Extended Abstract : Biology and Biodiversity

12th SCiUS Forum

Results
Experiment 1: V. campbellii PSU3280 reduction assay

This study found that both phage at all MOIs tested were able to reduce V. campbellii compared to
control. Phages at MOI = 1 was the most effective in thereduction of V. campbellii.
Experiment 2: Inhibition of V. campbellii PSU3280 biofilms

It was found that phages at the highest MOI (10,000) was the most effective in inhibiting biofilm
formation of V. campbellii compared to that of control. No differences were observed between cells incubated
with OPA17 at diffferent duration (4, 8, or 12 hours). For phage OTA22, the efficacy was varied among MOI
and incubating times. This study found that high concentration of phage yielded the best result in biofilm
inhibition and no statistically significant differences were found between the two phages.
Experiment 3: Removal of V. campbellii PSU3280 preformed biofilms

For the removal of V. campbellii PSU3280 preformed biofilms, it was observed that V. campbellii
PSU3280 biofilm was reduced when treated with phage. The results showed that phages OPA17 at MOI 1 had
the best biofilm removal efficiency at 4, 8 and 12 hours. For phage OTA22, at 4 hours, MOI 1,000 had the
best efficacy, and the results were varied when treated for 8 hours or 12 hours. When comparing the efficacy
of phages OPA17 and OTA22 at different MOIs, it was found that the removal efficacy observed at 12 hours
was better than the results obtained from 4- and 8-hours treatments. No statistically significant differences
were found between two phages.
Experiment 4: Biofilm eradication observed by SEM

The V. campbellii PSU3280 biofilms treated with phage OPA17 or OTA22 at MOI 10,000 were
shown in Figure 1. The reduction in preformed biofilms were observed in all treated groups.

A BCD

EFG

Figure 1 Scanning electron microscope (SEM) images of Vibrio campbellii PSU3280 biofilms. (A) Untreated
control, (B-D) sample treated with OPA17 at MOI 10,000 for 4, 8, and 12 hours, respectively. (E-G) sample
treated with OTA22 at MOI 10,000 for 4, 8, and 12 hours, respectively.

Discussion and Conclusion
Experiment 1: V. campbellii PSU3280 reduction assay

From the results of experiment 1, it was found that the phages OPA17 and OTA22 at the MOI 1 were
the most suitable for reducing the number of V. campbellii. This result was consistent with the previous
experiment of Sasikala and Srinivasan which showed that using VP01 at MOI 0.1 and 1 was effective in
reducing the number of V. alginolyticus [3]. In addition, both phages were capable to control the number of
V. campbellii throughout the study period.

OB3_15_02/3

194

12th SCiUS Forum

Experiment 2: Inhibition of V. campbellii PSU3280 biofilms
The results of experiment 2 showed that phages OPA17 had the greatest efficiency in reducing

biofilm formation when apply at high concentration (MOI 10,000), this was consistent with the results of Yang
et al., where phages FE11 were used to remove the biofilm of V. parahaemolyticus and it was found that when
the MOI was increased, the efficiency of reducing biofilm formation was increased [4]. It is different for phage
OTA22 that different MOI had varied results. This may depend on the type of phages. Żaczek et al. reported
that V. alginolyticus can be inhibited by phages at MOI = 10 and MOI = 100 and inactivation results in biofilm
inhibition [5]. Phages might not have direct effect on inhibiting biofilm formation and the decrease in biofilm
content may be due to the phages' ability to kill bacteria before biofilm was formed.
Experiment 3: Removal of V. campbellii PSU3280 preformed biofilms

From experiment 3, it was found that each phage at each MOI had different efficacy in removing the
biofilm compared to the controls. Phages may produce enzymes such as depolymerases that degrades the
extracellular polymeric substances (EPS) which are the matrix components of biofilm [6]. However, the
biofilm removal efficiency of the bacteria was reported as MOI independent because phages are not directly
exposed to bacteria within the biofilm or may not be exposed to biofilm in the true MOI. Thus, appropriate
dose of phages and treated time may differ in each application and required further study.
Experiment 4: Biofilm eradication observed by SEM

The results from SEM analysis were consistent with the biofilm observed by CV assay. This study
suggested that for effective bacteriophages therapy, mixed phages or phage cocktail were needed in order to
prevent bacterial regrowth or the bacterial resistant to each of phage.

Acknowledgements
This project was supported by the Science Classroom in University Affiliated School (SCiUS) under

Prince of Songkla University. The funding of SCiUS is provided by the Ministry of Higher Education, Science,
Research and Innovation. This extended abstract is not for citation.

References
1. Wang L, Chen Y, Huang H, Huang Z, Chen H, Shao Z. Isolation and identification of Vibrio campbellii as
a bacterial pathogen for luminous vibriosis of Litopenaeus vannamei. Aquaculture Research. 2013 Apr
9;46(2):395–404.
2. Plaza N, Castillo D, Pérez-Reytor D, Higuera G, García K, Bastías R. Bacteriophages in the control of
pathogenic vibrios. Electronic Journal of Biotechnology. 2018 Jan;31:24–33.
3. Sasikala D, Srinivasan P. Characterization of potential lytic bacteriophage against Vibrio alginolyticus and
its therapeutic implications on biofilm dispersal. Microbial Pathogenesis. 2016 Dec;101:24–35.
4. Yang M, Chen H, Huang Q, Xie Z, Liu Z, Zhang J, et al. Characterization of the Novel Phage
vB_VpaP_FE11 and Its Potential Role in Controlling Vibrio parahaemolyticus Biofilms. Viruses. 2022 Jan
27;14(2):264.
5. Żaczek M, Weber-Dąbrowska B, Górski A. Phages as a Cohesive Prophylactic and Therapeutic Approach
in Aquaculture Systems. Antibiotics. 2020 Sep 1;9(9):564.
6. Ferriol-González C, Domingo-Calap P. Phages for Biofilm Removal. Antibiotics. 2020 May 21;9(5):268.

OB3_15_02/4

195

12th SCiUS Forum

Title : The study of antimicrobial activity of turmeric OB3_17_01
for the microorganisms causing dermatitis
Field : Biology and Biodiversity
Author : Miss Pathitta Charoenrak
Miss Sunruthai Boonchuay
School : PSU.Wittayanusorn Surat Thani School
Prince of Songkla University, Surat Thani Campus
Advisor : Asst. prof. Dr. Nitas Proukaew
(Prince of Songkla University, Surat Thani Campus)
Mr. Keerati Kullawanichaiyanan
(PSU.Wittayanusorn Surat Thani School)

Abstract :
Turmeric is a popular economic medicinal plant in Surat Thani, Thailand with several advantages.

It is commonly used as an ingredient in southern cuisine and herbal medicine recipes in Thailand. This project
aims to investigate the efficiency of turmeric against skin microorganisms, namely Staphylococcus aureus and
Candida albicans, which cause the steadily increasing number of skin infection cases in Thailand to
approximately 170,000 cases per year. To study the effectiveness of turmeric, the ethanol-based extract was
prepared and evaporated in the solvent until it became a dry turmeric powder. Then diluted with
Mueller-Hinton Broth (MHB) to determine the minimal inhibitory concentration (MIC). The MIC
of Staphylococcus aureus is inconclusive due to the turmeric extract's dark color, which obstructs
the microorganism measurement. The minimal bactericidal concentration (MBC) was determined.
Staphylococcus aureus was grown at all concentrations. It was determined that a concentration of 256 mg/mL,
which was the highest in this experiment, could not inhibit Staphylococcus aureus growth. However, MIC of
Candida albicans was 2.00 mg/mL. The minimal fungicidal concentration (MFC) of Candida albicans was
4.00 mg/mL. Compared to clear zone diameters, turmeric extract showed an average clear zone of 12.2±2.25
mm at a 2.00 mg/mL concentration. The average clear zone was 16.5±2.3 mm at a 4.00 mg/mL concentration,
which is less than the clear zone diameters of Ketoconazole concentrations of 2%, 1%, and 0.5% with average
values of 26±7.56, 22.5±7.9, and 18.1±6 mm, respectively. As a result, turmeric extract is less effective than
Ketoconazole in inhibiting Candida albicans infection.

