Extended Abstract : Biology and Biodiversity

12th SCiUS Forum

aggregations, and the location of each aggregate clone marked. All dictyostelid colonies that appeared were
subcultured on non-nutrient agar (NNA) plates for identification. Isolates of interest for further study were
conserved, by adding spore suspensions to 20% glycerol stored under -80 oC.

Aggregations, pseudoplasmodia and fruiting bodies (sorocarps) were photographed through the
bottom of the Petri dish with a 4x objective on an Olympus stereo microscope.

In this study, we use the terms “dictyostelid-type” and “polysphondylid-type” to describe a fruiting
body with a multicellular stalk and a nonwhorled branching pattern (with or without side branches) and a
fruiting body with a multicellular stalk and a whorled branching pattern, respectively.

2. DNA isolation, PCR amplification and sequencing analysis
The ribosomal small subunit (rDNA SSU) of dictyostelids was sequenced for molecular identification. Each
isolate was studied when growing independently on NNA plate with bacteria as a food source. Cells from the
edge of plaques growing on these plates were collected with a sterile loop, mixed with DNA extraction kit
(DNeasy Blood & Tissue Kit, QIAGEN, Germany). The genome was used directly for Polymerase chain
reaction (PCR) amplification. Amplification consisted of an initial denaturing step at 95 oC for 5 min, followed
by 30 cycles of 95 oC for 30 s, 52 oC for 1 min and 72 oC for 2 min, with a final annealing step of 10 min at 72
oC. Sequences were amplified with primers D542F: 5′ TTGGAGGGCAAGTCTG 3′and D1340R: 5′
TCGAGGTCTCGTCCGTTATC 3′ [8]. Sequencing was performed at Macrogen (South Korea). A BLASTn
search was performed using the National Center for Biotechnology Information (NCBI) GenBank database to
identify the most similar SSU sequences and confirm the genus-level placement of the isolates.

3. Feeding preference assay
To assess the feeding preferences of the isolated dictyostelids, three species each of gram-negative bacteria
(Escherichia coli, Klebsiella pneumoniae, and Serratia marcescens) and gram-positive bacteria (Bacillus
cereus, Bacillus subtilis, and Staphylococcus aureus) served as food source. The bacterial strains were grown
and maintained on trypticase soy agar (TSA) slants, all were incubated at room temperature for 24 hours. The
feeding preference assay was then conducted on HIA plates containing streaks of the selected bacteria. To
prepare the plate, 300 μl of the food bacterium (cell concentration equivalent to 0.5 Mcfarland) was spread on
NNA plate surface. Then, a single terminal sorus of a dictyostelid isolate was transferred to the middle of the
culture plate. The inoculated culture plates were then incubated at room temperature under diffuse light for up
to 4 days. The feeding front was determined.

Results, Discussion and Conclusion
Two isolates representing two species of dictyostelids were recovered from nine soil samples collected at the
three study sites in the Ubon Ratchathani University campus, Thailand. Identification of the isolated
dictyostelids was done by comparing their morphologies with those of published literature. Classification of
dictyostelids based on morphology and molecular method (18S rDNA gene) belonged to Polysphondylium
pallidum and Dictyostelium purpureum.

Life cycle of P. pallidum. Myxamoebae aggregate (Fig. 1A) 24 hours after the spores have been
inoculated on agar and began to form sorogen (Fig. 1B) 36 h after inoculation. The sorophore and sori (Fig.
1C) begins to form and grow longer at about 48 hours., and young sorocarp begins to fruit.

Figure 1. Life cycle of P. pallidum. The time of each stage showed on the top right corner. (A) Aggregations;
(B) Sorogen formation; (C) Sorophores and sori. Culture at 22 oC on non-nutrient agar with E. coli
(magnification 40x).

OB2_08_01/2

94

12th SCiUS Forum

Life cycle of D. purpureum. The whole life cycle of D. purpureum extends of a period of less than 2
days. The aggregations (Fig. 2A) formed 24 hours after the inoculation, whereas the pseudoplasmodia
formation (Fig. 2B) needed 36 hours. After that, the sorophores and sori (Fig. 2C) begin to grow orderly and
finally form fruiting sorocarps after 42 hours.

Figure 2. Life cycle of D. purpureum. The time of each stage showed on the top right corner. (A) Aggregations;
(B) Pseudoplasmodia; (C) Sorophores and sori. Culture at 22 oC on non-nutrient agar with E. coli
(magnification 40x).

To assess the feeding preferences of the isolated dictyostelids, three species each of gram-negative
bacteria and gram-positive bacteria. Among the two groups of test microorganisms used in the feeding
preference assay, the gram-negative bacteria were found to promote the growth of cellular slime molds best
(Fig. 3). E. coli remained the preferred food bacterium followed by K. pneumoniae and S. marcescens. On the
other hand, not all dictyostelids fed on gram-positive bacteria (Fig. 3). P. pallidum fed on all of the three gram-
positive bacteria, while D. purpureum utilized only B. subtilis, and S. aureus as food bacterium. Furthermore,
the feeding rate faster with gram-negative bacteria than with gram-positive bacteria (Table 1), supporting the
use of E. coli as the food bacterium for the isolation of these organisms.

Figure 3. The feeding preferences of P. pallidum and D. purpureum, six species of bacteria: gram-negative
bacteria (E. coli, K. pneumoniae, and S. marcescens and gram-positive bacteria (S. aureus, B. cereus, and B.
subtilis).

OB2_08_01/3

95

12th SCiUS Forum

Table 1. Feeding rate of the two dictyostelids isolated from Ubon Ratchathani University campus, Thailand.

Test bacteria Feeding rate (hr)

Gram-negative P. pallidum D. purpureum
E. coli
K. pneumoniae 48 36
S. marcescens 48 48
Gram-positive 48 48
S. aureus
B. cereus 96 96
B. subtilis 120 -
72 72

Conclusion

In this research study, two isolates of dictyostelids were isolated from soil samples collected from Ubon
Ratchathani University campus, Thailand. Identification of the isolated dictyostelids was done by comparing
their morphologies with those of published literature. Classification of dictyostelids based on morphology and
molecular method (18S rDNA gene) belonged to Polysphondylium pallidum and Dictyostelium purpureum.
Two groups of test organisms (gram-negative bacteria and gram-positive bacteria) used, gram-negative
bacteria, particularly E. coli, produced the most prolific growth of cellular slime molds. All two isolates were
able to grow on the three species of gram-negative bacteria. These findings only further support the use of E.
coli in ecological studies of dictyostelids.

Acknowledgements

This project was supported by Science Classroom in University Affiliated School (SCiUS). The funding of
SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This extended
abstract is not for citation.

References

1. Raper KB. The dictyostelids. Princeton University Press; 1984.
2. Brefeld JO. Dictyostelium mucoroides. Ein neuer organismus aus der Verwandschaft der Myxomiceten.

Abh Senckenb Naturf Ges, 1969;7:85-107.
3. Romeralo M, Escalante R, Baldauf S. Evolution and Diversity of Dictyostelid Social Amoebae. Protist.

2012;163(3):327-343.
4. Swanson AR, Vadell EM, Cavender JC. Global distribution of forest soil dictyostelids. Journal of

Biogeography. 1999;26(1):133–48.
5. Schaap P. Evolution of size and pattern in the social amoebas. BioEssays. 2007;29(7):635–44.

6. Spudich JA. Methods in Cell Biology Volume 28 - Dictyostelium discoideum: Molecular approaches to
Cell Biology. San Diego: Academic Press; 1987.

7. Cavender JC, Raper KB. The acrasieae in nature. I. Isolation. American Journal of Botany.
1965;52(3):294–296.

8. Schaap P, Winckler T, Nelson M, Alvarez-Curto E, Elgie B, Hagiwara H, et al. Molecular phylogeny and
evolution of morphology in the social amoebas. Science. 2006;314(5799):661–3.

OB2_08_01/4

96

12th SCiUS Forum

Title : Vasorelaxant effect on rat isolated aorta of OB2_03_05

Field : Shiitake mushroom (Lentinula edodes) protein hydrolysate
Author : Biology
Ms.Narissara Singanusong
School : Ms.Trongkwun Wichai
Advisor : Naresuan University Secondary Demonstration School, Naresuan University
Assoc.Prof.Dr.Krongkran Chootip, Naresuan University

Abstract
Shiitake (Lentinus edodes) has been used as a medicinal mushroom for promoting health, and can act to

provide antihypercholesterolemic, anti-inflammatory and antimicrobial effects. Previous studies have shown that
protein hydrolysates from shiitake mushroom was effective in angiotensin-I converting enzyme (ACE) inhibitors,
this can lead to a decline in the formation of angiotensin II and accordingly a drop in blood pressure.
However, the effects of Shiitake mushroom protein hydrolysate on vascular relaxation have never been elucidated.
Therefore, this study aims to investigate the vasorelaxation effects and mechanism of action of the Shiitake
mushroom protein hydrolysate (SMPH) in rat aorta. Vasorelaxant effects of the SMPH were evaluated in rat aorta
pre-contracted with phenylephrine. Aortic rings preparation were pre-incubated with the inhibitors of endothelial
mechanism, including the nitric oxide ( NO) synthase inhibitor Nω- nitro- L- arginine methyl ester and
the cyclooxygenase inhibitor indomethacin. SMPH induced relaxation in a concentration- dependent manner in
intact and denuded endothelium aortic rings pre- contracted with phenylephrine. Pretreatment with inhibitors of
NO synthase decreased SMPH- induced vasorelaxation, but its vasorelaxant effect was not changed with
cyclooxygenase inhibitor. SMPH induces relaxation in rat aortic rings which was involved activation of
the NO/ cGMP pathway. These findings provide evidence to support the use of SMPH as a dietary supplement in
the treatment of hypertension.

Keywords : Lentinula edodes, protein hydrolysate, shiitake mushroom, vasorelaxant effect

Introduction
Hypertension is a disease that is common in the elderly. The obese elderly who have high blood fat or

smoke have a high chance of getting this disease. Currently, doctors diagnose people with blood pressure ≤140/90
mm/ Hg. in normal conditions as having hypertension. Most patients are asymptomatic but may have pain in the
back of the neck, stiffness on the nape, and dizziness. The disease can lead to complications such as ischemic heart
disease and stroke, which is the leading cause of many deaths.

At present, antihypertensive has various types of forms of action. These medications have long-term side
effects such as dry cough, and dizziness while sitting up. And some groups of drugs, when used for a long time
and then immediately discontinued, may develop withdrawal symptoms. Therefore, if there is a drug that extracted

OB2_03_05/1

97

12th SCiUS Forum

from natural herbs that affects lowering blood pressure. It may reduce the chance of side effects and may be used
for extended periods.

Shiitake mushroom ( Lentinula edodes) is an edible mushroom that has high nutritious and medicinal
properties to reduce blood pressure. There is research showing that the mushroom includes a chemotype that
can inhibit the angiotensin- converting enzyme ( ACE) . And if the ACE enzyme has inhibited, it can cause the
blood vessels to dilate and decrease blood pressure. And the research shows that the protein hydrolysate could be
used as a potential health-promoting ingredient with ACE inhibitory activities. However, there is no research using
shiitake mushrooms protein hydrolysate ( SMPH) to control blood pressure through vascular pathways which is
an important factor in controlling blood pressure. Therefore, this project's objective is to investigate
the vasorelaxant effect and mechanism of action of Shiitake mushroom protein hydrolysate on rat isolated aorta.

Methodology
The experiments were divided into 4 parts as follows:

1. Preparation of Shiitake mushroom protein hydrolysate and chemical composition analysis
This project got the shiitake mushroom protein hydrolysate from Thailand Institute of Scientific and

Technological Research (TISTR)
2. Preparation of rat isolated aorta

The male Sprague Dawley rats were anesthetized and then isolated the abdominal aortas.
Cleaned connective tissue that attached outside and cut into segments about 2- 5 mm. , then suspended the aorta
segments in the organ bath and left them to equilibrate for at least 30 minutes before started the experiments.
3. Study of the vasorelaxant effect

After left the aortic ring to equilibrate, there are steps to study as follows:
3.1. Investigated the function of the aorta by added a high K+ solution
3. 2. Investigated the endothelial function integrity by added 10- 6 M of phenylephrine to stimulated
the contraction of the aorta and then added 10-6 M of acetylcholine to stimulated the relaxation
3.3. Added the cumulative concentration of Shiitake mushroom protein hydrolysate
3.4. Added the high K+ solution
4. Study the mechanism of action
The method was the same as the vasorelaxant effect experiment but after checking the endothelial
function integrity then the blockers were incubated for 30 minutes before adding SMPH. There are divided into
2 experiments.
4.1. Incubated indomethacine which is the cox pathway blocker
4.2. Incubated L-name which is the eNOS pathway blocker
5. Statistical analysis
5.1. Taking the mean and reliability of the mean by using standard deviation (S.E.M)
5.2. Compare the difference before and after adding SMPH in the same group by using the Student T-test
5.3. Compare the difference between groups by using ANOVA

OB2_03_05/2

98

12th SCiUS Forum

If the p-value0.05, it could be considered different.

Results
According to the vasorelaxant effect experiment, the % relaxation results using 5. 2. show that SMPH

induced relaxation in a concentration- dependent manner in endothelial intact and endothelial denude. And the
comparison of % relaxation between endothelial intact ( E+ ) , endothelial denude ( E- ) , and control by using 5. 3,
shows that endothelial intact has the highest %relaxation as shown in figure 1.

*** *** ***
**
*** *** ** *
* * *
**
*

Figure 1: the comparison of %relaxation between E+, E- and control by using ANOVA
(*P<0.05, **P<0.01, ***P<0.001; Compare with control)

And from the mechanism of action experiment, shows that Pretreatment with inhibitors of NO synthase
decreased SMPH- induced vasorelaxation and the vasorelaxant effect was not changed with cyclooxygenase
inhibitor as shown in figure 2.

