NA agar. Then incubated at 37 °C for 16-
18 hours, then used for morphological studies.
5. In vitro antagonism assessment: The 10 isolates of Bacillus spp. were screened for antagonistic activity to
inhibit the mycelial growth 6 isolates of P. palmivora and 2 isolates of L. theobromae by the dual culture method.

OB4_13_02

272

12th SCiUS Forum

Ten isolates of Bacillus spp. were streaked at the distance of 2 cm from the edge of PDA, while a mycelium
plug of the plant pathogenic fungi was placed on the opposite side at 7 cm length. The dual culture plate was

incubated at 25-28 °C for 7 days, while P. palmivora and L. theobromae disc on PDA plates without bacteria

were maintained as controls. After 7 days, the dual culture plates were evaluated for antagonistic activity to

reduce pathogen colony expansion. The percentage of mycelial growth reduction was calculated using the

formula given below by Inhibition rate (%) = [(C- T)/ C×100] where, C is the radial diameter of the control

colony and T is the radial diameter of the test colony (Korsten et al., 1995).

6. Data analysis: The experiments were performed in triplicate and the results were expressed as mean ± S.D.

Analysis of variance (ANOVA) was carried out to determine any significant differences in measurements using

SPSS software. The significance of the differences between the means was determined using Duncan’s Multiple

Range Test (DMRT) and the differences were significant at p < 0.05.

Results

The result showed that the total of 10 isolates of Bacillus spp. could inhibit the fungal mycelial growth of

P. palmivora in the range of 3.33-66.35% as shown in Table1.

Table1 The percentage inhibition mycelial growth of P. palmivora of Bacillus spp.

Percentages of mycelial growth reduction (%) of P. palmivora

Bacillus spp. MT4 (3) MT1 (3) MT1 (4) MT2 (3) Sam1 (3) Sam3 (1)

B.cereus SB2-2 14.50±2.84h 0.00±0.00d 0.00±0.00c 0.00±0.00c 25.00±6.61b 0.00±0.00c

B.cereus SG2-2 17.69±1.58g 0.00±0.00d 0.00±0.00c 0.97±3.07c 3.33±3.82c 0.00±0.00c

B.cereus SB3-2 52.25±1.37b 13.68±3.92b 12.76±3.18b 22.19±1.54b 25.83±3.82b 12.54±2.92b

B.cereus SB1-2 19.96±2.09gf 0.00±0.00d 0.00±0.00c 1.86±5.31c 0.00±0.00c 0.00±0.00d

B.cereus SF3-2 22.24±2.37ef 0.00±0.00d 0.00±0.00c 0.00±0.00c 0.00±0.00c 6.71±0.00c

B.subtilis SF1-3 66.35±0.79a 19.66±3.92a 41.23±6.94a 32.80±4.05a 41.67±3.82a 34.89±4.45a

Bacillus sp.WB1 32.69±0.79d 3.42±1.48d 0.00±0.00c 0.00±0.00c 0.00±0.00c 0.00±0.00d

B.cereus L1-2 37.24±1.37c 8.55±5.34c 0.00±0.00c 0.00±0.00c 0.00±0.00c 0.00±0.00d

Bacillus sp.SJ1-4 6.78±0.79j 0.00±0.00d 0.00±0.00c 0.00±0.00c 0.00±0.00c 0.00±0.00d

B. flexusSS3-4 23.15±2.09e 0.00±0.00d 0.00±0.00c 0.00±0.00c 0.00±0.00c 0.00±0.00d

Values in the same column or row followed by the same letter are not significantly different according to analysis of variance and DMRT at P < 0.05.

The result showed that the total of 10 isolates of Bacillus spp. could inhibit the fungal mycelial growth of

L. theobromae in the range of 5.81–55.27% as shown in Table2.

OB4_13_02

273

12th SCiUS Forum

Table 2 The percentage inhibition mycelial growth of of L. theobromae Bacillus spp.

Percentages of mycelial growth reduction (%) of L. theobromae

Bacillus spp. MT5 (1) Kd5 (2)
B. cereus SB2-2
5.81±1.27f 0.00±0.00f

B. cereus SG2-2 6.55±2.55f 0.00±0.00f

B. cereus SB3-2 28.62±1.28b 46.19±3.20b

B. cereus SB1-2 8.75±1.28ef 0.00±0.00f

B. cereus SF3-2 12.44±1.28d 14.04±2.10c

B. subtilis SF1-3 52.17±1.28a 55.27±1.21a
Bacillus sp.WB1 27.15±2.21b 3.56±2.10e

B. cereus L1-2 16.85±1.28c 11.25±2.42d

Bacillus sp.SJ1-4 8.02±3.37ef 0.00±0.00f
B. flexusSS3-4 10.96±2.55ed 0.00±0.00f

Values in the same column or row followed by the same letter are not significantly different according to analysis of variance and DMRT at P < 0.05.

Conclusion

The results showed that a total of 10 isolates of Bacillus spp. could inhibit the fungal mycelial growth

of P. palmivora and L. theobromae in the range of 3.33-66.35% and 5.81–55.27% respectively. Moreover, the

results revealed that Bacillus subtilis isolate SF1-3 had the best inhibitory effect on all the isolates of

P. palmivora with 19.66-66.35% and L. theobromae with 52.17–55.27%.

Acknowledgements

This project was supported by Science Classroom in University Affiliated School (SCiUS). The funding

of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This extended

abstract is not for citation.

References

1 Thompson, A. 1934. A disease of durian tree. Malay. Agr. J.48:1-9.

2 Tsao, P.H. 1974. Phytophthora disease of durian, black pepper and citrus in Thailand. F.A.O. Report of United

Nation. Development Programme Project THA 6526. Food and Agriculture Organization of U.N., Bangkok,

Thailand. 25 p.

3 Zentmyer, G.A. 1983. The world of phytophthora. pp. 1-7. In D.C. Erwin, S. Bartnicki Garcia and P.H. Tsao

(eds.) 1983. Phytophthora :Its biology, taxonomy, ecology and pathology. The Amer. Phytopathol. Soc.,St

Paul, Minnesota.