Keywords : Turmeric, Staphylococcus aureus, Candida albicans

Introduction
In Thailand, skin infections are highly prevalent. It is caused by pathogenic microorganisms such as

Staphylococcus aureus cause skin infections such as purulent wounds and stye. Candida albicans can be found
in the mouth, intestines, and vagina. Several methods of inhibiting both types of microorganisms that cause
infections on the skin have been studied. The antimicrobial drug is a medical treatment, people are becoming
more aware of its negative consequences, such as side effects and drug resistance. As a result, there is a need

OB3_17_01/ 1

196

12th SCiUS Forum

to find natural alternatives, especially herbs, as an option, because of fewer toxic effects. Turmeric grown in
Surat Thani is a high active ingredient called curcumin content. It is a well-known herb in traditional medicine
that treats skin infections. Turmeric extract was used to study its efficacy in inhibiting skin infections caused
by microorganisms. The study results will be essential to determine the function of turmeric extract for skin
medication instead of antimicrobial drugs.

Methodology

Part 1: Preparation of turmeric extract
The first step in making turmeric extract is to wash the turmeric in clean water. Then, dry it in

the oven at 50°C for one week. It was then ground in a blender and extracted with ethanol solvent at a 1:2 ratio
at 25°C for 24 hours. Next, the turmeric extract is filtered with a white cloth and evaporated at 55°C using
a rotary evaporator. Then, place in a fume hood until completely dry, and store at 25°C. It was then weighed
for Staphylococcus aureus and Candida albicans at 5.12 and 2.56 g, respectively. And mixed with 10 mL
of water and turmeric in the test tube. Finally, use an ultrasonic machine to decrease turmeric particle size
in the test tube.
Part 2: Preparation of microbial

Streaked Staphylococcus aureus on Tryptic Soy Agar (TSA) and put in an incubator at 37°C for 24
hours. Then streaked Candida albicans on Potato Dextrose Agar (PDA) and put in an incubator at 30°C for

24 hours. After placing the colonies to the saline, the Optical Density (OD) of the two microorganisms was

measured using a spectrophotometer at a wavelength of 625 nm to a value between 0.07 and 0.09.
Part 3: Determining the Minimal Inhibitory Concentration (MIC)

Prepared the Mueller Hinton Broth (MHB) and poured 4.5 mL of it into a test tube. Then, the
turmeric extract was diluted with MHB to reduce two times each time of the concentration
256 to 0.5 mg/mL. Put 0.5 mL Staphylococcus aureus into test tubes. Mix with a vortex until it is well blended.
Put the test tubes in an incubator at 37°C for 24 hours and record the MIC. Pour 4.5 mL of it into a test tube.
Turmeric extract was diluted with MHB to reduce two times each time of the concentration to 128 to 0 . 25
mg/mL. Put 0.5 mL Candida albicans into test tubes. Mix with a vortex until it is well blended. Put the test
tubes in an incubator at 30°C for 24 hours and record the MIC.
Part 4: Determining the Minimal Bactericidal Concentration (MBC)

Bringing a test tube with turbidity equivalent to the negative control was obtained from the MIC
determination of Staphylococcus aureus. Streaked on Tryptic Soy Agar and incubated for 24 hours at 37°C.
Record MBC at which Staphylococcus aureus can grow on a petri dish with less than five colonies.
Part 5: Determining the Minimal Fungicidal Concentration (MFC)

Bringing a test tube with turbidity equivalent to the negative control was obtained from the MIC
determination of Candida albicans. Streaked on Potato Dextrose Agar and incubate for 24 hours at 30°C.
Record MFC at which Candida albicans can grow on a petri dish with less than five colonies.
Part 6: Comparison of microbial inhibition activity of turmeric extract with the standard drug

Spreaded Candida albicans on the surface of the PDA with a cotton swab. Put the medication disc
on the surface of the culture media. Using turmeric disc 2 mg/mL for MIC and 4 mg/mL for MFC,

OB3_17_01/ 2

197

12th SCiUS Forum

Ketoconazole 2%, 1% and 0.5% were placed on a petri dish. Then incubated for 24 hours at 30°C. Compared
the efficacy of each type of disc in inhibiting microorganisms that cause skin infections to the clear zone
diameter.
Part 7: To count number of Staphylococcus aureus and Candida albicans with plate count technique

From Part 2, put 4.5 mL saline in 15 test tubes. 0.5 mL of OD measuring microorganisms
were inserted into the first test tube. Mix with a vortex until it is well blended. Make serial dilution from tube
1 to tube 2 for ten times reductions are volume of 0.5 mL test tubes. While decreased in the next tube,
use a vortex to mix all test tubes. It was then diluted in a continuous stream until all 15 tubes were used
0.5 mL into a petri dish, mix the melten culture media and microorganisms by rotating the dish back and forth.
Put Staphylococcus aureus dish in an incubator at 37°C for 24 hours and put Candida albicans dish in an
incubator at 30°C for 24 hours. The average number record of colonies counted per petri dish (CFU/mL) was
calculated by counting the number of colonies in Petri dishes ranging from 30 to 300.

Results, Discussion, and Conclusion
MIC can be recorded from the same turbidity test tubes as the negative control tubes due to the dark

yellow color of turmeric. As a result, the MIC value could not be calculated using the above principle.
Therefore, the MBC and MFC values were measured to observe the number of microorganisms on the surface
of culture media from various concentrations.

Figure 3. MBC of Staphylococcus aureus
The MBC results for Staphylococcus aureus indicated the growth at 256 mg/mL concentration.
As a result, Staphylococcus aureus was uninhibited at a 256 mg/mL concentration.

Figure 4. MFC of Candida albicans

The MFC values were reported from less than five colonies’ concentrations. MFC was 4 mg/mL
because it had three colonies and MIC was 2 mg/mL because it had seven colonies.

Table 1. Comparison of the Microbial inhibition activity of turmeric extract with the standard drug

Candida albicans Clear zone (mm.)
Turmeric 4 mg/mL (MFC) 16.5 ± 2.3
Turmeric 2 mg/mL (MIC) 12.2 ± 2.25
26 ± 7.56
Ketoconazole 2.0% 22.5 ± 7.9
Ketoconazole 1.0% 18.1 ± 6
Ketoconazole 0.5%

OB3_17_01/ 3

198

12th SCiUS Forum

These are the average values for the clear zone diameter of Ketoconazole concentrations of 2%, 1%,
and 0.5%, with average values of 26±7.56, 22.5±7.9, 18.1±6 mm, respectively.

The number of colonies that grow from Staphylococcus aureus was obtained by pour plate technique
on Tryptic Soy Agar

• Plate count technique of Staphylococcus aureus (Used 500 µL)
The microbial count can be calculated by the formula (a):

Microbial count = Number of colonies × 2 × Dilution factor …(a)
(44 × 10) + 136 × 2 × 103 = 5.76 × 10 5 CFU/mL

2
So, the microbial count of Staphylococcus aureus is 5.76 × 10 5 CFU/mL.

Figure 5. Plate count technique of Staphylococcus aureus
The number of colonies that grew from Candida albicans was obtained by pour plate technique on
Potato Dextrose Agar
• Plate count technique of Candida albicans (Used 500 µL)
Using the formula (a) to calculate the same value

Microbial count = 76 × 2 × 103 = 1.52×105 CFU/mL
Therefore, the microbial count of Candida albicans is 1.52×105 CFU/mL

Figure 6. Plate count technique of Candida albicans

Turmeric is effective in inhibiting Candida albicans but less than Ketoconazole antimicrobial.
Turmeric can be used to treat diseases caused by skin infections. However, the treatment requires a high
concentrations of it.