* ** ** ** ** ** **

Figure 2: the comparison of %relaxation between L-name, indomethacin and E+ by using ANOVA
(*P<0.05, **P<0.01, ***P<0.001; Compare with E+)

Conclusion
SMPH induces relaxation in rat aortic rings by the activation of the NO/ cGMP pathway. And according

to the results, SMPH has the property to induce vasorelaxation. So it will lower total peripheral resistance and

OB2_03_05/3

99

12th SCiUS Forum

mean arterial pressure resulting in lower pressure. Therefore, it can be concluded that SMPH is suitable for
development as a dietary supplement in the treatment of hypertension.
Acknowledgements

This project was supported by Science Classroom in University Affiliated School ( SCiUS) under
Naresuan University and Naresuan University Secondary Demonstration school. The funding of SCiUS is
provided by Ministry of Higher Education, Science, Research and Innovation, which is highly appreciated. This
extended abstract is not for citation.
References
1. Kabir, Y., Yamaguchi, M. and Kimura, S. (1987). Effect of shiitake (Lentinus edodes) and maitake (Grifola

frondosa) mushrooms on blood pressure and plasma lipids of spontaneously hypertensive rats. J Nutr Sci
Vitaminol (Tokyo), 33(5), 341-346.doi: 10.3177/jnsv.33.341.
2. Messerli, F. H. , Bangalore, S. , Bavishi, C. and Rimoldi, S. F. ( 2018) . Angiotensin- conversting enzyme
inhibitors in hypertension: to use or not to use? JACC, 71(13), 1474-82. doi: 10.1016/j.jacc.2018.01.058.
3. Rational drug use in adult and elderly service users with acute and chronic illnesses. (2018). Rational drug use
in adult and elderly service users with acute and chronic illnesses. n.p.: Prince of Songkla University. (in
Thai).
4. Wichai, J. , Poldongnauk, S. and Thorpanyaruang, T. ( 2014) . Knowledge of hypertension. Khon Kaen :
Klungnana Vittayo Press. (in Thai).

OB2_03_05/4
100

12th SCiUS Forum

Title: Isolation and characterization of probiotics from mangrove OB2_17_03
sediments for application in inhibits biofilm formation of
Field: pathogens in aquaculture
Author: Biology and Biodiversity
School: Mister Phongsatorn Ousakulwattana
Advisor: Miss Rinrada Suwandee
PSU.Wittayanusorn Surat Thani School
Prince of Songkla University, Surat Thani Campus
Asst. Prof. Dr.Patima Permpoonpattana
Miss Orathai Daengsawat
(Prince of Songkla University, Surat Thani Campus)

Abstract

Probiotics are living microorganisms that confer health benefits to the host when administered in adequate
amounts; however, probiotics were applied to aquaculture, improving immune response in crustaceans to inhibit
diseases of aquatic animals. This study, focused on diseases from Vibrio parahaemolyticus that affect shrimp
diseases such as Acute Hepatopancreatic Necrosis Syndrome; AHNS, White spot disease; WSD. In addition, there
was also an inhibition test against Staphylococcus aureus and Pseudomonas aeruginosa. because these bacteria
are related to diseases of aquatic animals. This study aims to isolate Bacillus sp. as probiotics from the mangrove
sediment and to study the anti-biofilm activity of probiotics against bacterial pathogens in aquaculture. We have
identified a bacterium from mangrove that can inhibit the growth of Biofilm of V. parahaemolyticus,
Staphylococcus aureus and Pseudomonas aeruginosa and analyzed antibacterial activity. Through isolation and
culture of the unknown bacteria, the culture characteristics, morphology observation, biochemical test, study on
probiotics properties and biofilm-inhibiting properties of bacterial pathogens. It was found that the bacteria are
gram-positive spore chain Bacillus. The citrate test, indole test, starch test, and catalase test for these bacteria were
positive, while indole was negative. According to the morphological and biochemical tests. The results show that
seven isolates namely, RSPA02, RSPA05, RSPA09, RSPA13, RSPA15, RSPA21 and RSPA25 had biochemical
traits similar to Bacillus sp. The efficient spores on DSM agar at 30 °C for 72 hours showed that 98.01, 95.79,
99.93, 98.54, 100 and 100 percent of the spore efficiency, respectively. Therefore, isolate RSPA09, RSPA13,
RSPA21 and RSPA25 were selected for bile salt tolerance and stomach acid. The results show that RSPA09,
RSPA13, RSPA21 and RSPA25 tolerance to stomach acid pH 2.0, 2.5, 3.0 and tolerance to bile salt at 0.1, 0.3, 0.5
after 3 hours of incubation and sensitive to antibiotics. Antibiofilm of bacteria showed cell-free supernatant of
RSPA13 that anti-biofilm producing activity against V. parahaemolyticus, S. aureus and P. aeruginosa. Thus, this
newly identified bacterium was classified as Bacillus sp. Importantly, the crude bacteriocin of this Bacillus sp.
could inhibit the growth of V. parahaemolyticus, S. aureus and P. aeruginosa. This study reports the ability to
inhibit biofilms from strains from mangrove sediment to inhibit biofilm formation in one of the pathogens that
cause disease in aquatic animals and suggests that isolated bacteria as probiotics properties and antibiofilm activity
can be developed and applied in aquaculture.

Keywords : Isolation, Probiotic, Bacillus sp., Biofilm, Vibrio parahaemolyticus

Introduction
Thailand is a country that has been successful in fisheries development until it can be ranked in the top

10 in the world with high productivity. It has also been one of the top exporters of fishery products since 1992.
Gross fishery products are valued at 98.9 billion Baht, accounting for 11.87% of the gross domestic product of the
agricultural sector or 1.27 percent of the country's gross domestic product. That makes aquaculture an important

OB _ _ /1

101

12th SCiUS Forum

occupation in Thailand's export economy. Nevertheless, at the same time the culturing of aquatic is faced with
many problems. Which affects the quality of the export of goods, resulting in the ability to export less quantity of
goods. In particular, the impact of culturing of aquatic is prone to infection. And solutions especially in agriculture
that often use chemical products to fix the quality problem of water used for aquaculture and growth quality that
may have chemical residues from the use of chemicals. Therefore, there are guidelines for biological studies of
probiotics that can be used to replace chemicals in solving problems in aquaculture effectively.

Methodology
The experiments were divided into 4 parts as follows,

Part 1: Isolation of Bacillus strain from mangrove sediment
This project isolated Bacillus from 5 isolation Xylocarpus granatum, Bruguiera gymnorrhiza,

Sonneratia caseolaris and Avicenia marina sample location, because the area had developed nursery animals.
Isolated bacteria were divided into two groups tested by heat and test without heat. This test aims to stimulate
bacteria to produce spores, which is a property of Bacillus that was probiotic.
Part 2: Morphology and biochemical test

Bacteria isolated from mangrove sediment were used for the Gram staining test. To study the appearance
of a bacterium that is assumed to be a bacillus under a microscope. By the nature of the bacillus is shaped like a
rod and bacilli. It was stained with crystal violet, after which the bacteria suspected to be bacillus were tested for
a biochemical test were Catalase test, Citrate test, Oxidase test, Motility test, Indole test and Starch hydrolysis test
Part 3: Probiotics properties of isolated bacteria

3.1 Spore efficiency
Select bacteria with biochemical test results similar to Bacillus sp. and divide into two groups tested by
heat and without heat. The spore-forming properties are characteristic of bacillus, which the sporulation will occur
when the environment is not suitable bus bacillus has spore-forming properties that are resistant to temperature
and environmental conditions; therefore suitable, for use as probiotics in aquatic animals.
3.2 Antibiotic susceptibility
Select the bacteria with the best spore-forming efficiency then cultured in LB medium to mid-log phase
(107-108 CFU/ml) and smeared on Mueller Hinton Agar (MHA). The antibiotics used are as follows: Ampicillin,
Tetracycline, Amoxicillin and Cloxacillin are observed clear zone resistance.
3.3 Blood agar test
It is likewise required to locate and differentiate hemolytic, some micro-organisms produce exoenzymes
that lyse crimson blood cells and degrade hemoglobin; those are referred to as hemolysins. Bacteria can produce
specific kinds of hemolysins.
3.4 Tolerances to gastric fluid and bile salt
It is a simulation of the digestive system and digestive system. Probiotics must be resistant to acids and
bile salts. Probiotics are microorganisms that travel through and live in the digestive tracts of animals that consume
probiotics. The environmental conditions that probiotics experience are gastric acidity and baseline in the small

OB _ _ /2

102

12th SCiUS Forum

intestine. The secretion of bile from the small intestine can also damage the cell walls of probiotic microorganisms.
The test was performed using hydrochloric acid solutions adjusted to pH , and , and bile salt solutions
of , and percent, respectively.
Part 4: Antibiofilm activity of CFS against bacterial pathogens in aquaculture

Bacteria were cultured on trypticase soy agar solid medium, then centrifuged at 8000 rpm for 10 min.
The clear cell-free part was tested for antibacterial activity, V. parahaemolyticus, S. aureus and P. aeruginosa.
And then measured absorb wave light at 570 nm.
Results

It was found from experiment 1 that sample 1 Xylocarpus granatum had the largest number of total
bacteria and heat treatment example from mangrove sediments.

This table shows the results of morphological and biochemical tests. The results indicate that seven
isolates, namely RSPA02, RSPA05, RSPA09, RSPA13, RSPA15, RSPA21. And RSPA25, share biochemical
properties similar to Bacillus sp.

Table.1 Morphological and biochemical tests bacteria

The percentage of spore efficiency of isolated bacteria on DSM agar at 30°C for 72 hours showed 98.01
RSPA02), 95.79 (RSPA05), 99.93 (RSPA09), 98.54 (RSPA13), and 100 (RSPA15, RSPA21, RSPA25) percent,
respectively. The microorganism closest to Bacillus sp. is RSPA15, RSPA21 and RSPA25

Antibiotic susceptibility of isolated bacteria was found that RSPA13 is a bacterial susceptible to three
types of antibiotics: Cloxacillin, Amoxicillin, and Tetracycline, as shown in table 2.

Table.2 Antibiotic susceptibility of isolated bacteria

OB _ _ /3

103

12th SCiUS Forum

Blood agar test was found that RSPA05 is gamma-hemolysis. RSPA13 and RSPA15 were in termed
alpha-hemolysis. And were found that RAPA02, RSPA09, RSPA21, and RSPA25, which is characterized by a
clear (transparent) zone surrounding the colonies, is beta-hemolysis.

Survival of isolates RSPA09, RSPA13, RSPA21, and RSPA25 were selected for their bile salts and
gastric acid tolerance. The results show that RSPA09, RSPA13, RSPA21, and RSPA25 tolerate heartburn pH
2.0.2.5, 3.0 and tolerance to bile salts at 0.1, 0.3, 0.5 after 3 hours incubation.

Bacterial antibiofilm revealed a cell-free supernatant of RSPA13, which produces antibiofilm-producing
activity against of pathogens that are V. parahaemolyticus, S. aureus, and P. aeruginosa.

Conclusion
To conclude, isolation of Bacillus species from mangrove sediment. A total 32 bacteria were isolated

from mangrove sediment in five samples. Isolated bacteria similar to Bacillus 7 isolates (RSPA02, RSPA05,
RSPA09, RSPA13, RSPA15, RSPA21, and RSPA25) and isolate RSPA13 had the potential as a good probiotic.
Bacillus species isolated from mangrove sediment as probiotics resistant to low pH tolerance, spore forming
bacteria and antibiotic susceptibility. Antibiofilm of bacteria showed cell-free supernatant of RSPA09 that anti-
biofilm-producing activity against S. aureus, as also found in isolate RSPA13 against V. parahaemolyticus, and
isolate RSPA21 and RSPA25 against P. aeruginosa.

Acknowledgements
This project was supported by Science Classroom in University Affiliated School (SCiUS) under Prince

of Songkla University, Suratthani campus and PSU. Wittayanusorn Suratthani School. The funding of SCiUS is
provided by Ministry of Higher Education, Science, Research and Innovation, which is highly appreciated. This
extended abstract is not for citation.

References

1. Aryal S, Singh H, ANAND D, balaji p, Zaman N, Abraham C et al. Blood Agar- Composition, Preparation,

Uses and Pictures [Internet]. Microbiology Info.com. 2022 [cited 29 May 2022]. Available from:

https://microbiologyinfo.com/blood-agar-composition-preparation-uses-and-pictures/

2. BOONTHAI, T., VUTHIPHANDCHAI, V. and NIMRAT, S., 2011. Probiotic bacteria effects on growth and

bacterial composition of black tiger shrimp (Penaeus monodon). Aquaculture Nutrition, 17(6), pp.634-644.

3. Ray, S., Jin, J., Choi, I. and Kim, M., 2022. Cell-Free Supernatant of Bacillus thuringiensis Displays Anti-

Biofilm Activity Against Staphylococcus aureus. Applied Biochemistry and Biotechnology,.

4. Rosa, J., Conceição, N., Conceição, R. and Timm, C., 2018. Biofilm formation by Vibrio parahaemolyticus

on different surfaces and its resistance to sodium hypochlorite. Ciência Rural, 48(12).

5. Welcome to Microbugz - Blood Agar Test [Internet]. Austincc.edu. cited May Available

from: https://www.austincc.edu/microbugz/blood_agar_test.php

OB _ _ /4

104

12th SCiUS Forum

Title: Antimicrobial Resistance and Virulence Factors of Pseudomonas aeruginosa OB2_14_02
Isolated from Slaughterhouses in Phatthalung Province

Field: Biology and Biodiversity

Author: Miss Tidarat Khunchit

Miss Pinmanee Sretongkaew

School: Paphayompittayakom School, Thaksin University

Advisor: Asst.Prof.Dr.Chaisit Niyasom (Thaksin University)

Abstract

Pseudomonas aeruginosa is an important human pathogen. The aim of this study was to determine the
antimicrobial resistance and some virulence factors in the 30 strains of P. aeruginosa isolated from slaughterhouse
samples using cetrimide-nalidixic acid agar. All strains were identified as P. aeruginosa based on morphological and
biochemical properties and further confirmed by gyrB gene species-specific polymerase chain reaction (PCR). Isolated
P. aeruginosa strains were examined for their antimicrobial susceptibility patterns against 9 antimicrobials by disc
diffusion technique. All were resistant to ampicillin and susceptible to piperacillin/tazobactam,
cefoperazone/sulbactam, imipenem and ciprofloxacin. Almost strains were intermediate resistant to ceftazidime
(73.33%) and co-trimoxazole (70%). Some showed resistance to co-trimoxazole (16.67%), meropenem (10%) and
amikacin (3.33%). The ampicillin minimum inhibitory concentrations (MICs) of isolated P. aeruginosa were in a
range of 128-1,024 µg/ml. Moreover, all strains were determined for the occurrence of 6 potential virulence factors.
Their overall frequency for hemolytic activity, lipase, protease, pyoverdine, pyocyanin and pyorubin pigmentation
were 100%, 100%, 96.67%, 80%, 50% and 20% respectively. Interestingly, ampC and plcH gene were detected by
PCR in all isolated strains. This result suggested that carbapenem-resistant and aminoglycoside-resistant P.
aeruginosa are present in slaughterhouse and they also have some pathogenic potential.

Keywords: Pseudomonas aeruginosa, Virulence Factors, Antimicrobial Resistance, Slaughterhouse

Introduction
The overuse of antimicrobial agents in livestock production for enhancing animal growth and prophylaxis is

one of the most important factors that provide the emergence and distribution of antimicrobial resistant bacteria. Many
antimicrobials used in animal farms are the same or closely related to those used in human. Infection caused by
antimicrobial resistant bacteria is difficult or impossible to treat and increasing the risk of disease spread, severe illness

OB2_14_02/1

105

12th SCiUS Forum

and death. Pseudomonas aeruginosa is a gram-negative bacterium that distributes in soil and water as well as in
animal, human and plant. It is also considered as an important pathogen that causes of community and hospital-
acquired infection such as bloodstream infection, pneumonia, urinary tract infection and surgical wound infection.