OB4_13_02

274

12th SCiUS Forum

Title: Investigation of oligomeric states of OB4_06_04

Field: MurE as potential antibacterial targets
Authors: Biology and Biodiversity
School:
Advisor: Mr. Rujipat Permpornpipat, Mr. Tanit Yodsirawong, and Mr. Vachiravit Phitchuanchom

Ratchasima Wittayalai School, SCiUS-Suranaree University of Technology

Dr. Sakesit Chumnarnsilpa, Institute of Science, Suranaree University of Technology

Abstract:
Multidrug-resistant bacteria are one of the most serious problems to public health. This highlights the

importance of developing for eradicating antibiotic-resistant pathogens. Antibiotics commonly target bacterial
cell wall formation of which peptidoglycan is an important component. The peptidoglycan layer is important
for cell wall structural integrity, being the outermost and primary component of the wall. By disrupting the

synthesis of peptidoglycan the growing bacteria are unable to synthesize new cell wall, a crucial component
for bacterial survival. Because the Mur-complex is a group of enzymes playing important roles in the bacterial
cell wall synthesis, they are attractive targets for the development of new antibiotics. MurE. MurE (UDP-N-
acetylmuramoyl-L-alanyl-D-glutamate-2,6-diaminopimelate ligase), is one of the key enzymes in the Mur
complex. During the cytoplasmic step of peptidoglycan precursor synthesis, MurE from gram-negative bacteria
begins the reaction by adding meso-diaminopimelic acid to the nucleotide precursor, which is known as UDP-
N-acetylmuramoyl-L-alanyl-D-glutamate. The available inhibitor is unable to inhibit the enzyme in vivo which
is believed that result from the oligomerization of the enzyme. The goal of this study is to investigate the
solution structure of Escherichia coli (EcMurE). Here, we purified EcMurE by tandem chromatography (Ni-
NTA follow by Size Exclusion Chromatography, SEC) and monitored the structure by SAXS (Small Angle X-
ray Scattering), polyacrylamide gel electrophoresis (PAGE), and analytical-SEC. The results of analytical-SEC
together with SDS-PAGE indicated that EcMurE was not structural homogenous in solution. The multiple

protein bands of EcMurE in Native PAGE agreed with SEC analysis, proved that EcMurE displayed multiple
oligomeric structures in the solution. SAXS analysis confirmed that EcMurE displayed multiple oligomeric in
the absence of substrate. The results from this work provide a better understanding of the oligomeric structure
of MurE which is crucial for their functions and drug binding. Hence it can act as the potential antibacterial
target that will aid in the development of new antibiotic drugs and novel methods for the treatment of multidrug-
resistant bacteria.

Keywords: Mur complex, MurE, Small Angle X-ray Scattering (SAXS), Multidrug-resistant bacteria (MDR),
Protein conformations, and oligomeric states.

OB4_06_04/1

275

12th SCiUS Forum

Introduction:
There has been a big rise in multidrug-resistant (MDR) bacteria in the last century. This is one of the

most important clinical and biological events of the 20th century [1].
Cell division is a process that all organisms must go through. Mur enzymes (MurA-MurG) play a

cytoplasmic step of bacterial cell wall synthesis and control the synthesis of peptidoglycan precursors (murein).
These enzymes work together by combining two monosaccharides and five amino acids into the peptidoglycan
precursor. MurE (UDP-N-acetylmuramoyl-L-alanyl-D-glutamate-2,6-diaminopimelate ligase, EC: 6.3.2.13) from
gram negative bacteria adds meso-diaminopimelic acid to the nucleotide precursor UDP-N-acetylmuramoyl-L-
alanyl-D-glutamate. The number of evidence suggests that MurE oligomerization and conformational changes
are keys to the regulation of this enzyme. Therefore, the solution structures of MurE is important for the drug
design. Here we performed biochemical and biophysical experiments to investigate the solution structure of
the MurE of Escherichia coli.
Methodology:

The recombinant protein EcMurE, a 59 kDa protein was expressed in E. coli BL21 DE3 as an 8-
histidine tag at the N-terminal of the protein to facilitate the protein purification step purified. The recombinant
protein was purified by tandem chromatography, IMAC, and further purified by SEC.

PAGE analysis was used to investigate conformations and oligomeric states of EcMurE.After that
SAXS data from a solution of EcMurE proteins were collected at the Synchrotron Light Research Institute
(SLRI) in Nakhon Ratchasima, Thailand. The scattering data were processed and analyzed by the ATSAS
program [2]

276

12th SCiUS Forum

Results and Discussion:

III

II
V

I
IV

Figure.1 SEC analysis Figure.2 Polyacrylamide Gel Electrophoresis

The SEC experiment was conducted using a Superdex 200 10/300 column that had been equilibrated
with protein buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.5). The chromatogram revealed multiple peaks with
varying retention volumes and intensities, as illustrated in Figure 1.

The SEC chromatogram (Figure 1) and SDS-PAGE results (Figure 2) indicated that EcMurE may exist
in several conformations or multiple oligomeric states. Each peak of the SEC was concentrated separately and
subsequently analyzed by Native and SAXS.

The PAGE analysis showed that EcMurE of every peak displayed as a single band on SDS-PAGE
(Figure 2A) indicating that the protein was pure. The multiple bands of EcMurE in the Native-PAGE (Figure
2B) suggesting that EcMurE could present in multiple conformations or difference oligomeric states in
solution.

AB

Figure.3. Scattering pattern of Peak I-V from SEC(A) and Kratky plots of Peak I-V from SEC(B)
Table 1 Structural information of EcMurE from the SAXS data

SAXS experiments were used to investigate the solution structural of EcMurE in the absence of
substrate. The two concentrations of EcMurE (5 and 10 mg/ml) were used in the solution scattering. The

277

12th SCiUS Forum

scattering pattern of the substrate free EcMurE of peaks I-V revealed high-quality X-ray scattering data with
no aggregation (Figure 3A). Kratky plot showed that EcMurE exhibited a compact globular fold and flexibility
within all samples, as determined by the study (Figure 3B). SAXS alanysis showed the molecular weight of the
protein in each peakfrom 64–187 kDa, (Table 1). Additionally, we employed EcMurE SAXS data to generate
Ab initio models using the DAMMIF server. The superimposition of the MurE crystal structure with the
resultant averaged and filtered molecular envelope of EcMurE peak I-V is shown in Figure 4

Dmax = 199 Å Dmax = 140 Å Dmax = 171 Å Dmax = 144 Å

Dmax = 106 Å

Peak I Peak II Peak III Peak IV Peak V

Figure.4 EcMurE Ab initio model from difference peaks of SEC.