Acknowledgments
This project was supported by Science Classroom in University Affiliated School (SCiUS).

The funding of SCiUS is provided by the Ministry of Higher Education, Science, Research and Innovation.
This extended abstract is not for citation.

References
Kebede, B.H., Forsido, S.F., Tola, Y.B. and Astatkie, T. 2021. Free radical scavenging capacity, antibacterial

activity and essential oil composition of turmeric (Curcuma domestica) varieties grown in
Ethiopia.Heliyon. Sciences direct. 1-8.

OB3_17_01/ 4

199

12th SCiUS Forum

Title : Study on antifungal efficacy of Senna alata (L.) Roxb. OB3_03_04
extract

:Field Biology and Biodiversity

:Author Miss Jiratchaya Moonsri

School : Miss Taraporn Netlawan
Naresuan University Secondary Demonstration School, Naresuan University

:Advisor Asst. Prof. Supinda Sirilak, M.D. (Naresuan University)

Asst. Prof. Dr. Sophit Khanthawong (Naresuan University)

Abstract
The objective of this study is extraction of Senna alata (L.) Roxb. leaves, and test the antifungal

activity against pathogenic fungi that cause dermatophytosis, tinea versicolor and candidiasis. Moreover,
antifungal soaps with the extract have been developed. The study was started with extraction, 1 0 0 g of fresh
Senna alata (L.) Roxb. leaves were soaked in 9 5 % ethanol in 1 0 0 0 mL volume for 3 days, then filtered by
white cloth and vacuum filter respectively. Then extract from the solvent by vacuum evaporator and 2 6 mL
of crude extract was obtained. After that, the extract was mixed into an agar medium at a ratio of 0.4 mL per
20 mL of agar medium, the concentration was 200 mg/plate. The results found that the extract has antifungal
activity against Trichophyton rubrum, Trichophyton mentagrophytes and Microsporum canis however it
cannot inhibit Candida albicans. Furthermore, to produce antifungal soap, 2 mL of extract was mixed with
100 mL of glycerin to obtain the concentration of the substance to have a final concentration of 200 mg/mL
then add scent to make appearance of soap clear and fragrant. The antifungal activity of Senna alata (L.) Roxb.
leaves, results alternatively medicinal plant guideline in clinical studies for the benefit of further treatment.

:Keywords Senna alata, dermatophytes, Tinea versicolor

Introduction
Candle Bush or scientifically named Senna alata (L.) Roxb. It is a medium-sized bush. It can be

propagated by the sowing method and can be planted in all types of soil and does not require attention. It can
be commonly found in Thailand, both on the fields and up to the mountains. it can be used for treating many
diseases, such as being used externally to treat skin diseases, being used as anti-constipation, and used to
reduce blood pressure and reducing blood glucose levels.

OB3_03_04/1

200

12th SCiUS Forum

According to research reports, the aloe-emodin, emodin, chrysophanol, and rhein that extracts by
ethanol from the leaves are effective against Epidermophyton floccosum, Microsporium gypseum,
Trichophyton rubrum, Trichophyton mentagrophytes and Microsporum canis which are the fungi that cause
Dermatophytosis and Malassezia furfur that is the cause of tinea versicolor.

From this information, Senna alata (L.) Roxb is very common and easy to plant and has properties
for treating dermatophytosis and tinea versicolor. The researcher was interested and wanted to extract the
extract from the leaves and then mix them with a glycerin to obtain a soap that inhibits the growth of fungi
that cause dermatophytosis, tinea versicolor and candidiasis.

Methodology
The experiments were divided into 3 parts as follows,

Part 1: Preparing Senna alata (L.) Roxb extract by maceration
Weigh 100 g of the Senna alata (L.) Roxb leaves and put it into a 1000 mL glass bottle, then

add 95% ethanol to the 1000 mL volume. Close the lid with aluminum foil and leave for three days. After that,
Filter with straining cloth and funnel filtration, then filter again using Buchner funnel filtration and vacuum
pump. Evaporate the alcohol from the extract in the vacuum evaporator at 50°C and at 71 mmHg pressure
until completely dry. Lastly, bring to weigh and record the result
Part 2: Testing antifungal efficacy

2.1 Testing antifungal efficacy on Trichophyton rubrum, Trichophyton Mentagrophytes and
Microsporum canis by using agar dilution method

Autoclave the Sabouraud Dextrose Agar solution then mix it with 0.4 mL of Senna alata (L.)
Roxb. extract per 20mL for each plate then Pour 20mL of the solution into the plate and wait until the agar is
set. After that use a 0.6 cm diameter pipette to cut out the fungi from the stock and use an inoculation needle
to transfer the fungi into the center of the plate, then close the lid. Lastly, Incubate at 25°C or at room
temperature.

2.2 Testing antifungal efficacy on Malassezia furfur and Candida albicans by using the agar
dilution method
Autoclave the Sabouraud Dextrose Agar solution then mix it with 0.4 mL of Senna alata (L.)
Roxb. extract per 20mL for each plate. then pour 20mL of the solution into the plate and wait until the agar is
set. Adjust the turbidity of the fungi from the stock using McFarland standard no. 0.5 and dilute it in phosphate-
buffered saline, after that spread it all over the plate using a spreader glass. Lastly, Incubate plates in an
inverted position at 37°C in the incubator.
Part 3: Making soap that has inhibition of pathogenic fungus.

Cutting 100g of the glycerin soap, then dissolve the glycerin in a microwave. After that, Add
2 mL of Senna alata (L.) Roxb. extracts to get the final concentration of 400 mg/mL and add perfume into
glycerin. Finally, Pour the mixture into a mold and wait for the soap to set

OB3_03_04/2

201

12th SCiUS Forum

Results
From part 1 of the methodology, 26 mL of crude extract was obtained from 100 g of fresh Senna

alata (L.) Roxb. Leaves.
From part 2 of the methodology
Diameter of fungi (mm)

Specie of fungi Negative Positive control Senna alata (L.) Roxb. Note
control extract 0.4 ml

Trichophyton rubrum 45/43 Can’t be determine 34/33 -
(Doesn’t appear the

growth of fungi)

Trichophyton 36 - 28 -
mentagrophyte

Microsporum canis 35 - 25 -

Table 1: Result from Testing antifungal efficacy of Trichophyton rubrum,
Trichophyton Mentagrophytes and Microsporum canis by using agar dilution method

Amount and size of yeast’s colonies

Specie of fungi Negative control Positive control Senna alata (L.) Note
Candida albicans Roxb. extract 0.4 ml
Malassezia furfur
Colonies of yeast No colonies of Colonies of yeast -
can be found all yeast were can be found all
over the plate found over the plate

-- - All of the
plates got

contaminated

Table 2: Result from Testing antifungal efficacy of Malassezia furfur and Candida albicans
by using agar dilution method

Note: Positive control groups are included only for certain experiments.
From part 3 of the methodology, soap products contain 200mg extract, which has a dark brown

color and fragrance.

Discussion
This experiment found that fresh Senna alata (L.) Roxb. leaves 100 g soak with 95% ethanol 1000 ml

volume for 3 days, which is carried out according to the research. Then, filter it with straining cloth, funnel filtration
and Buchner funnel filtration with a vacuum pump. Then evaporate to eliminate the solvent from the extract in the
vacuum evaporator. It will yield about 26 ml of the crude extract from fresh Senna alata (L.) Roxb. leaves. From
this study, it was estimated that the extract volume depended on the moisture content and the freshness of leaves.