The objective of this research was to investigate the emergence and dissemination of antimicrobial resistant
P. aeruginosa in livestock production in Phatthalung province, Thailand. Strains of P. aeruginosa were isolated from
swine, poultry and bovine slaughterhouse samples to determine their antimicrobial resistance profiles, virulence
factors and some virulence genes. The preliminary results of this study, we suggested that carbapenem-resistant and
aminoglycoside-resistant P. aeruginosa are present in slaughterhouses or animal farms and they also have some
potential to cause infection.

Methodology

Isolation of bacteria from Slaughterhouses samples
Swabs (wall, surface and knives) and carcasses were collected from slaughterhouse in Phatthalung Province

for the isolation of P. aeruginosa using Cetrimide Nalidixic acid agar. Isolates were identified as P. aeruginosa by
morphological, physiological properties (Table 1) and the presence of gyrB gene.

Table 1. Morphological and physiological properties of P. aeruginosa

Gram/ Oxidase TSI Lysine Motile Citrate Urease Malonate OF OF 10% 10%
morphology + K/N decarboxylase + + + + Glucose Maltose Lactose Glucose
Negative/ bacilli
+ +,- -,- - +

Detection of Virulence factors
Isolated strains were tested for their 6 potential virulence factors. Lipase and protease production were

detected by tributyrin agar and skim milk agar plate method, respectively. Hemolytic activity were determined on 5%
sheep blood agar plate. Pyocyanin (blue) and pyorubin (reddish brown) pigmentation were determined on nutrient
agar plate. Pyoverdin (greenish yellow) pigmentation was examined on cetrimide agar under UV light.

Antibiomicrobial susceptibility test
Isolated P. aeruginosa were determined for antimicrobial sensitivity by Kirby-Bauer disc diffusion method

against 9 antimicrobials which were ampicillin, piperacillin/tazobactam, cefoperazone/sultabactam, imipenem,
ciprofloxin, ceftazidime, co-trimoxazole, meropenem and amikacin. The ampicillin-resistant isolates were further
investigated for their ampicillin minimum inhibitory concentrations (MICs) by broth microdilution method.

Detection ampC and plcH gene by Polymerase Chain Reaction (PCR) technique

OB2_14_02/2
106

12th SCiUS Forum

DNA of isolated P. aeruginosa were extracted by boiling method. Amplification of gyrB, ampC and plcH
were done by PCR using primers listed in (Table 2). 5 l of amplified products were analyzed by 1.5% agarose gel
electrophoresis.

Table 2 The primers used in this study

Gene Sequence (5’-3’) Product (bp) References
gyrB F: CCTAGCCATCCGTCGCCACAAC 222 Qin et al. (2003)
R: CGCAGCAGGATGCCGACGCC
ampC F: CGGCTCGGTGAGCAAGACCTTC 218 Monstein et al. (2007)
R: AGTCGCGGATCTGTGCCTGGTC
plcH F: GCACGTGGTCATCCTGATGC 608 Sabharwal et al. (2014)
R: TCCGTAGGCGTCGACGTAC

Result, Discussion and Conclusion

This study, 30 P. aeruginosa strains, identified by standard microbiological and biochemical test, were
isolated from swine, bovine and poultry slaughterhouses in Phatthalung province, Thailand. Moreover, all strains were
molecularly confirmed as P. aeruginosa by the presence of gyrB gene (Figure 1A). From susceptibility test, all strains
were categorized into 7 antimicrobial resistance patterns (Table 3). All 30 isolated strains were resistant to ampicillin.
The ampicillin minimum inhibitory concentrations (MICs) values ware in a range of 128-1,024 µg/ml. Moreover,
ampC gene were found in all isolates. (Table 3, Fig 2B). This finding suggested that one possible mechanism
responsible for ampicillin resistance in these isolates were ampicillinase C production. Moreover, all strains were
100% sensitive to piperacillin/tazobactam, cefoperazone/sulbactam, imipenem and ciprofloxacin. Almost strains were
intermediate resistant to ceftazidime (73.33%) and co-trimoxazole (70%). Some strains showed resistance to co-
trimoxazole (16.67%), meropenem (10%) and amikacin (3.33%). Meropenem is the second carbapenem antibiotic. It
is a beta-lactam antibiotic that inhibit bacterial cell wall synthesis. Amikacin is an aminoglycoside antibiotic which
binds to the bacterial ribosome inhibiting protein synthesis.

The frequency for hemolytic activity, lipase, protease, pyoverdine, pyocyanin and pyorubin pigmentation of
isolated P. aeruginasa were 100%, 100%, 96.67%, 80%, 50% and 20% respectively. Interestingly, plcH gene were
detected by PCR in all isolated strains. This showed that the beta-hemolytic activity on blood agar plate were due to
the production of hemolytic phospholipase C which encoded by plcH gene.

In conclusion, the results suggested that carbapenem-resistant amikacin-resistant P. aeruginosa are present
in bovine slaughterhouse in Phatthalung province and they may also have some pathogenic potential due to the
production of hemolytic phospholipase C, hydrolytic enzymes and pyocyanin pigment.

OB2_14_02/3
107

12th SCiUS Forum

Figure 1. Detection of gyrB (A), ampC and plcH (B) gene by PCR technique
Table 3. The antimicrobial resistance and some virulence factors of 30 isolated P. aeruginosa

Resistance Antimicrobial Isolate Virulence factors Amp MIC
pattern Resistance number (µg/ml)
1 C 1/2 Hemolysis Protease Lipase Pyoverdin Pyocyanin Pyorubin ND
R: AMP C 4/4 ß-hemolysis + - - ND
2 I: CAZ, COT G 3/4 ß-hemolysis + ++ - - ND
S: PIT, IE, MRP, G 3/5 ß-hemolysis + + - ND
3 CFS, CIP, IK G 3/6 ß-hemolysis + ++ + - 256
4 G 5/3 ß-hemolysis + - - ND
5 R: AMP H 3/1 ß-hemolysis + ++ + - ND
6 I: COT H 4/8 ß-hemolysis - - - ND
7 S: PIT, IE, MRP, H 5/2 ß-hemolysis + ++ - - ND
CFS, CAZ, CIP, AK I 5/1 ß-hemolysis + + - ND
I 5/2 ß-hemolysis + ++ + + ND
R: AMP C 1/6 ß-hemolysis + + - 256
I: CAZ C 1/11 ß-hemolysis + ++ + + ND
S: PIT, IE, MRP, C 1/12 ß-hemolysis + + + 256
CFS, CIP, COT, AK C 1/13 ß-hemolysis + ++ + - ND
R: AMP, MRP G 3/1 ß-hemolysis + + - ND
I: CAZ, COT H 5/6 ß-hemolysis + +- + - 256
S: PIT, IE, CFS, CIP, I 1/3 ß-hemolysis + - - ND
AK G 3/14 ß-hemolysis + ++ - - 256
R: AMP, COT H 2/5 ß-hemolysis + - - ND
I: CAZ H 4/12 ß-hemolysis + ++ - - ND
S: PIT, IE, MRP, I 1/2 ß-hemolysis + - - ND
CFS, CIP, AK H 1/4 ß-hemolysis + ++ - - 512
R: AMP, COT H 1/15 ß-hemolysis + + + ND
R: AMP, COT, AK I 1/1 ß-hemolysis + ++ - - 1024
I: CAZ ß-hemolysis + - -
S: PIT, IE, MRP, E 3/5 ++ 512
CFS, CIP E 3/7 ß-hemolysis + + + 512
G 3/3 ß-hemolysis + ++ + + ND
ß-hemolysis + - -
A 2/1 ++ 128
G 3/7 ß-hemolysis + - - ND
ß-hemolysis + ++ + -

++

+-

++

++

++

+-

++

+-

+-

++
++
+-

++
++

Isolate number: A&C code = poultry slaughterhouse, E code = swine slaughterhouse, G H I code = bovine slaughterhouse, AMP = Ampicillin, PIT = Piperacillin/Tazobactam, IE = Imipenem,
MRP = Meropenem, CFS = Cefoperazone/sulbactam, CAZ = Ceftazidime, CIP = Ciprofloxacin, COT = Trimethoprim/sulfa, AK = Amikacin, R = Resistant, I = Intermediate, S = Susceptible,
ND = Not determined

Acknowledgements

This is project was supported by Science Classroom in University Affiliated School (SCiUS). The funding
of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This extended abstract is
not for citation.

References
Hassan WH , Kamel Ibrahim MH, Sayed Shany SA , Hassan Salam HS . Virulence and resistance determinants in
Pseudomonas aeruginosa isolated from pericarditis in diseased broiler chickens in Egypt. J Adv Vet Anim Res 2020;
7: 452-463.

OB2_14_02/4

108

12th SCiUS Forum

Title : Curcumin-loaded nanocomplexes alleviate acute kidney injury in OB2_04_03
hamsters-induced by adenine
Field :
Authors : Biology and Biodiversity

School : Ms. Chawanluk Ruangchayajatuporn
Advisors :
Ms. Yada Pratipanawatr

Demonstration School of Khon Kaen University, Khon Kaen University

Prof. Dr. Somchai Pinlaor

Department of Parasitology, Faculty of Medicine, Khon Kaen University

Mr. Picha Chaijundee, Demonstration School of Khon Kaen University

Abstract

Acute kidney injury (AKI) is a sudden loss of excretory kidney function and usually leads to chronic
kidney disease. The predisposing factors of AKI are inflammation in blood vessels within kidney and chemical
supplements. Overdose of adenine can induce renal failure which affects nephron function, is used as animal model
study. Curcumin possesses an ability to anti-inflammatory, anti-fibrosis and ameliorates kidney damage. However,
it has poor water solubility and poor bioavailability. Curcumin-loaded nanocomplexes (CNCs) were manipulated
and developed. The objective of this study was to investigate the efficacy of CNCs in adenine-induced AKI in
hamsters. Male hamsters were placed in experimental groups as follows: normal control (NC), fed with Adenine
(Ade), fed with blank nanocomplexes (BNCs, Ade+BNCs), fed with different doses of CNCs (25, 50 and 100
mg/kg body weight: Ade+CNCs25; Ade+CNCs50; Ade+CNCs100). The hamsters were daily treated with adenine
for 14 days and stopped. BNCs or CNCs supplement was orally treated thrice a week for 28 days. Weighting of
food intake, water intake, and body weight were monitored weekly. The result revealed that food intake and water
intake were similar among all experimental groups. Increasing of relative body weight change was found in CNCs-
treated and NC group. Relative kidney weight increased in Ade and Ade+BNCs groups but decreased in all doses
of CNCs treatment. Biochemical parameters revealed that decrease of blood urea nitrogen, serum creatinine, uric
acid, and urine microalbumin to creatinine ratio were seen in Ade+CNCs50 and Ade+CNCs100 groups compared
to Ade group. Gross appearance of kidney in Ade+CNCs50 and Ade+CNCs100 groups were recovered as
indicating in brown color with little white spots compared to another Ade-treated groups. Histopathological feature
indicated that tubular inflammation and fibrosis lesions were prominently seen in Ade group, but these changes
were decreased in Ade+CNCs50 and Ade+CNCs100 groups. Immunohistochemical study revealed that increase
expression of HMGB1, early inflammatory marker, and increase expression of KIM-1, early renal tubular injury
marker was observed in Ade group and those reduced in CNCs 50 and 100 mg treated groups. In conclusion, CNCs
treatment mitigates AKI by reducing inflammation and fibrosis, leading to recover of renal function in hamsters.

Keywords : Curcumin, Nanoparticles, Acute kidney injury, Adenine, HMGB1

__________________________________________________________________________________
OOBB22__0044__0033//11

/4

109

12th SCiUS Forum

Introduction
Acute kidney injury (AKI), also known as acute renal failure (ARF), is a sudden loss of excretory kidney

function and usually leads to chronic kidney disease (CKD), which is majorly found in northeastern of Thailand.
The predisposing factors of AKI are inflammation in blood vessels within kidney and chemical supplements [1].
Overdose of adenine can induce AKI which affects nephron function, is used as animal model study. The RIFLE
Criteria of kidney disease (Risk, Injury, Failure, Loss of kidney function, and End-stage kidney disease)
classification were classified as AKI.

Curcumin is a yellow polyphenolic pigment from the Curcuma longa L. (turmeric) rhizome. It has been
shown to possess wide range of pharmacological activities including anti-inflammatory, anti-fibrosis, antioxidant,
anti-cancer, wound healing and anti-microbial effects. Curcumin has been frequently used in other disease such as
diabetes, cardiovascular disorders and also kidney disease. However, it has poor water solubility and poor
bioavailability via consumption. In order to increase its efficacy, curcumin-loaded nanocomplexes (CNCs) was
previously manipulated and characterized [3], which showed sustainably release and had low toxicity [4].

In the present study, we aimed to investigate the alleviate effect of CNCs on adenine-induced AKI in
hamsters. The animal were daily treated with adenine for 14 days and stop. BNCs or CNCs supplement was orally
treated thrice a week for 1 months. Histopathological changes of kidney and biochemical assays of kidney
functions were investigated. The outcome of study may have an increase impact of CNCs for alleviate of AKI and
delay progression of CKD.

Methodology
Ethical statement
The protocol of this study was reviewed and approved by the Animal Ethics Committee of Khon Kaen

University based on the Ethic of Animal Experimentation of National Research Council of Thailand
(IACUC-KKU-57/64).