Conclusion:
This is the first report that provide the structure detail of EcMurE in solution. Our finding have proved

the existing of the multiple oligomeric states of EcMurE in the absence of substrate, in the experimental
solution (150 mM NaCl and 50 mM Tris-HCl, pH 7.5). This finding direct us to the next step, to explore the
mechanism of oligomerization that remains unknown.

Acknowledgments:
This project was supported by Science Classroom in University Affiliated School ( SCiUS) . The

funding of SCiUS under the Suranaree University of Technology and Rajsima Wittayalai School. The funding

of SCiUS provided by the Ministry of Higher Education, Science, Research and Innovation, Thailand is highly
appreciated. This extended abstract is not for citation. We would like to express our deep gratitude to Nongluk

Yutaekool, Center for Biomolecular Structure, Function, and Application, Suranaree University of
Technology, Nakhon Ratchasima, who was a trainer and supporter, and Dr. Nuntaporn Kamonsuttipaijit at
BL1.3W: SAXS/WAXS, Synchrotron Light Research Institute (SLRI), Nakhon Ratchasima, Thailand.

References:
1. Klemm, E.J., V.K. Wong, and G. Dougan, Emergence of dominant multidrug-resistant bacterial clades:

Lessons from history and whole- genome sequencing. Proceedings of the National Academy of
Sciences, 2018. 115(51): p. 12872.
2. Franke, D., et al., ATSAS 2.8: a comprehensive data analysis suite for small-angle scattering from
macromolecular solutions. J Appl Crystallogr, 2017. 50(Pt 4): p. 1212-1225.

OB4_06_04/4

278

12th SCiUS Forum

Title : Allele Frequency Distribution of Microsatellite OB4_01_06
Locus DXS6789 in Male Thais for Forensic Science
Field : Application
Author :
School : Biology and Biodiversity
Advisor :
Miss Yodsawimon Vongburinphan
Mr. Suphakarn Chaisuk

Chiang Mai University Demonstration School, Chiang Mai University

Asst. Prof. Dr. Padchanee Sangthong, Faculty of Science, Chiang Mai University
Mr. Kusol Raungprataungsuk, Chiang Mai University Demonstration School

Abstract

Microsatellite is a repetitive DNA marker which is used for determine genetic differences in
population. It can be used in forensic science such as human identification, paternity testing and
detecting criminals who leave only traces of biological evidences as such as blood, semen, hair, nail,
bone and teeth. Some complicated cases such as the relationship between female siblings of the
same father when the father is not available for testing or grandmother-granddaughter relationship
testing, only the X-chromosome microsatellites are required for identification. Therefore, the aims of
the study is to investigate the allele frequencies of the DXS6789 locus which highly variable in
Thai population. Genomic DNA from buccal swab was extracted using GeneJET Genomic DNA
purification kit, and was determined by 1.2% agarose gel electrophoresis. As the result, the genomic DNA
band size about 20 kb was observed the genomic DNAs were used as DNA templates for Polymerase
Chain Reaction (PCR) technique and the PCR products were determine by 1.5% agarose gel
electrophoresis. PCR products of DXS6789 were approximately 300 bp in size without non-specific
band and high yield PCR products at optimal annealing temperature at 60.9 °C were found. Then,
the PCR products were extracted and purified using the NucleoSpin Gel and PCR Clean-up kit and
determined by 1.5% agarose gel electrophoresis. After that the purified PCR products of DXS6789
were sequenced to characterize the alleles according to international standards by Sanger
sequencing method. The results revealed that the DXS6789 locus in Thai male population. Contained
polymorphic region of two tetranucleotide repeat motifs, namely TATG and TATC. The pattern of TATG and
TATC repetitions were found 12 repetitions, namely TATG8-TATC6, TATG9-TATC6, TATG8-TATC7,
TATG10-TATC6, TATG9-TATC7, TATG11-TATC6, TATG10-TATC9 and TATG10-TATC10.

Keywords : DXS6789, X-chromosome Microsatellite, Short tandem repeat, Polymerase
Chain Reaction (PCR)

OB4_01_06/1
279

12th SCiUS Forum

Introduction
Population genetics is the study of genetic characteristics in a population that involves the

investigation of gene frequency, or allele frequency, based on genetic markers. Each genetic marker holds the
differences and characteristic in each individual. Therefore, the genetic markers are used in human
identification in forensic science work. Verification of parental or kinship relationships in some complex cases,
such as uncle-niece, grandmother-niece verification when the father cannot participate in the examination. In
these cases, only the microsatellite DNA or female or chromosome are tested and the interpretation of the
DNA results are based on the genetic statistics of Allele co-existing in the examinee, which sometimes does
not contain the genetic material for reference.

Now adays, the investigation of repetitive patterns and the allele frequency of microsatellite DNA on
the chromosomes at the DXS6789 lows are performed in many populations. It was revealed that DXS6789
locus contained highly genetic diversity reported including the pattern of microsatellite DNA and genetic
parameters in Thai population. However, the DXS6789 locus has no. Therefore, this study aims to determine
the genetic information and genetic information and genetic parameters on DXS6789 in Thai population.

Methodology
The experiments were divided into 2 parts as follows,

Figure 1 Summary of research methodology in this work
Part 1: Prepare sample

Buccal samples were collected by swabbing from healthy Thai male population, age between 18-60
years. Then pre-lyse sample were taken by adding 180 μL Buffer T1 and 25 μL Proteinase K into each sample.
and spun briefly for 20 s at 1500 x g in order to submerge the swab material completely. Then the samples
were incubated at room temperature for 5 min and vortex the tube vigorously for 15 s and spun briefly for
20 s at 1500 x g. The samples were incubate at 70˚C in an incubator for 30 min and increased the temperature
to 95 ˚C for 5 min. Then, Spin briefly for 20 s at 1500 x g to collect any sample from the lids. Then, lyse
samples were vortexed vigorously for 15 s and added 200 μL Buffer B3, then mixed for 15 s, by vortexing

OB4_01_06/2

280

12th SCiUS Forum

The tubes were at 70˚C for 20 min and vortex the tube vigorously for 15 s. For adjust DNA binding conditions,
was added 210 μL 96-100% ethanal to each sample and mixed by vortexing. Then bind DNA, 600 μL of the
samples were transferred into NucleoSpin® Tissue Columns add centrifuged at 11,000 x g for 1 min. Then
wash and dry silica membrance, add 500 μL BW Buffer and centrifuge at 11,000 x g for 1 min. 600 μL B5

Buffer was added and centrifuged at 11,000 x g for 1 min for 2 times. Then elute highly pure DNA, move
Column to microcentrifuge and add 35 μL BE Buffer. The samples were incubated at room temperature for

1 min and centrifuged at 11,000 x g for 1 min and 35 μL BE Buffer was added. The samples were incubate at
room temperature for 1 min and centrifuged at 11,000 x g for 1 min. The DNA samples were used as DNA
templates in PCR by using Phusion Flash Hight-Fidelity PCR Master Mix. The annealing temperature for PCR
gradient was Tm ±5. In this reach, the annealing temperature was 60.9˚C. PCR products were determined by
1.5% agarose gel electrophoresis. Finally, the PCR product from gel were cut out to purify by NucleoSpin Gel
and PCR Clean-up kit and was determined the quality by 1.5% agarose gel electrophoresis.