OB3_03_04/3

202

12th SCiUS Forum

The result of testing antifungal activity of Senna alata (L.) Roxb. leaf extract found that when the crude
extract that was obtained mixed into an agar medium at a ratio of 0.4 mL per 20 mL of agar medium, the
concentration was 200 mg/plate, was found the extract has antifungal activity against Trichophyton rubrum,
Trichophyton mentagrophytes, and Microsporum canis however it cannot inhibit Candida albicans. For Malassezia
furfur, after researching the information from the previous research, the extract was extracted by using Senna alata
(L.) Roxb. flower by soxhlet extractor and using Chloroform ethanol for extraction. The extract has the effect of
inhibiting Malassezia furfur since this study uses different parts of plants and extraction methods, and in addition,
Malassezia furfur is and fungi that grow well when there is a lot of fats or oil. Extraction methods and solutions that
contain oil may not affect the growth of infections or promote the growth of infections instead. This may require
further testing by changing the extraction method and the solvents and increasing the concentration of extracts to
see the inhibition effect further.

When 2 mL of Senna alata (L.) Roxb. extract was mixed with 100 mL of glycerin to get a final extract
concentration of 400 mg/mL which has been tested to have antifungal effect, then add flavor. The soap product has
a dark brown color, fragrant and also has an antifungal effect.

From this study, we found that the extract from Senna alata (L.) Roxb. can inhibit Trichophyton
rubrum, Trichophyton mentagrophytes, and Microsporum canis, which can be used to make soap with an antifungal
effect. It is an alternative herb to treat fungal infections and can apply this study in clinically for the benefit of further
treatment of related diseases.

Conclusion
According to this study, Senna alata (L.) Roxb. leaf extract can inhibit the fungus Trichophyton

rubrum, Trichophyton mentagrophytes and Microsporum canis, which can be used to make soaps with antifungal
effects. It is an alternative herb to treat fungal infections. The antifungal activity of Senna alata (L.) Roxb. leaves,
results alternatively medicinal plant guideline in clinical studies for the benefit of further treatment.

Acknowledgements
This project was supported by Science Classroom in University Affiliated School (SCiUS). The

funding of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This
extended abstract is not for citation.

References
1. Panichayupakaranant P, Sakunpak A, Sakunphueak A. Quantitative HPLC Determination and Extraction

of Anthraquinones in Senna alata Leaves. Journal of Chromatographic Science. 2009;47(3):197-200.
2. Prabhu V, Poonkodi K, Pradeep K, Buvaneswari S, Mini R, Vimaladevi K et al. Antidandruff activity of

Cassia auriculata and Cassia alata through fatty acids mediated inhibition of Malassezia furfur. Journal
of Applied and Natural Science. 2020;12(4):532-540.
3. Tiasripattanasuk S. STUDY OF EFFICACY AND STABILITY OF CASSIA ALATA GEL FOR
ANTIMICROBIAL ACTIVITIES [Internet]. Ir-ithesis.swu.ac.th. 2022 [cited 12 April 2022]. Available
from: http://ir-ithesis.swu.ac.th/dspace/handle/123456789/1065

OB3_03_04/4

203

12th SCiUS Forum

Title : Inhibitory Action of Thai Herb on OB3_10_04

The Growth of Pathogenic Bacteria
Field : Biology and Biodiversity
Author : Mr. Thanabodee Charoenvuttitham, Mr. Peerawat Phetsuth , Miss Muthita Pratuksakul
School : Kasetsart University laboratory School Kamphaeng Saen Campus Educational Research

and Development Center
Advisor : Assist. Prof. Aree Innun (Ph.D.)

Abstract :

The objective of this experiment was to study the effect of crude extracts from Thai herbs, including;
white basil, ginger and Andrographis paniculate powder, to inhibit the growth of pathogenic bacteria,
Escherichia coli (E. coli) and Staphylococcus aureus (S. aureus) at a concentration of 1 . 5 x 1 0 8 CFU/ml.
Distilled water, 95% ethanol, ether and acetone were used as solvent with the concentration ratio of basil (20
g), ginger (20 g) and Andrographis paniculate powder (1 g) per 100 ml of solvent (weight per volume). The
solvent was evaporated at 8 0 °C for 3 0 min. The crude extracts were then tested for antibacterial activity by
Agar disc diffusion test and Agar well test.

From the results, it was found that the white basil crude extract with ethanol, ether and acetone was
effective in inhibiting the growth of bacteria in both Gram-negative E. coli and Gram-positive S. aureus.
Especially, the crude extracts with ethanol and ether showed the activity against E. coli at 0.78 cm. and 1.38
cm., respectively. The crude extract of ginger with ethanol, ether and acetone was found to be effective against
S. aureus (1.10, 0.80 and 2.05 cm., respectively) better than E. coli (1.05, 0.30 and 1.35 cm., respectively),
indicating that acetone was a suitable solvent for extraction ginger for inhibiting gram-positive bacteria. While
the crude extract of Andrographis paniculata powder with ethanol and acetone showed good results to inhibit
both Gram-negative and Gram-positive bacteria. It was able to inhibit the growth of S. aureus as inhibition
zone of 1.15 cm. (ethanol) and 1.38 cm. (acetone), respectively. However, ether was not suitable for extraction
of active compound in Andrographis paniculate powder. The results of all experiments showed that Thai
herbs; white basil, ginger and Andrographis paniculata had antibacterial activity against pathogenic bacteria
when using the appropriate solvent and dosage.

Keywords : Ocimum sanctum L., Zingiber officinale, Andrographis paniculata (Burm.f.) Nees,
Antibacterial activity

OB3_10_04/1
204

12th SCiUS Forum

Introduction
Medicinal plants have been used with Thai people for thousands of years. At present, Thai herbs are

widely used to treat diseases. Some of the popular Thai herbs that are commonly used as medicines for
various diseases are;

Ocimum sanctum L. White basil leaves have a pungent smell due to consist of 1 . 7 % essential oil
which contains many chemicals such as sesquiterpene, ß-caryophyllene and ß-elemene. There are also several
phenylpropanoids including methyl eugenol and methyl chavicol. The substance of phenol, tannin and saponin
group show effective against E. coli and Shigella dysenteriae bacteria that cause diarrhea. The use of white
basil extract for wound healing and prevent infection from microorganisms initially. Reduce blood sugar
levels, cholesterol, relieve inflammation and arthritis as well.

Zingiber officinale Ginger rhizome contains about 1-3% essential oil, depending on planting method
and storage period. The main chemicals in oil are zingiberene, zingiberol, bisabolene, and camphene, these
are the parts that give ginger smell and spicy taste. The application of ginger used in oil or fat to prevent
rancidity. Ginger can also help the digestive system, which has been used in many treatments. According to
studies, ginger is an antioxidant, anti-inflammatory, anti-nausea and cancer-fighting agent.

Andrographis paniculata In Andrographis paniculata leaves, the essence of the active substance is
lactone group which is a substance andrographolide. Andrographis paniculata is an ancient medicine of China.
Used to cure abscesses, inflammation and treat dysentery. Pharmacological research found that Andrographis
paniculata can inhibit bacteria that can cause pus. Andrographolide helps to stop the spread of Covid-1 9, it
can be used to treat the initial symptoms.