Preparation of Curcumin-loaded nanocomplexes (CNCs) and Black nanocomplexes (BNCs)
CNCs and BNCs were prepared in industrial scale by the Welltech Biotechnology Co.Ltd, Thailand.
These were oral treated thrice a week with 25, 50 and 100 mg/kg body weight in hamsters by dissolved them in
distilled water. The stock of CNCs and BNCs were prepared weekly and stored in refrigerator at 4ºC until
Treatment [3].
Preparation of adenine
Adenine-induced AKI was prepared in 75 mg/kg body weight by mixing 7.5 mg of adenine (Sigma-
Aldrich Pte. Ltd., United State) with 1 ml of carboxymethyl cellulose (Wako Pure Chemical Industries, Ltd.,
Tokyo, Japan) for hamsters weighting 100 g. Adenine was daily treated for 14 days.
Animal and treatment
Four to six weeks old of male Golden Syrian hamsters weighting 80-100 g were obtained from Animal
unit, Faculty of Medicine, Khon Kaen University. The animals were randomly selected and kept in their cages for

__________________________________________________________________________________
OOBB22__0044__0033//22

/4

110

12th SCiUS Forum

at least 5 days before start experiment. In this study, a total of 36 male hamsters were placed in 6 experimental
groups (n=6, 6 hamsters/cage) as follows: (1) normal control (NC), (2) Adenine (Ade) treated hamster for induced
AKI, and Ade treated hamsters and supplemented with either (3) blank nanocomplexes (Ade+BNCs), (4-6)
different doses of CNCs 25, 50 and 100 mg/kg body weight (Ade+CNCs25; Ade+CNCs50; Ade+CNCs100,
respectively). The hamsters were daily treated with adenine for 14 days and stop. BNCs or CNCs supplement was
orally treated thrice a week for 1 month. Food intake, water intake, and body weight were monitored weekly. After
anesthesia with isoflurane inhalation, blood was collected from the anterior vena cava and placed into clotted blood
tube. Serum was separated by centrifuge at 3,000 rpm 10 min. Urine was collected from directly bladder after
animal were sacrificed. Serum and urine stored with -20°C until tested for biochemical test. For kidney of hamster,
we recorded kidney weight and stored it into 10% formalin for histopathological study and immunohistochemical
study.

Biochemistry
Serum and urine biochemical parameters including renal function test (blood urea nitrogen, creatinine),
uric acid, urine microalbumin and urine creatinine were examined using automate analyzer at Srinagarind Hospital.
Histopathological study
Kidneys were fixed in 10% formalin and embedded in paraffin and stained by hematoxylin and eosin
staining (H&E) which is by far preferred for viewing cellular and tissue structure detail and immuno-
histochemistry staining (HMGB1 and KIM1 kits) which identifies antigens in cell by exploiting the principle of
antibodies [2] for histopathology study.
Data analysis
The results were analyzed statistical data using T-test in Graphpad Prism program.

Results and discussions
The result revealed that food intake and water intake in each week were similar among all experimental

groups (P>0.05). The average body weight of Ade and Ade+BNCs groups were lower than NC group. After
1 month, all animal was euthanized. The kidney weight to body weight ratio in Ade and Ade+BNCs were increased
compared with NC group, but decrease in Ade+CNCs treatment group. Biochemical parameters revealed that
decrease of blood urea nitrogen, serum creatinine, uric acid, and urine microalbumin to creatinine ratio were seen
in Ade+CNCs50 and Ade+CNCs100 groups compared to Ade group, indicating improve renal function in body.
Gross appearance of kidney was pale color in Ade, Ade+BNCs and Ade+CNCs25 compared to brown color in NC
group, but was brown color with little white spots in Ade+CNCs 50 and 100 compared to another Ade-treated
groups, implying to renal recovery. Histopathological features using hematoxylin and eosin staining (H&E)
indicated that tubular inflammation and glomerulus injury were prominently seen in Ade group but these lesions
were decreased in Ade+CNCs50 and Ade+CNCs100 groups. Immunohistochemical study revealed that increase
expression of HMGB1, early inflammatory marker and likewise in KIM1, early renal tubular injury marker, was
observed in Ade group and reduced expression in CNCs 50 and 100 mg treated groups. In addition to discussion,
Ade+BNCs group found nearby results with Ade group due to it is nanocomplexes without curcumin, healing

__________________________________________________________________________________
OOBB22__0044__0033//33

/4
111

12th SCiUS Forum

substance while CNCs treatment group can improved and recovered renal functions by curcumin. For
Ade+CNCs25 group could be improved in order to decrease kidney function test in blood and urine and also in
histopathology study because low dose of curcumin. Ade+CNCs 50 and Ade+CNCs100 group are likely to yield
the most result to biochemical parameters and histopathology study, especially CNCs 100 mg/kg body weight
treatment, suggesting that this amount may suitable dose for recovery AKI in hamsters [4].

Conclusion
CNCs treatment especially in 100 mg/kg body weight is suitable as effective dose.

It reduced blood and urine kidney function test in hamsters and suppressed HMGB1 and KIM1 expression.
Therefore, we suggest that CNCs are a promising agent for mitigates AKI by reducing inflammation, leading to
recovery of renal function in hamsters.

Acknowledgements
We would like to express our deepest appreciation to Prof. Dr. Somchai Pinlaor, our advisor for creative

guidance, valuable advice, supervision, encouragement, and constructive criticism throughout the course of our
study. This project was supported by Science Classroom in University Affiliated School (SCiUS) under Khon
Kaen University and Demonstration School of Khon Kaen University. The funding of SCiUS is provided by
Ministry of Higher Education, Science, Research and Innovation. This extended abstract is not for citation.

References
1. Santos IF, Sheriff S, Amlal S, Ahmed RPH, Thakar CV, Amlal H. Adenine acts in the kidney as a
signaling factor and causes salt- and water-losing nephropathy: early mechanism of adenine-induced renal
injury. Am J Physiol Renal Physiol. 2019 Apr 1;316(4):F743-F757.
2. Shao Y, Sha M, Chen L, Li D, Lu J, Xia S. HMGB1/TLR4 signaling induces an inflammatory following
high-pressure renal pelvic perfusion in a porcine model. Am J Physiol Renal Physiol. 2016 Nov
1;311(5):F915-F925.
3. Pinlaor S, Jantawong C, Intuyod K, Sirijindalert T, Pinlaor P, Pairojkul C, et al. Solid dispersion improves
release of curcumin from nanoparticles: Potential benefit for intestinal absorption. Mater Today Commun
2021;26:1-9.
4. Jantawong C, Priprem A, Intuyod K, Pairojkul C, Pinlaor P, Waraasawapati S, et al. Curcumin-loaded
nanocomplexes: Acute and chronic toxicity studies in mice and hamsters. Toxicol Rep 2021;8:1346-57.

__________________________________________________________________________________
OOBB22__0044__0033//42

/4
112

12th SCiUS Forum

Title : OB2_17_04Prevalence of pedunculate barnacle (Octolasmis spp.) infection

Field : in mud crab (Scylla paramamosain) and effect of salinity in vitro
Author : Biology and Biodiversity
Mr. Napat Saejiw
School : Miss Natthanicha Ragpinij
PSU Wittayanusorn Suratthani School
Advisor : Prince of Songkla University, Surat Thani Campus
Asst. Prof. Dr. Kanda Kamchoo
Assoc. Prof. Dr. Chadapust Sudsiri
(Prince of Songkla University, Surat Thani Campus)
Mr. Thanet Kunamaspakorn
(PSU Wittayanusorn Suratthani School)

Abstract
Scylla paramamosain is an economically important marine crab. There is often an infestation with

parasites. Octolasmis sp. is the one of parasites that live in crab gills. They stole the nutrients that come with water
and continue to propagate until they blocked the crab's water inlets, resulting in the crab being unable to get
nutrients, water, and oxygen. They also destroyed the reproductive, nervous system, and affected their growth
ultimately resulting in death. The purpose of this project was to determine the prevalence of Octolasmis spp. in
mud crab (S. paramamosain) that were collected in a coastal area of Surat Thani province and to eliminate
Octolasmis spp. in vitro by different salinity levels of 0, 5, 15, and 25 ppt. Data were analyzed descriptively in the
form of tables and figures. The statistical analysis was performed using one-way ANOVA (α = 0.05). The results
showed 5 species of Octolasmis spp. i.e. Octolasmis angulata was with the prevalence of 66.67%, Octolasmis cor
with a prevalence of 65%, Octolasmis sp. I with the prevalence of 40%, Octolasmis sp. II with the prevalence of
23.33% and Octolasmis sp. III with the prevalence of 6.67%. The total value of prevalence was 85%. The
reductions in salinity levels of 0, 5, 15, and 25 ppt were observed for 24 hours. For 30 minutes to 2 hours period,
all Octolasmis spp. were not eliminated. In the 24-hour, the salinity treatment at 5 ppt had the highest percentage
of mortality, followed by 25 ppt, and 15 ppt respectively, with the percentage mortality of 50.00±23.56,
43.33±32.33 and 36.66±23.56 respectively. Statistical analysis of salinity treatment, mortality rate among different
salinity levels were not significant (p>0.05). However, the optimal salinity for Octolasmis spp. treatment was 5
ppt.

Keywords: Scylla paramamosain, Octolasmis spp., salinity

Introduction
Mud crabs are high economic value aquatic animals. There are 4 species of mud crabs in Thailand viz.,

Scylla olivacea, S. paramamosain, S. serrata, and S. tranquebarica. Many species of parasites have been reported

in mud crabs such as protozoa, helminth, and arthropods. The most common parasites of mud crabs are
cirripedians, pedunculate barnacles of the genus Octolasmis spp. They live in crab’s gills and inhabit the branchial

chambers of mud crabs (Jithendran et al.,2010). Negatively affects the molting of crabs (Boonrat and Prapasiri.,

OB2_17_04/1

113

12th SCiUS Forum

2006). Interestingly, six species of Octolasmis spp. were found in mud crabs. only two of the species are fully
identified i.e. O. angulata, O. cor and four left species have different and could be a new species (Ihwan M.Z,
2014). For treatment of Octolasmis spp., reducing the salinity levels from 30 ppt to 5 ppt can eliminate pedunculate
barnacles (Octolasmis spp.) in Scylla serrata. However, some chemicals group such as copper sulphate and
organophosphate are not effective on pedunculate barnacles (Boonrat and Prapasiri, 2006). This project was to
determine the prevalence and intensity of Octolasmis spp. in mud crab (S. paramamosain) that were caught in a
coastal area of Surat Thani province, southern Thailand and was to study the efficiency of salinity levels to
eliminate Octolasmis spp. in mud crab in vitro to evaluate the mortality rate.

Methodology

Experiment I: Prevalence and mean intensity of Octolasmis spp. infection in mud crabs
Mud crabs (S. paramamosain) were collected from fishermen in Kanjanadit district, Surat Thani province,

southern Thailand. Thirty males and females were caught by random sampling. Each crab was euthanized by ice

soaking until it stopped movement (10 minutes), then measured by the width of the carapace and its weight. The

carapace of the crab was removed, then pedunculate barnacles were collected from the gills. Octolasmis spp. were

identified and recorded under a stereo microscope. Specimens were kept in 70% ethyl alcohol. Some specimens

were identified and photographed with Leica SAPO, and Leica MC190 HD camera, operated with imaging

software.

Experiment II: In vitro treatment of Octolasmis spp. by different salinity levels

1) Preparation of seawater solutions: Seawater solutions in different salinity levels of 0, 5, 15, and 25

ppt were prepared with scientific sea salt (Marinium). This study used scientific sea salt dissolved in distilled water

at 0, 5, 15, and 25 ppt.

2) Parasite collection: Crab samples were collected from fisherman, then transferred to the laboratory.

The crabs were kept in an aquarium containing seawater at 25 ppt (pond culture 25 ppt). Each crab was euthanized

by ice soaking until it stopped movement (10 minutes). Cut the carapace, removed the gills and collected

pedunculate barnacles in a petri dish containing seawater at 25 ppt.

3) Eliminate Octolasmis spp. by different salinity levels and time: The experiment was designed by

using 4 treatments and 3 replications. Octolasmis spp. were soaked in different salinity levels 0, 5, 15, and 25 ppt.

Five specimens were put in each petri dish containing 10 ml of seawater at different levels. They were kept in the

incubator at 30ºC, then movement and mortality rates were recorded for a period of 30 minutes, 1, 2, 3, 6, 12, and

24 hours.

Data analysis

Experiment I: Data have calculated the prevalence and mean intensity of Octolasmis spp. in mud crab

(S. paramamosain).

Prevalence (%) Number of infected host
= x 100

Total number of host examined

Mean Intensity Number of a particular parasite
(Number of parasites/host) = Number of infected host

OB2_17_04/2

114

12th SCiUS Forum

Experiment II: Data have calculated the mortality rate (%) of Octolasmis spp. in different salinity levels
and statistical analysis was used one-way ANOVA with 4 treatments, each with 3 repetitions had a significant
effect on the 95% significance level (α = 0.05).

Mortality (%) = Number of dead Octolasmis spp. x 100
Total number of Octolasmis spp.

Result and Discussion

Parasites examination in mud crab (S. Table 1. Prevelance and intensity Octolasmis spp.
paramamosain) found 5 species of Octolasmis spp. i.e. in male and female mud crab (S. paramamosain).

O. angulata, O. cor, Octolasmis sp. I, Octolasmis sp. II,

and Octolasmis sp. III. The overall prevalence of

infection was 85% (51/60). The infection rates in male

mud crabs were recorded that O. cor was the highest

prevalence with 66.67%, and the mean intensity was

18.5 parasites/crab. While O. angulata was the highest

mean intensity with 19.68 parasites/crab and prevalence

with 63.63%. Female mud crabs found that O. angulata

was the highest prevalence with 70 %, and the mean

intensity was 40.48 parasites/crab (Table 1). However,

O. cor and O. angulata infected mud crabs have been

found in the Gulf of Thailand according to previous

reports (Jeffries et al. 2005; Ihwan et al. 2014).

In vitro treatment of Octolasmis spp. were performed by using different salinity levels of 0, 5, 15, and
25 ppt. (Table 2, Figure 1). The results showed that Octolasmis spp. could elimated at 3-hour by reducing the
salinity level at 0 ppt. The reductions salinity levels of 5ppt and 15ppt could eliminate Octolasmis spp. at 6-hour.
And reductions salinity level at 25 ppt could eliminate Octolasmis spp. at 24-hours. From the experimental results,

the mortality trend of the salinity reduction at 0ppt, 5ppt, and 15ppt was shown to increase as the time period
increased. With the salinity level at 0 ppt, the mortality rate of the Octolasmis spp. is the highest, followed by 5,
25 ppt, and 15 ppt, respectively. Statistical analysis of reduction salinity levels , mortality rates among different
salinity levels were not significantly (p>0.05)
Table 2. The mortality rate of Octolasmis spp. by reduction of salinity levels within 24-hour time periods.

Treatment Number of the dead Octolasmis (mean±SD)

0 ppt 30 min 1h 2h 3h 6 h 12 h 24 h
5 ppt 0
15 ppt 0 0 0 0.33±0.47 2.16±2.12 3.33±1.88 4.83±0.24
25 ppt 0
0 00 0 0.83±0.71 1.83±2.12 2.50±1.18

00 0 0.33±0.00 1.33±0.47 1.83±1.17

00 0 0 0 2.16±1.65

OB2_17_04/3
115

12th SCiUS Forum

Mortality rate (%) 100
90
80 30min 1h 2 h 3 h 6 h 12 h 24 h
70 0 0
60 0 0 0 6.66 43.33 66.66 96.66
50 0 0
40 0 0 0 0 16.66 36.66 50
30
20 0 0 6.66 26.66 36.66
10
0 0 0 0 0 43.33

0 ppt
5 ppt
15 ppt
25 ppt

Figure 1. The mortality rate of Octolasmis spp. with the different levels of salinity reductions

Conclusion
This study found 5 species of Octolasmis spp. are O. cor, O. angulata, Octolasmis sp. I, Octolasmis sp.