Part 2: Allele Frequency Distribution of Microsatellite Locus DXS6789

Purified DXS6789 PCR products from Thai Males were analysed of the nucleotide sequence by the
Big Dye terminater method. The DXS6789 nucleotide sequences were analyzed in Bioedit to determine the
repeatation of STR in the samples. After obtaining the nucleotide sequence information, microsatellite and
repeated pattern were investigated. Subsequently, the allele frequency is calculated as follow:

( ) = /

f (A) = allele frequency in population N

D = Sample detected allele

N = Population

Result

Table 1: Allele frequency distribution of microsatellite Locus DXS6789

Allele Repeated Sequence Frequency of alleles Allele detected
14 TATG8-TATC6 0.077 1
15 TATG9-TATC6 0.308 4
TATG8-TATC7 0.077 1
16 TATG10-TATC6 0.230 3
TATG9-TATC7 0.077 1
17 TATG11-TATC6 0.077 1
18
19 TATG10-TATC9 0.077 1
20 TATG10-TATC10 0.077 1
total 13
1

From the experiments to calculate the allele frequency, it was found that TATG9-TATC6 was the most
observed at 0.308, followed by TATG10-TATC6 with a frequency of 0.230, and Allele TATG8-TATC6, TATG8-
-TATC7, TATG9-TATC7, TATG11-TATC6, TATG10-TATC9, TATG10-TATC10 has the lowest frequency
0.077.

OB4_01_06/3
281

12th SCiUS Forum

Conclusion
The microsatellite of DXS6789 locus on the X chromosome was observed as TAGAX-TACAY

repetition. The highest allele frequency is TATG9-TATC6 with a frequency of 0.308 and the lowest frequency
is TATG8-TATC6, TATG8-TATC7, TATG9-TATC7, TATG11-TATC6, TATG10-TATC9, TATG10-TATC10 with
frequency 0.077 respectively, This genetic information from this finding can be applied for human
identification in forensic science

According to previously report, the genetic population the X chromosome short tandem repeat loci
DXS10011, DXS101, DXS6789, DXS7132, DXS8377, and DXS9895 in 447Taiwanese from Meng-yi
Chen,2004. It was showed that the microsatellite locus DXS6789 in X chromosome had the most allele
frequency on 16 allele with 36.4% and 15 allele with 16.8% at the population. On the other hand, A. Nagai’s
research determined the polymorphisms at the DXS6789, DXS8377 and DXS101loci in three Asian
populations. It was showed that the allele from 130 Japanese people and 89 Indonesian people had the most
allele frequency was on the 16 allele TATG10-TATC6 format the second was 15 allele TATG9-TATC6.
Interestingly, the repetitive of DXS6789 locus in Thai, Japanese, Indonesian were similar. In the future work,
increasing in number of thai samples may gain more genetic information to represent for Thai population.
Acknowledgements

This project was supported by Science Classroom in University Affiliated School (SCiUS) under
Chiang Mai University and Chiang Mai University Demonstration School. The funding of SCiUS is provided
by Ministry of Higher Education, Science, Research and Innovation, which is highly appreciated. This
extended abstract is not for citation.

References

Meng-Yi Chen, Chang-En Pu(2004); Scientific and Technical Research Center, Ministry Justice
Investigation Bureau. Population data on the X chromosome short tandem repeat loci DXS10011, DXS101,

DXS6789, DXS7132, DXS8377, and DXS9895 in Taiwan. Forensic Science International 146 2004:65-7.
A.Nagai, M.Hara, A.Kido, A.Takada, K.Saito, Y.Bunai(2009);Sequence polymorphisms at the DXS6789,
DXS8377 and DXS101 loci in three Asian populations. Forensic Science International: Genetise Supplement
Series
ส ม ชั ย จั น ท ร์ ส ว่ า ง , พี ร ะ ศั ก ด์ิ ศ รี นิ เ ว ศ น์ (2003); Population genetics;Composite populations;Genetic
correlation;Quantitative genetics;Plant breeding;Heritability;Animal breeding;Breeding methods

OB4_01_06/4

282

12th SCiUS Forum

Title : Antiviral activity and cytotoxicity of betanin extract OB4_05_02

Field : from red beets
Authors :
School : Biology and Biodiversity
Advisor :
Panitnan Kerdsuktrakool, Wachiraya Phutthamart

Demonstration School of Khon Kaen University, Khon Kaen University

Lect.Dr. Chonlatip Pipattanaboon

Department of microbiology, Faculty of Medicine, Khon Kaen University

Abstract
Betanin is the most common betacyanin pigment in red beets, Beta vulgaris. There are some reports of

betanin that can exhibit antimicrobial, anti-inflammatory, and antioxidant activities. However, antiviral activities
of betanins are still limited. In this study, we focused on dengue virus serotype 2 (DENV-2) due to the reasons that
it can cause the most important mosquito-borne diseases (dengue fever, dengue hemorrhagic fever, dengue shock
syndrome) in Thailand. An approved dengue vaccine was less effective against this serotype and no specific drug
for treatment of dengue infection. Therefore, we aim to determine the antiviral activity of betanin against
DENV-2 by using focus forming assay in vero cells. Our results showed that betanin could inhibit DENV-2 in
vero and has no significant cytotoxic effects in vero cells. The cytotoxic effects of betanin were evaluated using
MTT assay with a half-maximum cytotoxic concentration (CC50) of 27.50±1.48 mg/ml. All betanin concentrations
(0.039 - 5 mg/ml) showed more than 80% cell viability. Betanin exerted virucidal effects against extracellular
DENV-2 and inhibited intracellular DENV-2 progeny at the half-maximum inhibitory concentrations (IC50) of
3.59±0.25 and 0.56±0.15 mg/ml, respectively. Betanin achieved 65.38 % of virus reduction and 77.78 % of virus
progeny inhibition at the maximum concentration of 5 mg/ml. Taken together, our findings demonstrated that
betanin exhibited potential anti-DENV-2 activity and low toxicity to normal cells and might be beneficial for
further antiviral agent development.