Gram-positive bacteria have thick lipid and peptidoglycan membranes. Gram-negative bacteria have
an internal and external membrane and only a thin peptidoglycan that lies in the periplasmic space and contains
a layer of lipopolysaccharide on the outer cell membrane. For the pathogenic bacteria that were used in this
experiment are;

E. coli is a gram-negative bacteria, rod shape, does not produce spores and can grow both with oxygen
and without oxygen. E. coli is a coliform group which found in the feces of humans and warm-blooded
animals. It is naturally present in the large intestines of animals and humans. E. coli is bacteria which common
cause of diarrhea both in children and adults.

S. aureus is a gram-positive bacteria. The shape is similar to bunch of grapes, does not produce spores,
not moving and do not contain capsules. It is a bacterium that can grow in both aerobic and anaerobic
conditions. S. aureus can produce enterotoxin which heat resistance and cause food poisoning.

Methodology
Equipment: antibiotic assay paper disc dia. 6 mm., Vial Bottle, Shaker, Blender, Centrifuge

Spectrophotometer, Laminar flow, Test tube, Centrifuge tube, Autoclave Cork borer No. 3, Flask 250 and 500
ml., inoculating loop, Pipettes, Micropipettes, Tip 200 and 1,000 µ l. For the solvents: distilled water (D.I.),
Ethanol 95% v/v ether and acetone. For the bacteria: Escherichia coli and Staphylococcus aureus. Culture
medium: Nutrient agar (NA) and Nutrient broth (NB).

OB3_10_04/2

205

12th SCiUS Forum

White basil leaves samples from the top down were collected up to 10 leaves and used for the study
within 2 4 hours. Ginger 1 0 - 1 2 months old with a light brown exterior were used. Andrographis paniculata
uses products in the form of dry powder capsules.

White basil and ginger were soaked in 100 ml of 75% ethanol for 1 minute then washed with 100 ml
of distilled water three times to eliminate the remaining ethanol. As for Andrographis paniculata powder,
there is no need for cleaning at this step. Then, grind the cleaned white basil leaves with a sterilized Motar &
Pestle finely. Reduce the size of cleaned ginger with a sterile knife to approximately 0 . 5 x 0 . 5 cm.
Andrographis paniculata powder was used as it is.
Crude extract preparation; White basil (20 g) and ginger (20 g) and Andrographis paniculata (1 g) were soaked
in the solvent 1 0 0 ml using flask and shake overnight on a rotary shaker at a speed of 1 2 0 rpm at room
temperature. The excess solvent was evaporated at 80ºC for 30 minutes.
Stock culture of bacteria; E. coli and S. aureus were cultured in NB culture medium at 37±1 °C for 18-24 h.
Then the concentration of cells was adjusted to 0.5 McFarland standard which equivalent to about 1.5 × 108
CFU /mL Approx.

Agar disc diffusion test and Agar well test were used for determining the efficacy of herbal extracts
to inhibit the growth of pathogenic bacteria. Then measure the diameter of the inhibition zone (cm.) was
reported. Streptomycin 0.5% (v/v) was used as a positive control.

Results, Discussion and Conclusion
From the results, it was found that none of the herbs that used D.I. water as a solvent show any

inhibition zone. White basil extract had an inhibitory effect on the growth of both strains of bacteria. For the
Agar disc diffusion test, acetone was the most suitable solvent. The diameter of an inhibition zone against
E. coli and S. aureus is 0 . 8 2 cm. and 0 . 9 2 cm., respectively. For the Agar well test, ether showed the best
result at the concentration of 150µl. The diameter of an inhibition zone against E. coli and S. aureus is 1 . 3 8
cm. and 1.20 cm., respectively.

The extract of ginger was able to inhibit S. aureus better than E. coli. Agar well test of Ginger extract
(150 µl) with ethanol, ether and acetone showed activity against S. aureus by inhibition zones of 1.10 cm.,
0.80 cm. and 2.05 cm. respectively. Moreover, the crude extract inhibited E.coli by inhibition zones of 1.05
cm., 0.30 cm. and 1.35 cm. respectively. For Agar disc diffusion test, the best solvent was acetone. The
diameter of the inhibition zone against E. coli is 1.35 cm. and against S. aureus is 1.90 cm.

Andrographis paniculata have the ability to inhibit the growth of bacteria in both species. Result of
both the Agar disc diffusion test and the Agar well test showed that acetone is the best solvent with the
inhibition zone against E. coli by 1.19 cm. and S. aureus by 1.14 cm., respectively. For the Agar disc diffusion
test and Agar well test, at 100µl volume, showed activity against E. coli and S. aureus with the inhibition zone
of 1.10 cm and 1.38 cm., respectively.

Acknowledgement
This project would not have been possible without Asst. Prof. Dr. Aree Innun, project advisor, from

the Department of Microbiology, Faculty of Liberal Arts and Science for providing knowledge, guidelines,
advice and support in the preparation of this project, making this project successful. I’d also like to express

OB3_10_04/3

206

12th SCiUS Forum

my gratitude to both Asst. Prof. Dr. Weeranut Kaewwiset Department of Physics, Faculty of Liberal Arts and
Science and Dr. Tipawan Rungsawang Department of Chemistry, Faculty of Liberal Arts and Science who
manage the project to have a standard format and also help to coordinate the project to be completed in time.
The project was supported by Science Classroom in University Affiliated School (SCiUS). The funding of
SCiUS is provided by the Ministry of Higher Education, Science, Research, and Innovation. Finally, I would
like to thank our parents who provides assistance. All of the above-mentioned persons are indispensable in
this project. This extended abstract is not for citation.

References
1. Nisarat Siriwatanametanon, Wanwisa Dodgson and Jolyon L.A. Dodgson. (2017). Investigation of

Antimicrobial Activity of 13 Thai Medicinal Plants against Bacteria and Fungi. 11(3), 1351-1356
DOI: http://dx.doi.org/10.22207/JPAM.11.3.15.
2. Nararat Akarchariya, Sasithorn Sirilun, Jakaphun Julsrigival and Sunee Chansakaowa. (2017).
Chemical profiling and antimicrobial activity of essential oil from Curcuma aeruginosa Roxb.,
Curcuma glans K. Larsen & J. Mood and Curcuma cf. xanthorrhiza Roxb. collected in Thailand, Asian
Pacific Journal of Tropical Biomedicine. 7(10), 881-885.

3. Sa-Ngiamsuntorn K, Suksatu A, Pewkliang Y, Thongsri P, Kanjanasirirat P, Manopwisedjaroen

S, Charoensutthivarakul S, Wongtrakoongate P, Pitiporn S, Chaopreecha J, Kongsomros S,

Jearawuttanakul K, Wannalo W, Khemawoot P, Chutipongtanate S, Borwornpinyo S,

Thitithanyanont A and Hongeng S. (2021). Anti- SARS-CoV-2 Activity of Andrographis

paniculata Extract and Its Major Component Andrographolide in Human Lung Epithelial

Cells and Cytotoxicity Evaluation in Major Organ Cell Representatives. J Nat Prod.

84(4), 1261-1270.

4. Singletary Keith. (2010). Ginger (An Overview of Health Benefits). Nutrition Today. 4 5 ( 4 ) , 171-
183.

5. มหาวิทยาลัยมหิดลคณะแพทยศาสตร์โรงพยาบาลรามาธิบดี . (ม.ป.ป). สรรพคุณ ฟ้าทะลายโจร. ค้นเม่ือ 27 สิงหาคม 2564, จาก

https://med.mahidol.ac.th/altern_med/th/km/19jun2020-1729.
6. ดิสไทย . ( ม . ป. ป. ) . กะ เ พ รา ประ โ ย ชน์ ดีๆ สรรพ คุณเ ด่ นๆ แ ละ ข้ อมูลงานวิจัย . ค้นเมื่อ 2 9 สิ ง หาค ม 2 5 6 4 , จ าก

https://www.disthai.com/16963298/กะเพรา.