II and Octolasmis sp. III. The overall prevalence was 85% is a high prevalence. Both O. cor and O. angulata in
female crabs have the highest mean intensity at 40 parasites per 1 crab is medium intensity. The reduction of
different salinity levels, the results revealed that the most effective level of salinity was 0, 5, 15, and 25 ppt
respectively. Therefore, the salinity level of 5 ppt is optimal for eliminating the Octolasmis spp. in mud crabs
(p>0.05).

Acknowledgements
This project was supported by Science Classroom in University Affiliated School (SCiUS) under Prince

of Songkla University, Surat Thani Campus and PSU Wittayanusorn Suratthani School. The funding of SCiUS is
provided by Ministry of Higher Education, Science, Research and Innovation. This extended abstract is not for
citation.

References
บญุ รัตน์ ประทมุ ชาติ และปภาศริ ิ บาร์เนท. (2549). แนวทางการกาจดั เพรียงถว่ั งอกในเหงือกปูมา้ (Portunus pelagicus) และปูทะเล

(Scylla serrata). ชลบุรี: คณะวิทยาศาสตร์ มหาวิทยาลยั บรู พา.
JEFFRIES, W. B., VORIS, H. K., NAIYANETR, P., & PANHA, S. (2005). Pedunculate barnacles of

the symbiotic genusparaOctolasmis (Cirripedia: Thoracica: Poecilasmatidae) from the Northern Gulf of Thaila
nd. Tropical Natural History, 5(1), 9–13. Retrieved from https://li01.tci-thaijo.org/index.php/tnh/article/view/
102887

OB2_17_04/4

116

12th SCiUS Forum

Title: The attractiveness of different household sugar types to OB_07_03

Field: the ghost ant (Tapinoma melanocephalum (Fabricius, 1793))
Author:
Biological and diversity
School:
Advisor: Mr. Tanawut Hancherngchai

Miss Pattarathida Khunthula

Miss Sasinan Muenhawong

Mahasarakham University Demonstration School (Secondary)

Dr. Nakorn Pradit, Walai Rukhavej Botanical Research Institute, Mahasarakham University

Abstract
Ants can lead to many household problems because they cause damage mainly to food and many kinds

of stuff such as electric devices, clothes, etc. From the observation, the ghost ant (Tapinoma
melanocephalum (Fabricius, 1793)) was always found in the sugar bowl and made people annoying. However,
there are various types of sugars for cooking. This research is interested in the behavioral response of the ghost
ants to different sugar types in Thai kitchens. This study used three common household sugars (white sugar, brown
sugar, and coconut palm sugar) and used the 10% solution of each sugar type. The behavioral responses of the
ghost ants to the sugar were observed by choice assay (four-arm olfactometer assay) and no-choice assay. In the
choice assay, worker ant was allowed to make a decision between sugar odor and clean air in a 30x30 cm2 arena
four-arm olfactometer. The ants' decision on staying in the middle of the arena or going to the arm of the
olfactometer with or without sugar odor was counted. We found that the ants significantly stay in the middle of
the arena for coconut palm sugar and 10% coconut palm sugar solution. For white sugar and 10% white sugar
solution, most of the ants stay in the middle of the arena (76.92% and 80%). While, in brown sugar and 10% brown
sugar solution, ants tend to go for the olfactometer's arms (50% and 72.27%). In the case of ants going to the
olfactometer's arms, most of the ants picked the arm without sugar in white sugar and brown sugar condition (100%
and 87.5%). While, in the 10% solution of white and brown sugar, ants tend to go for the olfactometer's arms with
sugar (50% and 72.27%). In the no-choice assay, the ant colony was connected directly to the 20 cm long test tube
with the sugar at the end of the tube. For each sugar type, ants were observed at the time of the first visit, the
longest time spent, the total time spent, and the frequency of visits for 2 hours. We found that the first visit time
and the frequency of visits were not significantly different between sugar types (p=0.33 and p=0.09). The longest
time spent, and the total time spent show significantly different between sugar types (p=0.01and p=0.01). Ants
spent time in white sugar, brown sugar, and 10% white sugar solution longer than in coconut palm sugar, 10%
coconut palm sugar solution, and 10% brown sugar solution group. Here, we found that coconut palm sugar had
less attractive to the ghost ants. Moreover, the ghost ant might not use the sugar odor in searching for the sugar
source. Further study on coconut sugar odor's composition and the responses of different ant species may lead to
an ant repellent development.

Keywords: Ghost ant, Sugar odor, Olfactometer, Ant behavior, Household ants

OB_07_03/1

117

12th SCiUS Forum

Introduction
Ants are considered one household pests because they can cause annoyance and damage to many

household products, especially foodstuffs. Some of them can carry many bacteria which can cause human diseases.
Some ants are considered a threat to agriculture because they destroy agricultural products. Ants can harm people
by biting or stinging. The common ant control is pesticide usage by spraying, bait, or combination. The ghost ant
(Tapinoma melanocephalum (Fabricius, 1793)) is commonly found in the house. Even though they do not bite or
sting, they annoy people. They produce a strong smell when they were disturbed. They are always found on the
foodstuffs, especially in the sugar bowls. However, there are various sugars used in the kitchen. The three common
sugar in the Thai kitchen is white, brown, and coconut palm sugar. The difference in color, form, and smell of
sugar results from the origins and production process. The smell is one of the important cues in the foraging
behavior of insects. Ants are insects that have a very sensitive sense of smell. They used chemical pheromone to
find the food and guide. Since the ghost ant is one of the ants that are commonly found in the sugar bowl, we were
interested in the preference of the ghost ant for various types of sugar. We hypothesized that the sugar that has a
strong smell should attract the ghost ant better than the light smell. We also hypothesized that the sugar in the
solution form may attract the ant better than the solid because the ant might carry them to the nest easier. Ants can
collect liquid droplets on their bodies, take them to the nest, and passed the food to other members by mouth.
Therefore, we ran the choice test to observe the behavioral response of the ghost ant to each sugar odor and ran
the no-choice test to observe the foraging behavior of ants on each sugar type.

Methodology

Choice assay (Olfactometer assay)
The behavioral responses of the ghost ant’s worker to sugar odor were observed under a 30x30 cm2 arena

four-arm olfactometer at Tropical Insect Sanctuary, Thailand Institute of Scientific and Technological Research

(Lamtakhong Research) in November and December 2021. The top

of the arena was covered with a clear acrylic plate to prevent the

ants from escaping. Each arm of the olfactometer was connected to

a cylindrical glass chamber (9 cm length x 5 cm diameter)

containing the treatment choice. The constant airflow (1 mmHg)

was pushed into each chamber. Then the airflow moved into the

arena and moved out through a hole in the center of the arena. The

Figure 1 : Four-arm olfactometer set up choice between sugar and air (blank) was randomly placed on two
opposite arms of the olfactometer. In the sugar treatment chamber,

5 g. sugar flake or 10 ml. 10% sugar solution was put into the chamber. One starving worker ant was placed in the
center of the olfactometer’s arena and allowed to walk freely inside the arena for 15 mins. The ant's position in the

olfactometer (at the center, at the arm attached to the sugar chamber, and at the arm attached to the empty chamber)

was recorded at 15 mins. The experiment was conducted at 24-28 °C, 3and 40-45% RH. The arena was clean

with70% alcohol and distilled water before starting the next replication.

OB_07_03/2

118

12th SCiUS Forum

No-choice assay
The ghost ants’ colony was attached directly to the 20 cm-length test tube with a sugar source. One gram

of sugar was put in the test tube for the sugar flake, while, for the 10% sugar solution, one milliliter of the sugar
solution was put in the test tube. The experiment was placed on the bow with a 30-degree slope to prevent the
sugar source move into the ant colony. The response of ants to the sugar source was observed for 2 hours. The first
time that ant visited sugar, the frequency of visits, the longest time that ant spent on sugar, and the total time spent
were recorded.

Results

In the choice assay, all the worker ants significantly stay in the middle of the arena in coconut palm sugar

and 10% palm sugar solution. For white sugar conditions, most of the worker ants stayed in the middle of the

arena. While, in brown sugar conditions, ants tended to go to the arms (Figure 2a). The percentage of ants picked

the olfactometer arms with air more than the arm with sugar odor in white and brown sugar. While, in the sugar

solution, ants picked the arm with brown sugar odor and half of the ants picked the arms with white sugar odor

(Figure 2b). In the experimental setup with three kinds of 10% sugar solution and air in each arm of the

olfactometer, the worker ants went to the arm for 60%. However, ants did not show a specific preference for sugar

or air.

a) b)

Figure 2 : Percentage of ant behavioral response (a) stay in the middle or go to the arm,
(b) go to the arm with air or with sugar odor

In the no-choice assay, the time that ants first visit sugar was not significantly different (KS=5.73, df=5,
p=0.33) (Figure 3a). The ants tended to visit white sugar and brown sugar more often than other sugars, but they
did not show statistically different (KS=9.24, df=5, p=0.09) (Figure 3b). The longest time that ants spent on white
sugar, brown sugar, and 10% white sugar solution were significantly longer than they spent on coconut palm sugar,
10% coconut palm sugar solution, and 10% brown sugar solution (KS=14.39, df=5, p=0.01) (Figure 3c). Similarly,
ants total spend time on white sugar, brown sugar, and 10% white sugar solution significantly longer than on
coconut palm sugar, 10% coconut palm sugar solution, and 10% brown sugar solution (KS=14.94, df=5, p=0 .01)
(Figure 3d).

OB_07_03/3

119

12th SCiUS Forum

a) b)

a
aa

b bb

c) d)

aa bb
a

b

Figure 3 : Ant behavioral responses in the no-choice assay (a) Total Time spend (b) Longest Time spend
(c) First Visiting time (d) Frequency of visiting
(c) longest time spent, and (d) total time spent

Conclusion
Here, we found that the ghost ant showed strongly displeased with the coconut palm sugar. With the

specific volatile components and the chemical compounds of coconut palm sugar, the ants showed 100% staying
in the middle of the arena, having the lowest time spent, and tend to less visit the palm sugar. Here, we suggested
that the volatile compounds on coconut palm sugar have the potential to develop ghost ant repellence in the future.

Acknowledgments
This project was supported by Science Classroom in University Affiliated School (SCiUS) under

Mahasarakham University and Demonstration School. The funding of SCiUS is provided by Ministry of Higher
Education, Science, Research and Innovation, which is highly appreciated. This extended abstract is not for
citation.

References
1. Majid AH, Dieng H, Ellias SS, Sabtu FS, Abd Rahim AH, Satho T. Olfactory behavior and response of

household ants (Hymenoptera) to different types of coffee odor: A coffee-based bait development prospect. J
Asia Pac Entomol. 2018;21(1):46–51.
2. Renyard A, Gries R, Lee J, Chalissery JM, Damin S, Britton R, et al. All sugars ain’t sweet: selection of
particular mono-, di- and trisaccharides by western carpenter ants and European fire ants. R Soc Open Sci.
2022;8(8):210804.

OB_07_03/4
120

12th SCiUS Forum

Title : The study of Morphology and Probiotic OB2_09_04
Characterization of Lactic Acid Bacteria

Isolated from fermented food

Field : Biology and Biodiversity

Author : Ms. Kanganid Aswanuwath

Ms. Chotchanit Boonchuay

Mr. Arthapol Tharananithikul

School : Darunsikkhalai School, King Mongkut’s University of Technology Thonburi

Advisor : Asst. Prof. Dr. Nujarin Jongruja (King Mongkut’s University of Technology Thonburi)

Ms. Jintana Wonta (Darunsikkhalai School)

Abstract
Nowadays, strict measures on the use of antibiotics to stimulate growth in animals have been put in many

countries because antibiotic residual in animals is one of the causes that leads to antibiotic resistance in humans.
Therefore, there must be a substitute for antibiotics, one of that is probiotics. Probiotics are living microorganisms
that, once eaten by animals, must have health benefits, help improve the digestive process, and can grow and
multiply in the animal's body. However, to get a good strain of probiotics, selection and preliminary studies on
probiotic properties are required. Therefore, the aim of this study is to study the probiotic properties of NJpro
bacteria. The studying morphology shows that probiotic NJpro is gram-positive bacteria which have a cylindrical
or bacillus shape. From the biochemistry tests, the result suggests that the NJpro cannot produce Catalase enzyme
and can produce Lactic acid. For the resistance to acid-base, after 48 hours of incubating in MRS agar, the survival
rate in pH3 is 79.29%, pH4 is 86.83%, pH5 is 97.99%, pH6 is 99.14%, pH7 is 99.81%, and pH8 is 97.99%, with
the highest survival rate at pH7 which is 99.81%. And for the resistance to bile salt, after 48 hours of incubating
in MRS agar, the survival rate in 0.1% bile salt is 91.89%, 0.2% bile salt is 86.93%, 0.3% bile salt is 83.87%, 0.6%
bile salt is 86.35%, and 1% bile salt is 84.92%, with the highest survival rate at the 0.1% bile salt which is 91.89%.
In addition, NJpro also had good inhibition against pathogens including Escherichia coli(Inhibition zone=7.12
mm), Salmonella typhimurium(Inhibition zone=8.27 mm), and Staphylococcus aureus(Inhibition zone=4.97 mm).
From this study, Njpro is the bacteria with good probiotic properties and is suitable for further studies to be used
in various industries in the future.

Keywords : Lactic acid bacteria / Probiotic bacteria

OB2_09_04/1
121

12th SCiUS Forum

Introduction
Probiotic are a group of living microorganisms that have some benefits to animals' health and can multiply

in the intestines when consumed. Concerning the basic mechanisms of probiotics, after consumption, probiotics
will grow and prevent pathogenic bacteria from attaching to the animals’ intestinal. The action includes the
secretion of substances such as antibiotic-like compounds, bacteriocin, and organic acids to inhibit the pathogens'
growth. In addition, probiotics contribute to the digestive process by producing various enzymes to assist the
digestion in the digestive tract. By stimulating the activity of macrophages and natural killer cells, probiotics also
helping boost immunity and prevent various infections which enter the body through mucosal immunity.

However, to get a good strain of probiotics as needed, selection and preliminary studies on probiotic
properties include the morphology and biochemical properties, the ability to tolerate in acid-base and bile salt
conditions, and the ability to resistance to pathogen are required.