Keywords : Betanin, Red beets, Cytotoxicity, Anti-viral, Dengue virus

Introduction
Dengue virus consists of four serotypes (DENV-1, DENV-2, DENV-3, and DENV-4) that can be

spreaded by Aedes mosquitoes. It can cause mild dengue fever to severe dengue hemorrhagic fever or dengue
shock syndrome, which are the major mosquito-borne diseases and public health problems in more than 100
tropical and subtropical countries including Thailand. The most lethal serotype than others was DENV-2 and
a currently approved dengue vaccine showed less effectiveness against this serotype (1, 2). Antiviral agents and
therapeutic antibodies still need to be developed to rescue and control dengue infection (3). In the context of
extract, betalains are water-soluble pigments in various plants and mushrooms. Betalain pigments can be classified
into two groups of betacyanins (red to purple) and betaxanthins (yellow to orange). Betacyanin can be found in
pitahaya, red spinach, red beet and other red plants. Betanin is the most common betacyanin pigment in red beets,

OB4_05_02/1
283

12th SCiUS Forum

Beta vulgaris. Red beets are common in all regions, generally sold in the market, and a popular choice for
consumption. There is a report of betacyanins from red pitahaya and red spinach that can inhibit DENV-2 (4, 5);
however, there is no report of betanin against any human pathogenic viruses. Betanin exhibits other medicinal
applications such as anti-inflammatory, antioxidant, and antimicrobial activities (5); thus, the study is focused on
the antiviral activity of betanin from red beet.

The aim of this study is to determine the antiviral activity of betanin against DENV-2 in vero cells. Firstly,
we evaluated the cytotoxic effects of betanin on vero cells by using MTT assay to determine the CC50 value. Then,
we examined virucidal activities (disruption of viral particles) and inhibition activities (inhibition of viral
progeny) by using focus forming assay to investigate the IC50 values. Our findings demonstrated both antiviral
activities and cytotoxic effects of betanin that might be useful for being information for further development of
antiviral agents or antiviral supplements.

Materials and methods
DENV-2, vero cell, and betanin

DENV-2 (New Guinea C strain) was propagated in C6/36 cells at 28 °C and DENV-2 stock was kept at
- 80 °C. Vero cells were cultured in DMEM (Gibco, USA) medium supplemented with 10% FBS, at 37 °C, 5%
CO2 for further experiments. Betanin was purchased from Sigma-Aldrich (St. Louis,USA; catalog number
MKCN1856). It was freshly dissolved in sterile distilled water to yield 10 mg/mL stock and further diluted in
serum free-DMEM to prepare the working stocks (2 fold-dilutions; 0.039 - 5 mg/ml for MTT assay, 0.078 - 5
mg/ml for virucidal assay, 0.156 - 5 mg/ml for inhibition assay).
MTT assay

Briefly, vero cells were seeded into a 96-well plate with a concentration of 1x105 cells/well one day before
treated with different concentrations of betanin in triplicates with DMEM containing 2% FBS. After 24 h, 20 μl
of 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (AppliChem GmbH, Germany) in PBS was
added to each well. After 1 h of incubation at 37 °C, the cells were agitated, and the absorbance was measured at
570 nm in a microplate reader (Thermo Scientific, USA). The percentage of cell viability of each concentration
was plotted and CC50 value was calculated by non-linear regression using GraphPadPrism9.
Antiviral assays

For virucidal assay, DENV-2 (100 ffu) was treated with working solutions of betanin (0.078-5 mg/ml) at
37 °C for 1 h, then added into vero cells (2x105 cells/well) in triplicates at 37 °C for 2 h. Inoculums were removed
and overlaid with 2% CMC-DMEM medium (2% CMC, 2%FBS) at 37 °C, 5% CO2 for 3 days. For inhibition
assay, vero cells (2x105 cells/well) were infected with DENV-2 (100 ffu) at 37 °C for 1 h. Inoculums were
removed, washed one time with PBS, and treated with 0.156-5 mg/ml of betanin in 2% FBS-DMEM in triplicates
at 37 °C, 5% CO2 for 2 days. After treatment by each assay, infected foci were determined and visualized
by immunostaining of 4G2 antibody and anti-mouse ALEXA-488 (Abcam, United Kingdom) using fluorescent
microscopy (Nikon, Japan), then calculated as the percentage of foci reduction. The IC50 values of betanin were
calculated by non-linear regression using prism software (GraphPadPrism9, USA).

OB4_05_02/2

284

12th SCiUS Forum

Results
MTT assay was used to determine the cytotoxic effects of betanins in vero cells by treating normal vero

cells with serially-diluted betanins (0.039 - 5 mg/ml) for 24 h. Cell viability of each concentration was plotted in
figure 1. The CC50 value was calculated as 27.50±1.48 mg/ml. At 0.039 - 5 mg/ml, betanin showed more than 80%
cell viability (Figure 1). All concentrations can be used in antiviral assays.

Virucidal assay was performed to determine the direct inhibition effects of betanins against extracellular
virions. DENV-2 was treated with betanins (0.078 - 5 mg/ml) at 37 °C for 2 h, and then determined DENV-2 foci.
We found that betanin could exhibit dose-dependent virucidal activities against DENV-2 with the IC50 value at
3.59±0.25 mg/ml (Figure 2).

Inhibition assay was performed to further determine the inhibition effects of betanins against intracellular
viral progeny. Vero cells were infected with DENV-2, followed by treatment of betanins, and evaluated DENV-2
progeny. We found that betanin could exert dose-dependent inhibition activities against DENV-2 progeny with
the IC50 value at 0.56±0.15 mg/ml (Figure 3).

Figure 1. Cytotoxic effects of Figure 2 Virucidal activities of Figure 3 Inhibition activities of
betanin in vero cells. betanin against DENV-2. betanin against DENV-2.