OB3_10_04/4
207

12th SCiUS Forum

Title: Analysis of chemical compositions and antioxidant OB3_01_02
Field:
Authors: activity in the extracts of curly kale crops harvested at different time

School: Biology
Advisor:
Ms. Jiratthaya Phoomphant

Ms. Thanisara Thongthong

Ms. Nutravee Chullanan

Chiang Mai University Demonstration School Chiang Mai University

Dr. Pimpisid Koonyosying, Department of Biochemistry, Chiang Mai University

Prof. Dr. Somdet Srichairatanakool, Department of Biochemistry, Chiang Mai University

Ph.D. Narisara Paradee, Chiang Mai University

Ms. Pornpailin Suwanpitak, Chiang Mai University Demonstration School

Abstract

Kale or Curly kale (Brassica oleracea var. sabellica), is an agricultural product that can be grown all
year round and the normal harvest time is 45 days. Kale’s leaves contain chlorophyll, glucosinolate, vitamins,
minerals, and phytochemical compounds which benefit health. Due to the physiological changes during plant
growth, level of constituents in different parts of plant, biochemical markers, and pharmaceutical effect would
be also change. In this study, we aim to explored the main chemical compositions and antioxidant activity of
curly kale stems and leaves at different harvest age. The stems and leaves of fresh kale at different harvest age
(15, 30, 45, and 60 days) were dried in a hot air oven, crushed and extracted by either hot water or 70% ethanol.
Then, the extracts were dried under vacuum and measured the level of phenolic compounds, flavonoids and
anthocyanins content using colorimetric methods. The antioxidant activity was performed by ABTS assay.
The results were found that total flavonoid content was highly present in hot water extract of the 15-day-old
leaves and stems sample. Meanwhile, both hot water and ethanol extract of 45 days kale leaves obviously
showed a high level of flavonoids, total phenolic content, anthocyanin, and antioxidant activity. However, the
total amount of the studied substances and antioxidant activity of kale at different harvest age were powerfully
gain from the leaves rather than the stems. It can be concluded that the harvest age affects phytochemical
active compounds level and antioxidant capacity of curly kale. This study would be a guideline for increasing
the value of curly kale by choosing the appropriated harvest time, then developing the supplement foods.

Keywords : curly kale, harvest age, harvest time, phytochemical compounds, antioxidant

Introduction
Curly kale (Brassica oleracea var. sabellica) is a vegetable in the family Brassicaceae, same as kale,

cabbage, broccoli and cauliflower. It has many common names including Kale, Curl Leaf Kale, and Leaf

OB3_01_02/1
208

12th SCiUS Forum

cabbage. There are many kinds of curly kale, which have the characteristics of different look, such as green
slender leaves, wavy green or purple leaves, smooth or wavy leaf margins, stems are purple or green, etc. In
addition, curly kale is also recognized as a superfood that highly contains nutritious and versatile compared to
the same amount of other vegetables. Although kale is popular in foreign countries, it is not much popular in
Thailand which causes high amount of waste in our country lead to lower value of kale and decreasing of
famer income.

Determination of chemical compounds in vegetables is an important way to increase the value of
vegetables. Therefore, it can be hypothesized that kale would produce the maximum level of phytochemical
active compounds at certain time and consequently present high antioxidant activity. In this study, the content
of some chemical compounds from curly kale during different harvesting periods will be determined as a
guideline to continue to increase the value of curly leaf kale.

Methodology
Part 1: Extraction

First, fresh curly kale was weighted. The stems and leaves were separated and weight each part again.
Then, the stems and leaves were put in a hot air oven 50 degrees Celsius for 24 hours. Dried stems and leaves
were crushed and extracted by either hot water or 70% ethanol.
Part 2: Lyophilization

The hot water and ethanol extracts from both parts of curly kale were frozen in freezer and
lyophilized. Powder of the extracts was kept in dry place to maintain the quality of the chemical compounds.
Part 3: Biochemical analysis

3.1 Total phenolic compounds determination by Folin-Ciocalteu method (TPC).
In analysis, 300 µl of Distilled water (blank), gallic acid (GA) solution (positive control) and kale
extract (unknown) was pipette in to test tube. Folin-Ciocalteu solution 1.5 ml was added and mixed well. Then
100 µL of Na2CO3 was added and mixed well. Set it aside in the dark at room temperature for 30 min and
measured the absorbance at a wavelength of 734 nm. TPC values are compared to GA standard curve and the
TPC values are displayed as gallic acid equivalent (GAE).
3.2 Total flavonoid content (TFC) determination by aluminum chloride method.
Kale extract (unknown) and standardized quercetin (Q) (positive control) were performed by
aluminum chloride method. TFC concentrations were compared in samples from standard Q curves and the
TFC values were shown as quercetin equivalent (QE).
3.3 Anthocyanin content determination by potassium chloride method.
Kale extract was diluted with 25 mM potassium chloride solution (pH 1.0) and 0.4 M acetate buffer
(pH 4.5), set a side at room temperature for 20 mins. After that, the reaction was measured absorbance at
wavelengths of 520 and 700 nm using spectrophotometer. The anthocyanin content was then compared with
the cyanidin-3-glucoside standard graph and represent in milligram equivalent of cyanidin per g extract.
3.4 Measure the antioxidant activity by the Trolox-equivalent antioxidant capacity (TEAC) method.
In assay DI, standard Trolox (25-500 µg/mL) and kale extract (10 µL) were incubated with ABTS
cationic radical (ABTS+•) (0.99 mL) at room temperature for 6 min and measured OD at 734 nm. Antioxidant

OB3_01_02/2

209

12th SCiUS Forum

activity was determined from a standard curve of Trolox (6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic
acid) and expressed as mg Trolox equivalent (TE).

Results
Total phenolic compounds (TPC) determination

The water extracts from curly kale leave at 15, 30, 45 and 60 days contained total phenolic content
of 7.05, 3.39, 7.67, and 6.74 mg GAE/g extract, respectively. the 70% ethanol leaf extract from 15, 30, 45and
60 days kale showed total phenolic content of 5.66, 5.69, 5.89, and 5.65 mg GAE/g extract, respectively. Hot
water kale leaves extract which harvest at 15, 45, and 60 days presented TPC level higher than 70% ethanol
extraction (figure 1A). In addition, both water and 70% ethanol kale stems extraction contain TPC which is
less than the leaf extraction (figure 1B).

AB

Figure 1: Total phenolic compounds of hot water and 70% ethanol extract. A) Kale leaves B) Kale stems

Total flavonoid content (TFC) measurement
The water extracts of kale leaves from 15, 30, 45, and 60 days contained total flavonoids of 1.86,

0.43, 1.28, and 1.38 mg QE/g extract, respectively, and the leaves extracted with 70% ethanol from samples
at 15, 30, 45 and 60 days contained total flavonoids 1.19, 0.86, 1.39 and 1.67 mg QE/g extract, respectively.
The water extracts of leaves from 15 days showed the highest TFC level and the water-extracted leaves planted
at 15, 45 and 60 days showed more flavonoid content than 70% ethanol-extracted samples (Figure 2A).
However, the stem extraction showed less flavonoid content than the leaf extraction from both solvents
extraction (Figure 2B).

AB

Figure 2: Total flavonoids content of hot water and 70% ethanol extract. A) Kale leaves B) Kale stems

Anthocyanin content determination
It was found that water extracts of curly kale leaves at 45-day old showed the highest anthocyanin

content at 113.08 ug/g extract. Followed by samples at 60, 15 and 30 days showed anthocyanins of 77.21,
33.75, and 15.01 ug/gextract, respectively. As same as 70% ethanol extract of the 45-day sample showed
111.87 ug/g extract, followed by the 60, 30, and 15-day samples found 83.9, 32.63, 23.69 ug/g extract of
anthocyanin, respectively (Figure 3A). Moreover, Figure 3B showed that the stem extraction contained less
anthocyanin content than the leaf extraction from both water and ethanol 70% extraction.