Methodology
1. Morphology test

1) Gram staining: This test was intended to see if the bacteria had special cell walls that will be colored
violet or red. The test process starts with a colony of NJpro was separated and smeared on the slide, then
drop Crystal violet on the smear and lets it stay about 60 seconds, next drop Iodine on top of there and
lets it stay about 60 seconds, after that flow 95% Alcohol through it about 10 seconds, finally drop
Safranin O and lets it stay about 60 seconds. Every time the new chemical is dropped, we have to clean
the old substance on the surface by flowing the water through the slide, then we blot the smear with tissue
paper as the last step. There are 2 types of cell walls that we can distinguish according to this criterion.
First, if after testing the subject's color is purple, it is gram-positive bacteria. Second, if the subject's color
is red, it is gram-negative bacteria.

2. Properties under various conditions test
Initially, NJpro, lactic acid bacteria, was cultured in 20 ml MRS broth and incubated at 20°C for 24 hours.

Subsequently, 1% culture broth was brought to culture in 100 ml MRS broth as a control.
1) Resistance to acid base: MRS broth was adjusted pH to 3, 4, 5, 6, 7, and 8 with HCL and NaOH solutions,
then incubated at 37°C for 24 hours. The number of survival bacteria was determined by spread plate
method after 48 hours of incubation on MRS agar at 37°C.
2) Resistance to bile salt: Bile salt was added into MRS broth at concentration of 0.1, 0.2, 0.3, 0.6, and 1%,
then incubated at 37°C for 24 hours. The number of survival bacteria was determined by spread plate
method after 48 hours of incubation on MRS agar at 37°C.
3) Inhibition against pathogens: Pathogens including Salmonella Typhimurium, Escherichia coli, and
Staphylococcus aureus were cultured in TSB broth. After incubating swab pathogens in TSB agars and
make pores in the agars. MRS broth at 10,000 rpm was centrifuge at 10,000 rpm then pipette 40 µl of
cell free supernatant into pores Incubate at 37°C for 24 hrs. Measure the inhibition zone size using vernier
caliper.

OB2_09_04/2

122

12th SCiUS Forum

3. Biochemical test
1) Catalase test: This test was intended to see if NJpro are able to produce catalase enzyme. The process
begins with dropping hydrogen peroxide on the NJpro smeared. Generally, hydrogen peroxide is toxic
to cells, but some cells could produce catalases enzyme to protect themselves. When the catalase enzyme
reacts with hydrogen peroxide, it produced water and oxygen gas. Thus, if there are bubbles like soda on
the test subject after drop hydrogen peroxide, the test result is positive.
2) Milk clotting: This test was intended to see if NJpro was able to produce acid and make milk clotting or
silt. Firstly, a colony of NJpro was separated and put in the pasteurized milk, then incubated at 37°C for
24 hours. Some enzymes such as protease enzyme can denatured protein and casein. Therefore, if the
milk clots or silt, it is positive testing.

Result
1. Morphology test

1) Gram staining: The gram staining test suggests that NJpro was gram-positive bacteria. By observing
morphological features through a microscope at 10x, 40x, and 100X magnification, NJpro cells were
stained with the blue color of Crystal violet and they were cylindrical shape(bacillus).

2. Properties under various conditions test
1) Resistance to acid base: The survival rate of NJpro in pH3 was 79.29%, pH4 was 86.83%, pH5 was
97.99%, pH6 was 99.14%, pH7 was 99.81%, and pH8 iwas97.99%, with the highest survival rate at pH7
which was 99.81%.
2) Resistance to bile salt: The survival rate of NJpro in 0.1% bile salt was 91.89%, 0.2% bile salt was
86.93%, 0.3% bile salt was 83.87%, 0.6% bile salt was 86.35%, and 1% bile salt was 84.92%, with the
highest survival rate at the 0.1% bile salt which was 91.89%.
3) Inhibition against pathogens: Njpro inhibition zone size against various pathogens, the inhibition zone
size for Salmonella Typhimurium is 7.9 mm, the inhibition zone for Escherichia coli is 6.8 mm and the
inhibition zone for Staphylococcus aureus is 4.5 mm.

Figure 1: The survival rate of NJpro in pH Figure 2: The survival rate of NJpro in 0.1-1% bile salt

OB2_09_04/3
123

12th SCiUS Forum

Figure 3: Njpro inhibition zone size against various pathogens
3. Biochemical test

1) Catalase test: The result was negative, any bubble has formed, which means that NJpro cannot produce
catalase enzyme.

2) Milk clotting: The result was positive, the milk is clot, which means that NJpro was able to produce some
acid.

Conclusion
Njpro is lactic acid bacteria that was isolated from fermented food. Njpro has good probiotic properties,

it can survive in 3-8pH conditions, has a survival rate of more than 80% in conditions with 0.1-1% bile salt
concentrations and also found that NJpro has good ability to inhibit pathogens, including Salmonella Typhimurium,
Escherichia coli and Staphylococcus aureus.

Acknowledgements
This project was supported by Science Classroom in University Affiliated School (SCiUS). The funding

of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This extended abstract
is not for citation.

References
1. Alecrim, M. M., Martim, S. R., de Souza, B. C. and Teixeira, M. F. S., 2017, “Aspergillus flavo furcatis:

Aflatoxin test and milk-clotting protease production in submerged and solid state fermentation”, AFRICAN
JOURNAL OF MICROBIOLOGY RESEARCH [Electronic], Vol.11, No.7, pp. 312-318, Available :
Academic Journals [2021, September 24].
2. Kantira, A., Nuttaworn, S. and Nujarin, J., 2564, “Isolation of probiotic bacteria from fermentation food and
study properties to use prebiotics to promote probiotic bacteria growth”, Thai Society for Biotechnology
International Conference Online, April 2, 2021, Bangkok, Thailand, pp. 1-13.
3. กณั ฑิรา อนิ ทร์เจริญ, 2563, การศึกษาความเข้มข้นทเ่ี หมาะสมของพรีไบโอติกต่อการส่งเสริมการเจริญและเพ่อื เพ่ิมประสิทธิภาพในการยบั ย้งั เชื้อก่อโรคในไก่ของโปร
ไบโอติกแบคทเี รีย, วทิ ยานิพนธ์ปริญญาวิทยาศาสตร์มหาบณั ฑิต สาขาวชิ าจุลชีววทิ ยาประยุกต์ คณะวิทยาศาสตร์ มหาวทิ ยาลยั เทคโนโลยีพระจอมเกลา้ ธนบุรี.
4. วรรณพร ทะพงิ คแ์ ก, 2557, “ทางเลอื กในการทดแทนการใช้ยาปฏชิ ีวนะเป็นสารเร่งการเจริญเติบโตสาํ หรับปศสุ ัตว์”, วารสารเกษตร, ปี ท่ี30, ฉบบั ท่ี 2, หนา้
201–212.

OB2_09_04/4
124

12 ℎ SCiUS Forum

Title: Separation and characterization of antibacterial compounds from soil bacteria in animal farm

Field: Biology and Biodiversity OB2_06_02
Author: Koranan Panpim, Phattaratida Navachat, Sasikan Wangklang

School: Ratchasima Witthayalai School, SCiUS-Suranaree University of Technology

Advisor: Dr.Sakesit Chamnarnsilapa, Institute of Science, Suranaree University of Technology

Abstract
Antibiotics are widely prescribed for treatment of infection diseases in human and animals. When

antibiotics are regularly used in animal farm, the release of increasing amounts of antibiotics into soil creates the
potential that bacteria in soil may develop some antibiotic compounds that are toxic to other bacteria for their
survival. Therefore, it is the aim of this work to isolate and characterize antibacterial compounds from Bacillus
siamensis in animal farms soil. In this study, Luria-Bertani (LB) agar medium was used to screen and isolated
bacteria by noticing the clear zones around colonies. We identified gram-positive rod shape bacterium with a
convex round shape and rough edge colony that could inhibit Shigella flexneri. The 16S rRNA analysis identified
as B. siamensis. Culture medium extracts were purified by column chromatography using silica gel as a stationary
phase and a mixture of ethyl acetate and hexane as a mobile phase. The compound was analyzed by thin layer
chromatography (TLC) and purified compound to check the activity of antibiotic. It was found that the antibiotic
compounds killed some multidrug-resistant bacteria, such as S. flexneri. Therefore, antibiotic compounds from
B. siamensis have potential of producing new antibiotics.

Keywords: Multidrug resistance (MDR), Antibiotics, Shigella flexneri, Bacillus siamensis, soil bacteria

Introductions
In nature, large population of bacteria with limited resources have to be in the competition to survive by

producing antibiotics (secondary metabolites). Antibiotic abuse refers to the misuse or overuse of antibiotics,
contributes the development of antibiotic resistance, including the creation of multidrug- resistant bacteria
(informally called "super bugs"). Nowadays, humans have reached a crisis level in treating antibiotic resistant
infectious diseases. No drug has been developed to keep a pace with the natural capability of bacteria to advance
and defend themselves against antibacterial drugs. This research aims to isolate and characterize antibacterial
compounds from B. siamensis, isolated from the pig farm. This is due to the fact that animal farm that regularly

uses of antibiotics is an ideal place for screening the antibiotic-producing bacteria.

OB2_06_02/1
125

12 ℎ SCiUS Forum

Methodology & Results
1. Screening of antibiotic-producing bacteria
This study aims to isolate antibiotic producing bacteria and to extract antibiotic substances. The soil

samples were collected from the pig farm around Nakhon Ratchasima province, Thailand (Figure 1). The screening
for antibiotic-producing bacteria was performed by suspended 1 gram of the soil in 10 ml of 0.85% NaCl to make
a soil suspension for the screening of antibiotic producing bacteria.

2. Isolate and purify antibiotic-producing bacteria
Ten-fold dilutions of the soil suspensions were spread onto the LB-agar plate and incubated at 30°C to
screen for the colony with an inhibitory zone as shown in Figure 2a. Then, the streak plate method on LB-agar plate
at 30°C was used to isolate the bacterium producing a clear zone around the colony (Figure 2b). The isolated colony
was grown in 5 ml of LB broth at 30°C, shaking at 200 rounds per minute (rpm) and stored in the present of 25
percent glycerol at -80°C for using in next step of the experiments.

Fig. 1: The pig farm where the soil Fig. 2: (a) The colonies with inhibition zone from the screening on LB-
samples were collected. agar plate. (b) The streak plate method on LB-agar plate to isolate
the bacterium producing a clear zone around the colony.

3. Identification by 16s rRNA
The 16S rRNA gene was amplified using universal primer 27F 5'-AGAGTTTGATCCTGGCTCAG3' and
1492R 5'GGTTACCTTGTTACGACTT-3' by polymerase chain reaction (PCR) and cleaned by QI quick PCR
Purification Kit (Qiagen). The 16S rRNA gene sequencing was sequenced and analyzed by Thailand Institute of
Scientific and Technological Research to determine the sequence homology. The result showed that the isolated
bacterial clone is B. siamensis (99.92%) (Figure 3).

Figure 3: Phylogenetic tree of Bacillus sp. of the bacterial isolation.

OB2_06_02/2
126

12 ℎ SCiUS Forum

4. Antibacterial activity test by Agar plug diffusion method
The plug diffusion technique was used to test the inhibition activity against the bacterial pathogens of the
isolated B. siamensis. The 5 mm paper discs were soaked in the B. siamensis liquid culture and placed on each
LB-agar plate containing either isolated B. cereus, B. subtilis, E. coli, P. aeruginosa, and S. flexneri as background.
Then the plates were incubated at 30 °C for 24 hr. to monitor the growth inhibition. (Figure 4)

45 6

Fig. 4: The picture represents the inhibitory effect of the supernatant of B. siamensis culture on the bacterial
pathogens.
Fig. 5: The Growth inhibition test of the extract: (C) is paper disc control, (D) is paper disc with DMSO 3, 5, 19, 20,
24, and 26 are 5%, 10%, 40%, 50%, 90%, 100% of the purified substances (in ethyl acetate) diluted by DMSO.
Fig. 6: TLC analysis of the fraction from column chromatography of the extract (by 10% ethyl acetate), the TLC
plate was exposed to UV at 254 nm to visualize the present of the compounds (C) crude extract and (4)–(10) were
number of the fraction from the column, the active compound can be observed in the red circles of the (C) and (5).

5. Extraction, Purification and Growth inhibition test
The LB-agar medium at the clear zone around the colonies were excised and soaked in ethyl acetate at 30
°C for 24 hours. The extraction solution was dried by a vacuum-rotary evaporator, remove the solvent. The dried
extract was kept an Eppendorf tube and stored at 4°C as a control for thin-layer chromatography (TLC), where it
can be used as a reference.
The supernatant of the culture medium (1000 mL of LB broth) of B. siamensis incubated at 30°C for three
days. The supernatant was collected by centrifuged the bacterial culture medium at 3500 rounds per minute at 25°C
for 30 minutes. The active compound was extracted twice by 500 mL ethyl acetate. The 1000 mL of the extracted
were dried by vacuum rotary evaporator to evaporate out the solvent. The dried extract was dissolved in 1 mL of
ethyl acetate and transferred to a microcentrifuge tube, and stored at 4 °C. This extract was used for the bacterial

growth inhibition test, TLC and purification
In order to purify the active compound, the extract was subjected to the silica gel column using mixture

of ethyl acetate and hexane as eluents. The presence of active compounds in the B. siamensis culture media was
analyzed by TLC as shown in Figure 5.

OB2_06_02/3
127

12 ℎ SCiUS Forum

The bacterial inhibition activity of the purified active compound (Fraction 5) was investigated by disc
diffusion on an S. flexneri LB-agar plate. Dissolved 300 L of the extract with dimethyl sulfoxide (DMSO) at 40ºC
for 1 hour. Then, using agar dish-diffusion tests to investigate the antibacterial activity using the susceptible bacteria
as a background. We used 20 µg/µL of extracted substance to test antibacterial activity. The result showed that at
the concentration of 10%, 40%, 90%, 100% were able to inhibit the growth of the susceptible bacterium, S. flexneri .
(Figure 6)

Conclusion
In this research we were able to isolate Bacillus siamensis that is able to produce antibacterial growth

compound that can inhibit the growth of P. aeruginosa, E. coli, and S. flexneri. Our finding is potentially a great
discovery of a new antibiotic to fight against MDR. However, the compound needs to be further characterized for
the proper usages in the future.

Acknowledgement
The project is supported by Science Classroom in University Affiliated School (SCiUS) under Suranaree

University of Technology and Ratchasima Wittayalai School. The funding of SCiUS provided by Ministry of
Higher Education, Science, Research and Innovation is highly appreciated. This extended abstract is not citation.
We would like to express our deep gratitude to our research advisor Dr.Sakesit Chumnarnsilapa and Big thanks to
Mr.Pranai Phoprasart and finally the Center of Healthcare and Cosmetics Science and Institute of Chemistry,
Suranaree University of Technology.