Disscussion
Dengue infection has grown dramatically and become a significant problem in more than 100 tropical

and subtropical countries. Still, there is no effective antiviral drug existing for DENVs. Thus, it is extremely crucial
to identify potential antiviral drugs for dengue virus infection. Betanin is one of the betacyanin pigments that can
be found in red pitahaya, red spinach, red beet, and other red plants (4). Raw beetroots normally contain 87.1% of
water, 7.6% of carbohydrate, 1.7% of protein, 0.1% of fat and 0.3 - 0.6% of betanin (6). Recently, there are some
reports of betacyanins from red pitahaya and red spinach having antiviral effects against DENV-2 with low toxicity
(4). However, antiviral activities of betanin from red beet has not been explored against any dengue virus serotype.
Thus, our study would like to demonstrate 1) antiviral activities of betanin from red beet against DENV-2 and
progeny, as well as 2) cytotoxic effect of betanin from red beet on vero cells. According to antiviral assays, betanin
from red beet represented virucidal effect against extracellular DENV-2 at the maximum concentration (5 mg/ml)
as 65.38% (IC50 value = 3.59 mg/ml, incubation time 1 h), which is less effective than inhibition effect against
intracellular DENV-2 progeny with the reduction rate of 77.78% (IC50 value = 0.56 mg/ml; incubation time 2
days). Our findings revealed that IC50 values of betanins from red beet against DENV-2 and DENV-2 progeny

OB4_05_02/3
285

12th SCiUS Forum

showed less potential antiviral activities than previous studies. The IC50 values of betacyanins from other red plants
demonstrated at the level of 106.80 - 126.70 μg/ml for virucidal effects and 14.62 - 125.80 μg/ml for inhibition
effects (4). In addition, compared to other compounds, silymarin and baicalein showed higher virucidal effects and
inhibition effects against DENV-3 at the level of 12.70 - 68.94 μg/ml and 34.66 μg/ml, respectively (3). This may
be due to the different mechanisms of extracts to inhibit viruses, the exposed time of extracts and viruses, or the
difference of extract sources. More in vitro studies for proving molecular mechanisms and effects against other
serotypes, in silico predictions for target binding, as well as in vivo tests need to be concerned. In terms of cytotoxic
effects, betanin was determined CC50 at 27.50 mg/ml and illustrated more than 80% cell viability in all
concentrations, which is non-cytotoxic to vero cells even at very high concentration. Based on cytotoxicity of other
compounds including betacyanins, silymarin, and baicalein, they showed CC50 values at 12.70 μg/ml - 4.38 mg/ml
referred to risks of occurring cytotoxic effects more than betanins (3, 4). In conclusion, our study is the first report
of antiviral activities of betanins against DENV-2. We suggested that betanin could reduce extracellular DENV-2
and intracellular DENV-2 progeny with very low cytotoxicity. Our findings might support future research of
antiviral agents and supplements.

Acknowledgement
This project was supported by Science Classroom in University Affiliated School (SCiUS). The funding

of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. Sincere appreciation is
expressed to Lect.Dr. Chonlatip Pipattanaboon and Mr. Boonpob Nowichai for their supporting and suggestion in
all experiments. This extended abstract is not for citation.

Reference
1. Abd Kadir SL, Yaakob H, Mohamed Zulkifli R. Potential anti-dengue medicinal plants: a review. J Nat Med.

2013;67(4):677-89.
2. Sabchareon A, Wallace D, Sirivichayakul C, Limkittikul K, Chanthavanich P, Suvannadabba S, et al. Protective

efficacy of the recombinant, live-attenuated, CYD tetravalent dengue vaccine in Thai schoolchildren: a
randomised, controlled phase 2b trial. Lancet. 2012;380(9853):1559-67.
3. Low JG, Ooi EE, Vasudevan SG. Current Status of Dengue Therapeutics Research and Development. J Infect
Dis. 2017;215(suppl_2):102-96.
4. Chang YJ, Pong LY, Hassan SS, Choo WS. Antiviral activity of betacyanins from red pitahaya (Hylocereus
polyrhizus) and red spinach (Amaranthus dubius) against dengue virus type 2 (GenBank accession no.
MH488959). Access Microbiol. 2019;2(1):73.
5. Devadiga D and Ahipa TN. Betanin: A Red-Violet Pigment - Chemistry and Applications. Chemistry and
Technology of Natural and Synthetic Dyes and Pigments. 2020;1(1):246-227.
6. Sivakumar V, Anna JL, Vijayeeswarri J, Swaminathan G. Ultrasound assisted enhancement in natural dye
extraction from beetroot for industrial applications and natural dyeing of leather. Ultrason Sonochem.
2009;16(6):782-9.

OB4_05_02/4

286

Title : 12th SCiUS Forum
Field :
Author : Project IDAntimicrobial and antibiofilm effects of mangosteen peel extracts
School :
Advisor : Biology
Ms.Pisada Chaisuwaseth and Mr. Phojchara Kotisin
PSU.Wittayanusorn School, Prince of Songkla University
Asst. Prof. Dr.Wipawadee Sianglum, Ms.Apinya Boonkhum and
Mr.Surawut saengmanee

Abstract

The project on Antimicrobial and antibiofilm effects of mangosteen peel extracts developed due to the
current medical practice of biofilm formation on medical devices and replacement organs of pathogenic
bacteria. The researcher therefore saw the benefits of mangosteen peels as agricultural waste. Because there is
research that mangosteen peel can inhibit some pathogenic bacteria. Therefore, the researcher used mangosteen
peel extract to inhibit pathogenic bacteria. Pseudomonas aeruginosa, Escherichia coli representing Gram-
negative bacteria and Staphylococcus aureus as representative of Gram-positive bacteria were selected by disc
diffusion method and the lowest inhibitory concentration of mangosteen peel extract was obtained by broth
microdilution. method and finally to test the ability to inhibit biofilm. which extracts from mangosteen peel can
inhibit only the infection Staphylococcus aureus and slightly inhibited the biofilms of Pseudomonas aeruginosa,
Escherichia coli and Staphylococcus aureus.

Keyword : Antimicrobial, Antibiofilm, Mangosteen peel extracts

Introduction :

Biofilm have a lot of disadvantages such as forming in waste drainpipe until it gets clogged and forming in oral
cavity make bad oral health. But the worse is when biofilm forming on medical equipment or artificial organ
this make more deterioration to the patients and can lead to death. That made we pay attention about inhibit
biofilm. We focused to Mangosteen extract that have anti-bacteria property which is our local agricultural plant.
We tested our extract with gram positive bacteria, S. aureus and gram negative bacteria, E. coli, P. aeruginosa
and their Biofilm.