OB3_01_02/3
210

12th SCiUS Forum

AB

Figure 3: Total anthocyanins content of hot water and 70% ethanol extract. A) Kale leaves B) Kale stems

The antioxidant activity measurement
The study of antioxidant activity in curly leaf kale found that the leaves at 45 days extracted with

water had the highest antioxidant activity which was 8.00 mg TE/g extract (figure 4A). The water extraction of
kale leaves at 15, 60, and 30 days old samples showed the activity about 6.22, 5.62, and 1.46 mg TE/g extract,
respectively. The water and ethanol extract of 15, 30, 45, 60 days stem samples showed less antioxidant activity
than the leaf samples (figure 4A).

AB

Figure 4: Antioxidant capacity of hot water and 70% ethanol extract. A) Kale leaves B) Kale stems

Conclusion
The total amount of the studied substance was found from the leaf rather than the stem. It would be

an influence of size because kale has large leaves and small stem which can be accumulate food or nutrients.
The harvest age and time affects phytochemical active compounds level and antioxidant capacity of curly kale.
The kale at 15 days may not have as much nutrient accumulation. The 45 days old curly kale was shown the
high content of phytochemical active compounds and powerful antioxidant capacity. Meanwhile, curly kale at
60 days may affect by cellular degradation due to aging which cause low chemical compounds when compared
to 45 days of age. Therefore, the appropriated harvest time is very important to sustain the composition of
phytochemical active compounds and pharmaceutical effect of plant especially curly kale. This study would
be a guideline for increasing the value of curly kale by choosing the appropriated harvest time, then developing
the supplement foods consequently gain income for kale farmers.

Acknowledgements
This project was supported by Science Classroom in University Affiliated School (SCiUS). The

funding of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This
extended abstract is not for citation.

References
Li Xiaonan, Pang Wenxing, Piao Zhongyun. Omics Meets Phytonutrients in Vegetable Brassicas: For
Nutritional Quality Breeding. Horticultural Plant Journal, Elsevier; 2017

OB3_01_02/4
211

12th SCiUS Forum

Oral presentation
Biology and Biodiversity Group 3

Sunday August 28, 2022

No. Code Title Author School
PSU Wittayanusorn
1 OB3_17_05 Natural Rubber Serum Miss Natchaporn Saejew Surat Thani School

Fertilizer (NRSF) incubation Miss Nutcha Chiratthitichote Mahasarakham
University
by probiotic bacteria for use Demonstration School
(Secondary)
as a plant growth promoting
Naresuan University
substances Secondary Demonstration
School
2 OB3_07_01 Robusta extracts from the Miss Buntarik Kayaphad
Lukhamhanwarin
roasted coffee bean and cold Miss Jullada Phuwadonphadang chamrab School

brew extraction: Phenolic Miss Chanokporn Utarmat Demonstration School
of Khon Kaen
compounds and bacteriostatic University

effect on oral Streptococci Paphayomphittayakom
School
3 OB3_03_01 Production of xylanase and Miss Phitchaya Yingtrakoon

cellulase from the Miss Yada Ketiam

fermentation of marijuana

roots by lactic acid bacteria

4 OB3_08_02 ANTIMICROBIAL Mr. Pongsakorn Chaiyasit

EFFECTS OF RICE Mr. Pasin Nilthanapakorn

EXTRACT ON ACNE Mr. Chutiwat Pattanajak

CAUSING BACTERIA

CUTIBACTERIUM ACNES

5 OB3_05_01 The study of amylose Miss Nannapas Tuaykom

content in rice flour mixed Miss Wilasinee Kittisaktrakul

with carboxymethyl

cellulose as a coating

material on the prollongation

of egg

6 OB3_14_01 Multiplex PCR detection of Miss Suphitsara Nunainam

disease resistance genes in Mr. Kornrawit Khoonthongchan

rice

212

12th SCiUS Forum

Title : Natural Rubber Serum Fertilizer (NRSF) incubation OB3_17_05
Field :
Author : by probiotic bacteria for use as a plant growth promoting substances

School : Biology and Biodiversity
Advisor :
Miss Nutcha Chiratthitichote

Miss Natchaporn Saejew

PSU.Wittayanusorn Surat Thani School, Prince of Songkla University, Surat Thani Campus

Asst. Prof. Dr.Patima Permpoonpattana, Assoc. Prof. Dr.Charoen Nakason,

Asst. Prof. Dr.Skulrat Pichaiyut, Asst. Prof. Dr.Theera Srisawat

(Prince of Songkla University, Surat Thani Campus)

Miss Sitanun Yuwalaksanakun, Dr.Krisna Sasdipan (PSU.Wittayanusorn Surat Thani School)

Abstract

Natural rubber serum is a product of the creaming method. The creaming method is a chemical process
that separates natural rubber serum and rubber fraction. Natural rubber serum is discarded as waste effluent in
the rubber industry. However, the previous research showed that the serum contains nutrients that are necessary
for the growth of bacteria and plants such as nitrogen, phosphorus, and more than 80 different types of proteins,
etc. Thus, the purpose of this study was to investigate the efficiency of incubating natural rubber serum with
Bacillus sp. for use as plant growth-promoting substances. Natural rubber serum produced from the creaming
method was incubated with Bacillus aryabhattai (CKNJh11) at 37 °C for 7, 14, 21, and 30 days. Then, water
convolvulus (Ipomoea aquatica Forsk. Var. reptan) was treated with serum and B. aryabhattai (CKNJh11) and
Natural Rubber Serum Fertilizer (NRSF) without bacteria. Non-fertilizer was used as negative control and
chemical fertilizer with a 25-7-7 formula was used as a positive control. The result showed that B. aryabhattai
(CKNJh11) in NRSF was increased by 2.5 x 106 CFU/ml for 7 to 14 days and bacterial culture was decreased
after 21 to 30 days of incubation. The growth rate of water convolvulus treated with serum and B. aryabhattai
(CKNJh11) for 14 days showed the best growth rate. The average height of the plant was 36.38±1.97, the
average number of leaves was 11.11±2.34, the average length of root was 32.02±2.60, and the average of
circumference was 2.80±0.26. NRSF without bacteria group, the growth rate of water convolvulus was the least
with an average height of plant was 21.98±7.26, an average number of leaves was 6.44±1.07, and an average
length of root was 18.46±5.72.

Keywords: Natural rubber serum, Probiotic bacteria, Bacillus aryabhattai, Ipomoea aquatica Forsk. Var. reptan
OB3_17_05/1

213

12th SCiUS Forum

Introduction

In the Southern part of Thailand, it is a significant crop-growing area for several economic crops,
particularly natural rubber. The product from rubber tree tapping is fresh latex. Fresh latex was separated into
layers by the creaming method. The layers were divided into two parts (rubber fraction and serum). Natural
rubber serum is a waste in the rubber industry. However, the serum contains a lot of nutrients that are necessary
for the growth of bacteria and plants. Probiotics are also beneficial bacteria for plants, such as plant growth
promotion and nutrient addition, etc. Water convolvulus (Ipomoea aquatica Forsk. Var. reptan) is a tropical
plant grown as a leaf vegetable. It is a vegetable that produced and consumed in Thailand. Moreover, it is a fast-
growing vegetable and also nutrient-rich vegetable. Thus, Water convolvulus was used in this study.