References

1. Amin A, Khan MA, Ehsanullah M, Haroon U, Azam SMF, Hameed A. Production of peptide antibiotics
by Bacillus sp: GU 057 indigenously isolated from saline soil. Braz J Microbiol. 2012; 43(4):1340–6.
https://doi.org/10.1590/S1517-83822012000400015

2. Sumi CD, Yang BW, Yeo I-C, Hahm YT. Antimicrobial peptides of the genus Bacillus: a new era for
antibiotics. Can J Microbiol. 2015; 61(2):93–103. https://doi.org/10.1139/cjm-2014-0613

3. Darabpour E, Roayaei Ardakani M, Motamedi H, Taghi Ronagh M. Isolation of a potent antibiotic
producer bacterium, especially against MRSA, from northern region of the Persian Gulf. Bosn J Basic
Med Sci. 2012; 12(2):108–21. http://doi.org/10.17305/bjbms.2012.2509

4. Pottz GE, Rampey JH, Benjamin F. The effect of dimethyl sulfoxide (dmso) on antibiotic sensitivity of a
group of medically important microorganisms: Preliminary report. Ann N Y Acad Sci. 1967; 141(1):261–
72. http:// doi.org/10.1111/j.1749-6632.1967.tb34888

OB2_06_02/4

128

12th SCiUS Forum

Title : Sequence Comparison of Human Collagen Type I OB2_04_08
in Mollusk Databases and
Field :
Authors : Characterization of Acid Soluble Protein in Freshwater Snail Genus Pomacea

School : Biology and Biodiversity
Advisor :
Miss Kunanchaya Boonrom

Miss Yathida Lopphanthong

Demonstration School of Khon Kaen University, Khon Kaen University

Assoc. Prof. Dr. Paweena Pongdontri

Department of Biochemistry, Faculty of Science, Khon Kaen University

Abstract

Collagen is an important protein in our body, which composed of many types and their synthesis is
decrease as we grow old. Therefore, supplement collagen is now commercially interested. Based on the
commercialized abalone collagen, other mollusks were interested to identify the presence of collagen for more
choices. In this study, 2 techniques were used for the identification. The first technique was sequence
comparison of human collagen type I protein to mollusk collagen from NCBI database, by using BLASTP
search. The collagen type I was selected as it is the major collagen type in our body. The BLASTP search,
which revealed more than 95% similarity, resulted in 9 species of mollusk, which 4 species were classified as
Gastropoda and 5 species as Bivalvia. These collagens were putatively digested by chymotrypsin and pepsin
when analyzed by an EXPASY program. The second technique was to analyse whether a Gastropoda member
consisted of collagen by collagenase treatment of acid soluble fraction extract. Golden apple snail, or
freshwater abalone (Pomacea canaliculate), was selected to prepare acid-soluble fraction from foot and buccal
mass by 0.3 M acetic acid extraction, followed by 0.3 M NaCl precipitation and dialysis. The collagenase
treatment was performed within 5 hours at 37 oC. After SDS-PAGE analysis, no protein was detected in
collagenase treated fraction. This suggested that golden apple snail could be another choice for collagen
supplement.

Keyword : Pomacea canaliculate, Gastropoda, Bivalia, collagen, collagenase

Introduction
Collagen is a group of fibrous proteins that are important for all connective tissues in animals. Human

has 18 types of the protein based on amino acid sequences. However, only 4 types have been isolated for
intensive studies, in which type I is highly distributed at 90%. Loss of collagens occur during aging and resulted
in; for example, wrinkle formation, thinner epidermal tissue, skin vulnerable and easily damage, etc. To replace
the lost collagen, collagen from other animals is needed for production of commercial collagen food
supplement, from which fish and mollusk are widely used.

Collagen is a trimeric protein that has 3 polypeptide chains. Each chain composes of almost similar
amino acid sequence. However, the sequences and number of amino acids could be varied from species to

OB2_04_08/1

129

12th SCiUS Forum

species as indicated by sizes of the polypeptide chains. To find more choices for commercial collagen
supplement, it is important to know whether which species contains high similarity to human collagen.
Currently, many amino acid sequences of various mollusks are deposited in NCBI databases, to which are
interested to be preliminary analyzed their similarity and digestibility.

Abalone, a big marine single-shell mollusk, that belong to the class Gastropoda. The abalone flesh
has been used for collagen preparation for commercial production of human collagen supplement. By using
acid-soluble property and partially purified by diluted salt, abalone collagen has been extracted from various
parts and composes of various types of human collagen (EP1444266A4). More choices of collagen could be
investigated from other mollusks that belong to the same class. Recent study of a freshwater snail from genus
Filopaludina suggested the presence of collagen by the acid-soluble property, which could be precipitated by
diluted NaCl better than ammonium persulfate (Khruakriwan and Namuangruk, 2020). Despite the abundance
of Filopaludina can be found in local markets, the size is very small. In this work, a larger type of freshwater
snail that also could be easily found, golden apple snail (Pomacea canaliculate), was selected for the presence
of collagen by using acid-soluble property and collagenase treatment.

Methodology
Amino acid sequence analysis

Amino acid sequences of alpha I and alpha II chain of human collagen type I were blasted for collagen
from mollusks in NCBI databases using BLASTP search. The sequences with more than 95% similarity were
collected for further classification and analysis with digestion by digestive enzymes, i.e., trypsin, pepsin and
chymotrypsin, using an interactive program from www.expasy.org.
Extraction and characterization of acid soluble protein from golden apple snail

Golden apple snails (Pomacea canaliculate) were collected from a swamp site in Nam Phong district,
Khon Kaen. The snails were frozen knocked and cleaned by running tap water before collecting their flesh
from foot and buccal mass and cut into small pieces.

Acid-soluble extraction was performed by gently mixed 10 g of the flesh with 200-ml of 0.3M acetic
acid, pH 3 at 15-22 oC for 3 days. The soluble fraction was collected by centrifugation and slowly precipitated
by 0.3 NaCl overnight at 15-20 oC. The precipitin was collected by centrifugation and dialyzed against distilled
water at 15-20 oC overnight before characterization by collagenase treatment.

Collagenase treatment was performed by incubating the extracted protein with collagenase either 5 or
20 unit in the presence of 0.36M CaCl2 at 37oC for 5 h. The product was analyzed by 14% SDS-PAGE
(Laemmli, 1970) in comparison with untreated protein.

Results
Amino acid sequences of alpha I and alpha II chains of human collagen type I were blasted in mollusk

protein databases in NCBI using BLASTP. Ten amino acid sequences of 95% similarity were fetched and
equally classified into 2 classes; Gastropoda, single-shell snail, and Brivalia, double-shell snail (Table 1).

OB2_04_08/2

130

12th SCiUS Forum

These proteins were putatively digested by trypsin, pepsin and chymotrypsin into approximate 10-amino acid
peptides (Figure 1).

Acid-soluble protein extracted from golden apple snails was characterized whether it was collagen by
collagenase treatment. Prior to the treatment, the protein was concentrated by 0.3 M NaCl precipitation and
desalted by dialysis against water. It was noticed that the acid-soluble protein was reprecipitated after dialysis
but redissolved after treated by SDS-PAGE sample buffer under high temperature. To prove whether the
golden apple snail composed of collagen, this study used collagenase treatment. Collagenase is specific
protease that hydrolyzes only collagen protein. The hydrolyzed product can be determined by SDS-PAGE.
After 5-h treatment, protein bands were disappeared when 20 units of collagenase were used (Figure 2). This
indicated that the acid-soluble protein from the golden apple snail was collagen.

Table 1 Members of snails that have more than 95% similarity of human collagen type I.

Name Bivalia Gastropoda

Pecten maximus ✔

Crassostrea virginica ✔

Crassostrea gigas ✔

Pecten maximus ✔

Pecten maximus ✔

Patella vulgata ✔

Aplysia californica ✔

Gigantopelta aegis ✔

Gigantopelta aegis ✔

Gigantopelta aegis ✔

Figure 1 Putative digestion of trypsin (Tryps), pepsin (Pn) and chymotrypsin (Ch).

OB2_04_08/3

131

12th SCiUS Forum

Figure 2 Collagenase treatment of the acid soluble protein from golden apple snail.
Conclusion

To find new sources of collagen for collagen food supplement, this work used 2 approaches. In the
first approach, prediction was made by searching mollusk collagens that showed more than 95% similarity to
human type I collagen, including their digestibility by stomach proteases. Although this study identified 10
species from Gastropoda and Brivalia, which putatively gave approximate 10-amino acid peptides after
digestion. More sequence comparison of other types of human collagen to mollusk collagens might suggest
more choices. The second approach proved that golden apple snail, a member of class Gastropoda, could be
another choice for collagen supplement. Collagenase treatment of acid-soluble protein extracted from the snail
supported the presence of collagen in the snail as shown by SDS-PAGE.
Acknowledgements

We would like to thank our advisor, Assoc. Prof. Dr. Paweena Pongdontri for her help and
encouragement throughout our project, and also Mr. Anuchit Kanchan for his assistance in most of our
experiments. This project was supported by Science Classroom in University Affiliated School (SCiUS). The
funding of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This
extended abstract is not for citation.

References
1. Manickavasagam, inventer: Use of abalone processing waste. European patent EP1444266A4.

2001 Aug 8.
2. Laemmli U.K. Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4.

Nature 1970; 227:680-685.
3. Khruakriwan, A. and Namuangruk, M. Biodiversity of freshwater snail genus Filopaludina in Ban

Hinrong, Mueng Kao Phattana, Wiang Kao, Khon Kaen. Khon Kaen Demonstration School of Khon
Kaen University. 11th SCiForum 2020.

OB2_04_08/4

132

12th SCiUS Forum

Oral presentation
Biology and Biodiversity Group 2

Sunday August 28, 2022

No. Code Title Author School

1 OB2_18_05 Culture medium containing Mr. Natanon Dungthaisong Surawiwat School,

nitrogen sources from bio- Mr. Nattakrit Soonjan Suranaree University of

degradation chicken feather Miss Banthita Chantha-Uthai Technology

by soil bacteria

2 OB2_02_04 Effects of 20- Mr. Peerawat Phokhaijaturapat Demonstration School,

hydroxyecdysone on protease University of Phayao

activity in testis of the red

flour beetle, Tribolium

castaneum

3 OB2_01_07 Cultivation and study of Mr. Thanarat Fongkome Chiang Mai University

proteins in Hermetia illucens Mr. Phubet Sapperm Demonstration School

L. larvae with different

treatments

4 OB2_10_05 Identification of extracellular Miss Nuttaya Lawpattarakasem Kasetsart University

enzyme-producing bacteria Miss Nattanicha Netamporn Laboratory School

isolated from sediment of Miss Manassikan Kiettichonkan Kamphaeng Saen

shrimp ponds in Nakhon Campus Educational

Pathom Research and

Development Center

5 OB2_03_02 Study on the antioxidant Miss Kangsadan Chananithithum Naresuan University

efficacy of crude extracts Miss Pathita Phatharasiwawechkul Secondary

from some selected blue - Demonstration School

green algae (Cyanobacteria)

133

12th SCiUS Forum

Title : Culture medium containing nitrogen

sources from bio-degradation chicken OB2_18_05

Field : feather by soil bacteria
Biology and biodiversity

Author : Mr.Natanon Dungthaisong

Mr.Nattakrit Soonjan

Ms.Banthita Chantha-uthai

School : Surawiwat School, Suranaree University of Technology

Advisor : Asst.Prof.Dr. Seksit Chamnansilpa

Dr. Pilailuck Kabbali

Abstract

The Bacterial culture medium is currently costly. Because it has to be imported from abroad, small
schools or schools in the provinces cannot conduct microbial culture operations. In this work, the growth of
microorganisms was studied using the inoculated medium obtained from chicken feathers, which is one of the
causes of pollution in Thailand that is difficult to eliminate. In this study, the most efficient microorganisms in
feather degradation were investigated. Five types of soil bacteria were studied: unknown bacterial type 1, unknown
bacterial type 2, Escherichia coli, Bacillus subtilis, and Bacillus siamensis were selected by selecting the most
digestible set of feathers and adjusting the pH to be suitable for bacterial culture in the next step. The bacteria to
test for culture was Escherichia coli. The growth potential of the culture was compared in the digestion liquid with
the available culture medium. The results showed that when digesting chicken feathers by soil bacteria, it was
found that the most efficient soil bacterium for digestion was an unknown type 2 bacterium, Bacillus safensis.
Furthermore, the digestion liquid has properties in Escherichia coli bacteria that can be cultured on a par with the
available culture medium.

Keywords: Culture media, Chicken feather, Microorganism, and Cost reduction

Introduction

Chicken feathers are waste produced by the agricultural and poultry processing industries, increasing
every year, and are difficult to eliminate. There is much research on using chicken feathers in various fields, such
as oil and artificial leather production. Chicken feathers are waste products with high protein content. It can be
used as a nitrogen source, a carbon source, and a source of vitamins and minerals that can promote microbial
growth during the fermentation process. The author, therefore, foresaw the use of chicken feathers for microbial
culture. Since the bacterial culture medium must be ordered from abroad, resulting in high prices. Many provincial
schools do not have enough budget to provide them. Therefore, no microbial culture operations were performed.
The author, therefore, came up with a way to save on such costs by doing research and preparing food for bacteria

OB2_18_05/1

134

12th SCiUS Forum

from locally available raw materials that are readily available and cheap. Considering the cost price, it can save up
to 55.37 baht per liter. One liter of agar medium contains NaCl 5g 0.07 baht (14 baht/1000g), Yeast 5g = 12.9 baht
(1290 baht /500g), Peptone 10g = 42.4 baht (2120 baht /500g)

Method and Experimental Details

2.1 Preparation and condition of the feathers
Collect Chicken feathers from the slaughterhouse, Amphoe Kham Sakae Saeng, wash with water, place in the
sun for one day, then wash with detergent. To remove grease and dirt, clean with water once and then put the
feathers in a dehumidified oven at 60°C for 48 hours before being used in the next step.

2.2 Isolate and select the most effective microorganisms in feather degradation.
- Bacteria preparation used for the test
The medium used in this study carried out the study of five bacteria: unknown bacterial type 1, unknown
bacterial type 2, Escherichia coli, Bacillus subtilis, and Bacillus siamensis.

- Digestibility Test
Add 0.2 ml of soil-isolated culture samples to each centrifuge tube containing 0.2 g of chicken feathers, 20 mL of
water, and 0.01 g of salt (Bhari et al., 2018). The incubator was shaken at 150 rpm at room temperature for eight
days or until feather degradation was seen, repeating three sets of experiments. The best digestible strain was
determined by phytochemical testing. biochemistry.

2.3 Test the growth ability of E. coli in different media.
The initial pH of the Chicken Feather Broth (CFB*) was neutralized in 20 ml rosehip flasks and the medium LB
broth of the same volume. Then, 0.2 ml of Escherichia coli was instilled into each rosehip flask under 37°C on a
shaker at 150 rpm, then monitoring the growth by the absorbance value (OD) of 600. nm for 12 h, followed by pH
change. Repeat three experiments.