Methodology :
Petri dish
Disc paper
Forceps
Micropipette
Distilled water
Ethanol
Microcentrifuge tube
Cotton swap
BHI Broth

For internal use in the 12th SCiUS Forum only Not for citation.
287

12th SCiUS Forum

Mueller Hinton Agar
Nutrient Agar
Crystal violet
PBS (Buffer)
Incubator
96 well plate

Method

1. Preparation of bacteria

Streak plate of S. aureus E. coli P. aeruginosa
and selected 2 colony into MHB and Incubated medium at 37°C and OD was measured at a wavelength of 600
nm to obtain 0.5 McF (1.5 CFU/ml).

2. Disk diffusion
The streak plate was performed. The next step was to prepare the disc 100% of ME, 50% of ME and 25% of ME
(diluted with ethanol). Positive control was streptomycin and negative control was 50% ethanol. and 75% Place
disc paper on a plate and incubate at 37 °C 6h. Do the same for all three bacteria.

3. Broth dilute method

Find MIC two - fold serial dilution of ME then added 100 µl of 10^6 CFU/ml and incubated at 37 °C 16-18h

Find MBC Selected the MIC value dropped in MHA

4. Antibiofilm

Inoculate in broth of S. aureus and P. aeruginosa then two - fold serial dilution of ME and streptomycin, add 100
µL in all wells except negative control and incubate at 37°C for 24 h, then wash. With PBS 2 times, wait for it
to dry.

then stained with crystal violet (0.1%), rinsed with PBS twice and waited to dry, suspended with Acetone :
Ethanol (20:80 w/w).

Finally, it was measured absorbance 570nm.

Result :

1. Disk diffusion

Streptomycin on P. aeruginosa 20 mm average orbital, E. coli 25 mm average orbital and S. aureus 19.67 mm
average orbital, 100% ME 9mm average orbital, 50% ME, 7.67mm average orbital. 25% ME 8.67mm average
orbital. Mangosteen peel extract on P. aeruginosa, E. coli and Negative control were not formed.

2. Broth dilute method

The minimal inhibitory concentration (MIC) of E. coli was 6.25%, and P. aeruginosa and S. aureus were
inhibited at low concentrations. The highest concentration was 3.12% and the minimum bactericidal
concentration (MBC) was >25% of the mangosteen peel extract.

For internal use in the 12th SCiUS Forum only Not for citation.
288

12th SCiUS Forum

3. Antibiofilm
Biofilm-inhibiting activity of mangosteen peel extracts at concentrations of 4MIC, 2MIC, MIC, 1/2MIC,
1/4MIC, 1/8MIC and 1/16MIC was effective in inhibiting biofilm formation. Of the two pathogenic strains, S.
aureus, P. aeruginosa, the concentration of mangosteen peel extract was effective in inhibiting biofilm against S.
aureus was 67.05, 55.88, 41.05, 24.41, 14.73, 17.97, 11.53 percent, respectively. The extracts from mangosteen
peel were 62.19, 35.07 percent in inhibiting biofilm of P. aeruginosa at 4MIC and 2MIC concentrations,
respectively.
Compared with the biofilm inhibitory activity of colistin at concentrations 4MIC, 2MIC, MIC, 1/2MIC, it was
found to be effective in inhibiting biofilm formation. of pathogenic strains of P. aeruginosa were 89.75, 89.65,
88.94, 59.75 percent, respectively.

Acknowledgement
This project was supported by Science Classroom in University Affiliated School (SCiUS). The funding of
SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This extended abstract
is not for citation.

References
- file:///C:/Users/Lenovo/Downloads/ranapornp,+Journal+manager,+2.6459- 6471.pdf
- ภาควชิ าจุลชีววิทยา คณะวิทยาศาสตร์ มหาวิทยาลยั เทคโนโลยีพระจอมเกลา้ ธนบุรี.//(2012).//ฤทธ์ิยบั ย้งั แบคทีเรียของสารสกดั จากเปลือกผลไมบ้ าง
ชนิด.//สืบคน้ เม่อื 20 สิงหาคม 2564,/ จาก/http://www.resjournal.kku.ac.th/abstract/17_6_880.pdf
- National Drug Information.//ม.ป.ป.//มงั คุด.//สืนคน้ เมือ่ 20 กนั ยายน 2564,/ จาก/
http://ndi.fda.moph.go.th/uploads/evidance_file/20190719182026.pdf
- สายวชิ าวิทยาศาสตร์ คณะศลิ ปศาสตร์ และวิทยาศาสตร์ มหาวิทยาลยั เกษตรศาสตร์//(2550).//การแยกสารสกดั จากเปลอื กมงั คดุ เพอ่ื ใช้ในการยบั ยงั เช้ือ
Propionibacterium acnes.//สืบคน้ เม่อื 20 กนั ยายน 2564,/ จาก/
http://www.lib.kps.ku.ac.th/SpecialProject/General_Science/2550/Bs/SomnuekUa/SomnuekUaAll.pdf
- เทคนิคการแยกเช้ือให้บริสุทธ์ิ
http://oservice.skru.ac.th/ebookft/295/chapter5.pdf?fbclid=IwAR1WNeY4yq4dw1R61FNWe2FbYsmh
eE6KAlchZX9kA-8ypX0-GK84WLlzrY4

For internal use in the 12th SCiUS Forum only Not for citation.
289

12th SCiUS Forum

Title : Isolation of Soil Bacteria Capable of Degrading Cellulose OB4_18_04
Field :
Author : Biology and Biodiversity

School : Natthakit Thamasoparat
Advisor :
Poneak Pornjirachat
Supapich Phannon
Surawiwat School, Suranaree University of Technology
Asst. Prof. Dr. Nawarat Nantapong

School of Preclinical Sciences, Institute of Science, Suranaree University of Technology

Abstract : Nowadays, there are many agricultural wastes. The purpose of this research is cultivate methods

finding bacteria that can degrade cellulose by taking the soil in the agricultural area to isolate on the
carboxymethyl cellulose(CMC). Then cultivate the efficiency of cellulose degrading which can look at the clear
zones from iodine staining. According to the result, the most cellulose-degrading bacteria from tree root soil
and bamboo soil, 12 isolates per area. From the soil around the roots of B05 trees, the largest clear zone,
meanwhile, was 2.88 cm. Thus, the isolated cellulose-degrading bacteria could be identified for study more and
can be used to decompose agricultural waste.

Keywords : Agricultural waste, Cellulose-degrading bacteria, Iodine staining

Introduction

Nowadays, there are more than 9 million Thai farmers which accounted for 24% of labor in Thailand.
From this reason causes a large amount of agricultural waste. For instance, part of corn including stem, leaf and
cob have weighed about 9.31 million tons per year but only 0.46 tons per year have used. The rest 8.85 tons
turn to be agricultural waste. This factor affects to farmer that they have to find ways to destroy the waste.
According to the research, 45% of farmers have behavior in burning agricultural wastes which cause much
pollution such as carbon monoxide 1.67 million tons, nitrogen oxide 40,000 tons, dust smaller than 2.5 microns,
3.5 hundred thousand tons, dust smaller than 10 microns, 1.2 hundred thousand tons and carbon ash 10,000
tons. These cause the global warming problem including greenhouse effect, PM 2.5.

Lignocellulose material is an organic obtained from agricultural waste. These materials include
cellulose, hemicellulose and lignin. These materials can be degraded by cellulose-degrading microorganisms
which consist 3 groups of microorganisms including bacteria, fungi and actinomycetes. The microbes will
release cellulase enzymes outside the cell to decompose plant components. Bacteria are capable of degrading

OB4_18_04/1

290

12th SCiUS Forum

most cellulose compounds. Due to the diversity of bacterial species and their rapid growth under aerobic
conditions, such as Cellulomonas sp., Bacillus sp., Pseudomonas sp., Clostridium sp., Tricoderma sp., and
Streptomyces sp. These cellulose-degrading bacteria can be found in a variety of environments including living
things, organic waste and general soil. For instance, isolation cellulose-degrading bacteria from mangrove soil
of Mahanadi river delta, India, found bacteria including Micrococcus sp. , Bacillus sp. , Pseudomonas sp. ,
Xanthomonas sp., and Brucella sp.

From the efficacy to decompose various organic waste materials in the nature of these
microorganisms. It can be seen that microorganisms which produce cellulase enzymes can decrease agricultural
waste. Therefore, the objective of this research is to isolate bacteria from soil samples which have capable of
degrading cellulose.

Methodology
The experiments were divided into 2 parts as follows,

Part 1 : Isolation and Screening of bacteria

Bacteria were isolated from agricultural areas’ soils such as plot (A), tree root (B), and bamboo soil (C).
The process, 1 g of the sample was used and placed in a test tube with 10 ml of distilled water. Serial dilutioned
in the range of 10-1 – 10-6. Spread plate method was performed on suitable plate containing carboxymethyl
cellulose (CMC) agar, a specific culture medium for the separation of cellulose-degrading bacteria, containing
(g/ L) KH2PO4 1, MgSO4.7H2O 0.5, FeSO4.7H2O 0.01, NaCl 0.5, MnSO4.H2O 0.01, NH4NO3 0.3, CMC 10.0, and
agar 12. Plates were incubated at 37 °C for 3-5 days. Finally the different colonies were selected to make further
experiments.

Part 2 : Iodine Staining

Clear zones were visualized by flooding plates with KI/I2 solution (KI 1.0%, I2 0.5%) for 1-2 min
followed by a distilled water rinse. Plates were examined immediately in diffuse light as the iodine colouring
fades in 2-4 min indirect light.

Result
Sample were isolated from soils in Suranaree University of Technology area such as plot (A), tree root

(B), and bamboo soil (C). The results of experiment can identify bacteria 36 isolates. Continue with the
experiment by staining with iodine solution.

OB4_18_04/2

291

12th SCiUS Forum

Bacteria from agricultural plot's soil (A) had 19 isolates having clear
zone and hadn’t clear zone found 17 isolates. The diameter of the biggest
cleared zone is in sample A09. The averaged size of A09 is 1.90 centimeters.

Figure 1 : Sample from agricultural plot's soil (A)

Bacteria from tree root’s soil (B) had 32 isolates having clear zone
and hadn’t clear zone found 4 isolates. The diameter of the biggest cleared
zone is in sample B05. The averaged size is 2.88 centimeters.

Figure 2 : Sample from tree root’s soil (B)

Bacteria from bamboo soil (C) had 36 isolates having clear zone.
The diameter of the biggest cleared zone C06. The averaged size is 2.25
centimeters.

Figure 3 : Sample from bamboo soil (C)

Conclusion

From 36 isolates of bacteria samples were cultured on petri dishes containing carboxymethyl cellulose
(CMC) and staining with iodine solution. The researcher divided the samples into 3 groups including soil in
agricultural plot, soil around tree roots, and bamboo soil. According to efficacy of cellulase from different soils
in the area of Suranaree University of Technology found cellulose-degrading bacteria from agricultural plot
soil 6 isolates, 12 isolates from tree roots and bamboo soil. The ability to degrade cellulose from the resulting
clear zone diameter found that bacteria from the soil around the roots (B05) having the largest clear zone
averaged 2.88 cm, was formed. Therefore, cellulose-degrading bacteria which were isolated can be identified

species for further study and can be used as Guidelines for using to decompose agricultural waste

Acknowledgements

This project was supported by Science Classroom in University Affiliated School (SCiUS) under
Suranaree University of Technology and Rajsima Wittayalai School. The funding of SCiUS is provided by
Ministry of Higher Education, Science, Research and Innovation, which is highly appreciated. This extended
abstract is not for citation.

OB4_18_04/3

292

12th SCiUS Forum

References
1. Yodying, P.; Thongdonnoi, S.; Chungopast. S., Isolation of cellulose-degrading bacteria and effective of
corncob and water hyacinth decomposition using as substrates. Khon Kaen Agricultural Journal, 2019, 47, 177-
186.
2. Thanasrirangkul, C.; Pinjai, P,; Vaithanomsat, P., Screening of cellulase producing bacteria and efficiency of
lignocellulosic decomposition. King Mongkut’s Agricultural Journal, 2018, 36, 1-12.
3. Gohel, H., R.; Contractor, C., N.; Ghosh, S., K.; Braganza, V., J., A comparative study of various staining
techniques for determination of extra cellular cellulase activity on carboxy methyl cellulose (CMC) agar plates.
International Journal of Current Microbiology and Applied Sciences, 2014, 3, 261-266.

OB4_18_04/4

293