2.4 Statistical analysis
t-tests were performed to determine if mean differences between log-transformed data sets were significant. F-test
is any statistical test in which the test statistic has an F-distribution under the null hypothesis. All statistical
analyses were performed using statistical software (IBM SPSS Statistics 25)

Results
3.1 Isolation of bacteria from the soil with the best efficiency in feather degradation.

OB2_18_05/2

135

12th SCiUS Forum

Fig. 1 Chicken feather degradation experiment set by five types of bacteria.
Five types of bacteria were isolated from the soil. It was found that the unknown bacteria type 2 had the
best feather degradation ability, as shown in the figure.

Graph 1 Graph shows the absorption of CFB with 5 types of bacteria.
The growth curve curves show that during the lag phase, the growth of unknown bacteria type 1,
Escherichia coli, Bacillus subtilis, and Bacillus siamensis showed similar growth rates. The growth of unknown
bacteria type 2 was the most prominent.

Graph 2 Graph shows the pH of CFB with 5 types of bacteria.
The pH curve shows the range at which the in vitro pH of each inoculum stabilizes in the pH range of 6-
8 (El-Naghy et al., 1998), where an increase in pH may be caused by bacteria breaking the bonds. In the feather
structure, This results in releasing basal amino groups during digestion (Jeevana Lakshmi P. et al., 2013).
3.2 Bacterial identification
The test for the unidentified strain of Type 2 was found to be similar to Bacillus safensis at 99.92%
3.3. Growth test of Escherichia coli in different culture mediums.
As the graph shows, the absorption (OD) of E.coli from CFB and LB increases every hour.

Graph 3 Graph shows the absorbance of CFB and LB in E.coli culture.
3.4. Statistical analysis

The result of the processing shows the base statistical value of the dependent variable. The program
tested for variance using the statistics F-test. The value of 0.394 appeared to be significant at 0.536, which is
greater than 0.05 (Sig. >0.05), indicating that the variance of the two data sets was not different. From the test, the

OB2_18_05/3

136

12th SCiUS Forum

statistical value of the t-test was 0.961, df = 24, with a statistical significance of 0.346, which was greater than
0.05 (Sig.< 0.05), indicating that there was no difference in mean. Statistically significant at the 0.05 level, the
two datasets were not significantly different.

In the degradation of CFB, the most effective bacterium found in the soil is an unknown type 2
bacteria, Bacillus safensis.

The nitrogen test showed that there were 0.11 g/100 ml of dissolved nitrogen.CFB is expected that there
will be other nutrients that help the growth of the infection. Therefore, it increases the acidity of the culture
medium and the pH suitable for the development of Escherichia coli.

Conclusion
This study shows the properties of the bacterial digestion of chicken feathers. CFB can be used to grow

Escherichia coli bacteria and has aquaculture properties comparable to that of LB available on the market.

Acknowledgments
This project was supported by Science Classroom in University Affiliated School (SCiUS). The funding

of SCiUS is provided by the Ministry of Higher Education, Science, Research, and Innovation. This extended
abstract is not for citation.

References
Bhuvaneswari V. Studies on fungal endophytes from some medicinal plants with special reference totaxol

production by Endophytic coelomycetes [dissertation]. Tamil Nadu: University of Madras; 2005.
Kokaew J, Manoch L, Worapong J, Visarathanonth N, Singbooraudom N, Eamvijarn A, et al. Endophytic fungi in

medicinal plant and studies on antagonistic effect against plant pathogenic fungi in vitro. Proceeding of 45th
Kasetsart University Annual Conference; 2007 Jan 30 - Feb 2; Bangkok. Bangkok: Kasetsart University; 2007.
Ofir E, Oren Y, Adin A. Electroflocculation: the effect of zeta-potential on particle size. Desalination 2007;204:
33-38.
บญั ชา ธนบญุ สมบตั ิ. กฎพิสดาร ปรากฏการณ์พศิ วง 2. พิมพค์ ร้ังที่ 1. กรุงเทพมหานคร: สารคดี; 2549.

OB2_18_05/4

137

:Title Effects of 20-hydroxyecdysone on protease activity in testis 12th SCiUS Forum

of the red flour beetle, Tribolium castaneum OB2_02_04

:Field Biology and Biodiversity
:Author Mr.Peerawat Phokhaijaturapat
:School Demonstration school University of Phayao
:Advisor Assoc. Prof. Dr.Nujira Tatun

Abstract
The red flour beetle, (Tribolium castaneum) is a stored-product pest that can be used as insect

model to study various aspects including genetics, development, physiology, and molecular biology. 20-
hydroxyecdysone (20E) plays an important role in insect metamorphosis and development. Previous study
reported that 20E-injection caused morphological abnormalities in various degree and decreased the number
of offspring. Hence, we intended to examine the effects of 20E-injection on male reproductive organ of T.
castaneum. The newly-hatch pupae were injected with 20E using nanoinjecting apparatus, and resulting adults
were dissected to observe the size of testis and accessory glands. The results showed that the length of accessory
gland increased in 20E-injected group compared to the control. Since protease is an important enzyme in
protein immobilization in many tissues including reproductive organ of insect, hence we also examined the
change in protease activity in testis of 20E-injected insects. However, 20E injection did not alter the enzymatic
activity of protease in male reproductive organ of T. castaneum. The present study provided basic knowledge
on how T. castaneum responds to ecdysone and further study is needed in order to use ecdysone for insect pest
control in the future.

:Keywords 20E-hydroxyecdysone, accessory gland, protease, testicular lobe, testis

Introduction
At present, the problem of flour beetle in rice storage is still a problem, and due to its tropical area,

there are a large number of these insect species. And in recent years, there has been a lot of research that has
brought the starch beetle to study genetics (kingler, 2004).hormone Ecdysone plays an important role in insects.
It is a hormone that causes insects to molt, including secretions and shape changes. This hormone is released
during the chrysalis stage that is about to mature into an adult to molt. (smagge,2009) and many studies have
found that the hormone Ecdysone regulates different parts of the body, one study reported that 20E. Regulate
ovarian maturation, egg maturation (Parthasarathy et al.,2010) The starch beetle's central intestine changes
were also regulated with 20E (Parthasar-athy et al., 2008), as was the influence of ecdysone on morphology
(Nujira, et al.,2018). There have been no reports of effects on the starch moth's reproductive system or the

OB2_02_04/1

138

12th SCiUS Forum

generation of protease enzymes. As a result, we looked at the starch beetle's reproductive abilities and how
much enzyme it can make. The goal is to be able to manage the powder beetle's growth and reproduction.
Methodology

Hormone injection, A stock solution of 20E was dissolved in absolute ethanol at a concentration
of 1 mg/ml and then diluted with distilled water to obtain concentrations of 500 ng /100 nl. The pupae (n = 30)
were anesthetized with diethyl ether and then moved onto a glass slide, where they were held in place with
sticky tape. Next, 500 ng of 20E were injected into the body of each pupae using glass needle and pulled by a
needle puller. Control larvae were injected with distilled water. After injection, pupae were kept at room
temperature and then kept individually in plastic plates and then wait until the pupae develop to adults.

Morphological changes in testis, Insects injected with 20E were dissection under an Olympus
SZ21 stereomicroscope and use forceps to dissection to determine the abnormality of testis. The length and
width of Testicular lobe and Accessory gland were measured using cellSens Imaging software version 1.8 and
Adobe Photoshop CS4 was used to document the testis images.

Measurement of protease activity, Insect sepecimen was homogenized in Sodium Phosphate
Buffer 500 µl pH 6.0 in microcentrifuge tube. The homogenate was then centrifuge at 12000 rpm, 10 minute
and 4 ºC. The supernatant was transfer to new tube. The reaction mixture was consisted of 0.05 M Tris-HCl,
pH 8. 0 (180 µl), insect extract (10 µl). The reaction tube was mixed with with mixer and kept at room
temperature for 5 minute. The substrate (2% Azocasein 10 µl) was added to the reaction tube and incubated at
37 ºC, 60 minute. The reaction was stopped by aadition of 1% TCA (10 µl) and then kept on ice for 10 minute.
The tube was centrifuged at 13000 rpm, for 10 minute at 4 ºC. Supernatant (200 µl) was transferred to new
microcentrifuge tube and mixed with 1 N NaOH (100 µl), 0.05 M Tris-HCl pH 8.0 (700 µl). The absorbance
was measured at 440 nm using UV-Vis spectrophotometer.

OB2_02_04/2

139

12th SCiUS Forum

Results, Discussion and Conclusion

Figure 1: The length and width of testiscular lobe of T. castaneum

Figure 2: The length and width of accessory gland of T. castaneum

Figure 3: The activity of protease in testis of T. castaneum
The result showed that 20E injection affect the length of testiscular lobe of the red flour beetle (Figure

1). But there is no effect on accessory gland and the protease activity (Figure 2 and Figure 3). Therefore, the
reduction of size of testis may decrease the number of red flour beetle population.

However, we need to do the additional experiment to address whether 20E can be used to control
insect.

OB2_02_04/3

140

12th SCiUS Forum

Acknowledgements
This project was supported by Science Classroom in University Affiliated School (SCiUS). The

funding of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This
extended abstract is not for citation.
References
1. Klingler M. 2004: Tribolium. - Curr. Biol. 14: 639-640
2. Smagghe G. (ed.) 2009: Ecdysone: Structures and Functions. Springer Science & Business Media, Dordrecht,
583 pp.
3. Parthasarathy R., Sheng Z., Sun Z. & Palli R. 2010: Ecdysteroid regulation of ovarian growth and oocyte
maturation in the red flour beetle, Tribolium castaneum. - Insect Biochem. Mol. Biol. 40: 429-439.
4. Parthasarathy R., Tan A., Bai H. & Palli R.S. 2008: Transcription factor broad suppresses precocious
development of adult structures during larval-pupal metamorphosis in the red flour beetle, Tribolium
castaneum. - Mech. Dev. 125: 299-313.

OB2_02_04/4

141

12th SCiUS Forum

Title: Cultivation and study of proteins in Hermetia illucens L. larvae with different treatments

Field: Biology and Entomology OB2_01_07

Authors: Thanarat Fongkome
School: Phubet Sapperm
Advisors: Chiang Mai University Demonstration school
Asst.Prof. Ms. Patcharin Krutmuang
ABSTRACT: (Department of Entomology and Plant Pathology, Chiang Mai University)
Mrs. Pornpailin Suwanphithak
(Chiang Mai University Demonstration School)

At present, have increasing of world population, resulting in a lack of sufficient supply. Therefore,
alternative protein sources from insects are gaining more attention. The objective of this project was to study the
effect of feed formulations with local agricultural residues and products. They were applied to study the growth
and conversion of residues into good quality proteins in the larvae stage of insects. The Black Soldier Fly
(Hermetia illucens L.) is in the family Stratiomyidae, order Diptera. Black soldier flies (Hermetia illucens L.) are
one of the highest protein insects. It is easy to cultivate and eat a variety of foods using a short raising period, but
in the culture of different food types affect the number of important substances in insects. The feed formula
containing chicken feed, Japanese rice, jasmine rice, black glutinous rice, riceberry, soybean meal, yeast, whey
protein, molasses, and water were studied in 12 different ratios and formulas. A 1:2 ratio of water was added to
the diet. CRD (Tukey's) experiments were planned. Five iterations were performed with 100 larvae each. Results
were collected daily. Protein analysis was performed by this method. The Spectrophotometric biuret method. The
study found that the larvae fed the mixed soybean meal formula (MIX SB) had the best specific growth rate
(31.45%), while the larvae fed the jasmine rice (WR) had the highest protein content and were followed by the
larvae that ate mixed riceberry (MIX RB) (36.96%) and (34.31%). The results of this study will help decide the
alternatives to local food in raising the black soldier fly larvae (Hermetia illucens L.) for interested farmers. It is
also a good scientific basis that can be used for future reference.

KEYWORDS: Hermetia illucens L., Alternatives proteins, Spectrophotometric biuret method,
insects’ protein sources

OB2_01_07/1
142

12th SCiUS Forum

INTRODUCTION:

At present, have increasing of world population, resulting in a lack of sufficient supply. Therefore,
alternative protein sources from insects are gaining more attention. The objective of this project was to study the
effect of feed formulations with local agricultural residues and products. They were applied to study the growth
and conversion of residues into good quality proteins in the larvae stage of insects. Rice is the staple food of Thai
people. It is the ultimate food that is rich in nutrition. Especially local rice However, the value nutrition of grain
or the number of elements such as protein, starch and dietary fiber contained in each variety of rice is different.
As for the protein in rice, it is of good quality but less than the protein in other grains. Black soldier flies
(Hermetia illucens L.) are one of the highest protein insects. It is easy to cultivate and eat a variety of foods using
a short raising period, but in the culture of different food types affect the number of important substances in
insects. Therefore, this research aims on analyzing the protein content in the larvae stage of insects fed with
native rice varieties and comparing the protein content in the recipes containing Chicken treatment (CT),
Japanese rice (JR), Jasmine rice (WR), Black glutinous rice (BR), Riceberry (RB), soybean meal (SB), yeast,
whey protein, molasses and water.

METHODOLOGY:

The experimental method was divided into 2 parts, Cultivation and quantitative analysis of protein concentration

1. Cultivation
Hatched larvae (repeat 2 basins). Feed Chicken treatment and of water. Observe the changes and hatch

rates. After 7 days, 300 larvae were transplanted into a glass total 12 recipes were prepared, with each recipe being
repeated 5 times. Consist 6 normal treatments ( BR, SB, CT, MR, RB, JR) and 6 mixed treatments giving water
mixed with molasses. Daily weight of larvae was recorded from 50 randomized (10 reps each) from each treatment.
Observe the growth and increase food intake in the same proportion. Until at least one worm prepared to enter the
prepupae stage, determined by the color of the worm body that changes from milky white to dark, brown or black.
The pre-pupae larvae were immersed in a freezer. cleaned by bringing it to a boil and then put in a hot air dryer to
evaporate the water. When the maggots have dried Grind it with a mortar until it can pass through a sieve. Pack
the crushed maggots in a zip-top bag.

2. Quantitative analysis of protein concentration
The protein concentration was quantified by biuret assay. The spectrophotometric method with a

spectrophotometer the principle of nitrogen binding of polypeptides to cupric ions was applied under strong
alkaline conditions. It can be used to analyze protein content in the concentration range of about 1 - 1 0 mg/ml.
Make a standard curve of the Bovine Serum Albumin solution to compare the protein content in the Black Soldier
Fly Larvae solution. Analyze the sample solution and record the results.

OB2_01_07/2

143