Methodology

The experiments were divided into three parts as follows:

Experiment 1: Preparation of natural rubber serum
1.1 Take 30 kg of fresh latex.
1.2 Add 300 g of hydroxyethyl cellulose.
1.3 Stir it for 15-30 min, and leave it for 24-48 hours.
Figure 1: Ipomoea aquatica Forsk. Var. reptan plot

Experiment 2: Bacterial preparation and incubation of natural rubber serum with probiotic bacteria
2.1 Bacillus aryabhattai (CKNJh11) was isolated by streak-plate technique and incubated at 37°C for 24 h.
2.2 The natural rubber serum was treated with 106 CFU/ml of B. aryabhattai (CKNJh11) and incubated at

37°C for 7, 14, 21, and 30 days. Bacterial counts in natural rubber serum were observed at 7, 14, 21, and 30 days

Experiment 3: Efficacy evaluation of bio-fertilizer on sample plant
There were seven treatments, including natural rubber serum, natural rubber serum incubated with probiotic

bacteria for 7, 14, 21, and 30 days, 25-7-7 chemical fertilizer (positive control), and non-fertilizer (negative
control). Each treatment comprises three pots or three repetitions and in each pot are planted three rows of the
water convolvulus. As shown in Figure 1.

3.1 The water convolvulus was fertilized at 7 and 14 days old with the NRSF without bacteria and NRSF
that has been incubated with bacteria for 7, 14, 21, and 30 days at a dosage of 200 ml per pot of each treatment,
and a positive control gave chemical fertilizer 25-7-7 formula at the amount of 0.3 g per pot, while a negative
control does not provide any fertilizer.

3.2 Record the data by measuring the growth rate, the height of the water convolvulus, and the number of
leaves every 2 days. After harvesting, measured circumference, plant height, root length, and fresh and dry
weight.

3.3 Data analysis by Analysis of Variance (ANOVA)

OB3_17_05/2

214

12th SCiUS Forum

Results

Experiment 1: Preparation of natural rubber serum

Natural rubber serum was sent for analysis of macronutrients. The result showed that it contained total
Nitrogen, Total P2O5, and Total K2O as shown in Table 1.

Experiment 2: Bacterial preparation and incubation of natural rubber serum with bacteria

After natural rubber serum was incubated with B. aryabhattai (CKNJh11), the growth rate of the bacteria
was increased by 2.5 x 106 CFU/ml for 7 to 14 days and bacterial culture was decreased after 21 to 30 days of

incubation as shown in Table 2. Table 1: Analysis of macronutrients

After nutrient analysis of NRSF incubated with

bacteria for 7, 14, 21, and 30 days, it was discovered

that it contained total Nitrogen, Total P2O5, and Total

K2O as shown in Table 1.

Experiment 3: Efficacy evaluation of bio-fertilizer on

sample plant

The average height of water convolvulus treated

with serum and B. aryabhattai (CKNJh11) for Table 2: Counting of bacterial colonies
14 days showed the best height that was

36.68±1.97 and NRSF without bacteria group
showed the least height that was 21.98±7.26 as

shown in Figure 2.

The average number of water convolvulus leaves treated with serum and B. aryabhattai (CKNJh11) for 14

days showed the most average number of leaves that was 11.11±2.34 and NRSF without bacteria group showed
the least average number of leaves that was 6.44±1.07 as shown in Figure 3.

The average root length of water convolvulus treated with serum and B. aryabhattai (CKNJh11) for 14 days

showed the most average length of root that was 32.02±2.60 and NRSF without bacteria group showed the least

average length of root that was 18.46±5.72 as shown in Figure 4.

Average height of plant Average number of leaves

Figure 2: Average height of plant Figure 3: Average number of leaves

OB3_17_05/3
215

Average length of root 12th SCiUS Forum
Average of circumference

Figure 4: Average length of root Figure 5: Average of circumference

The average circumference of water convolvulus treated
with serum and B. aryabhattai (CKNJh11) for 14 days showed

the most average circumference that was 2.80±0.26 and

non-fertilizer (negative control) showed the least average

circumference that was 1.30±0.20 as shown in Figure 5.

Total fresh weight, plant fresh weight, root fresh weight,

average fresh weight per plant, total dry weight, plant dry Figure 5: Average of circumference

weight, and root dry weight of water convolvulus as shown in Figure 6: Ipomoea aquatica Forsk. Var.
Table 3. The treatment of NRSF incubated with bacteria for 14 reptan samples
days showed the highest weight.

Table 3: Weight of Ipomoea aquatica Forsk. Var. reptan

Conclusion
In this study, Natural rubber serum was incubated with probiotic bacteria for plant growth promotion. The

result showed that the natural rubber serum incubated with probiotic bacteria for 14 days showed the best growth
rate of water convolvulus. Therefore, it had the potential to be used as a bio-fertilizer for the reduction of
chemical fertilizer usage. In addition, this study can reduce waste occurrence in the rubber industry.

Acknowledgements
This project was supported by Science Classroom in University Affiliated School (SCiUS). The funding of

SCiUS is provided by the Ministry of Higher Education, Science, Research and Innovation. This extended
abstract is not for citation.

References
Mardina, V. and Yusof, F. Skim Latex Serum as an Alternative Nutrition for Microbial Growth. Springer Nature
Singapore Pte Ltd. 2018 179 A. Amid et al. (eds.), Multifaceted Protocol in Biotechnology. 2018;179-196.

OB3_17_05/4

216

12th SCiUS Forum

Title : Robusta extracts from the roasted coffee bean and OB3_07_01
cold brew extraction: Phenolic compounds and

bacteriostatic effect on oral Streptococci

Field : Biology and Biodiversity

Author : Ms. Jullada Phuwadonphadang

Ms. Chanokporn Ut-armat

Ms. Buntarik Kayaphad

School : Mahasarakham University Demonstration School (Secondary)

Advisor : Assoc. Prof. Dr. Woranan Nakbanpote, Faculty of Science, Mahasarakham University

Abstract
This research aims to study the effects of light roasting time and cold brewing of a Thai Robusta bean

on antibacterial activity against Streptococcus mutans (cariogenic bacteria) and Streptococcus salivarius (oral
commensal probiotic). Total phenolic content (TPC), total flavonoid content (TFC), free radical scavenging
activity (IC50), amounts of caffeic acid (CA), chlorogenic acid (CGA), trigonelline (TG), total sugar and
reducing sugar in the crude coffee extracts were investigated. Robusta (Coffea canephora) beans were
obtained from Laiwo Subdistrict, Kanchanaburi, Thailand. The green beans were roasted at 240°C for 2, 4, 6,
and 9 minutes. A ground roasted bean was packed in a filter bag, then extracted by soaking in water with a
1:10 ratio, at 4°C for 12 hours. The coffee extracts from the beans roasted for 2, 4, 6, and 9 minutes was
filtrated and freeze-dried. Their crude extracts were named GB, RB2, RB4, RB6 and RB9, respectively. The
colours of GB, RB2, RB4, RB6 and RB9 were hunter green, hunter green, avocado green, old gold and gold,
respectively. RB9 showed a decrease in total sugar, an increase in reducing sugar and a weakly acidic start.
The highest amounts of CA (45.67±2.68 mg/g crude extract) and TG (60.85±3.43 mg/g crude extract) were
found in RB9. The highest levels of CGA (131.96±2.84 mg/g crude extract), TPC (98.25±4.53 mg GAE/g
crude extract) and TFC (111.67±14.01 mg ECE/g crude extract) were reported for RB4. However, the
antioxidant activities of RB2, -4, -6, -9 were not significantly different. Minimum inhibitory concentrations
(MICs) against S. mutans of CA and TG were 1.9 and 3.8 mg/ml, respectively, and microbial bactericidal
concentrations (MBCs) against S. mutans of CA and TG were 2.4 and 4.3 mg/ml, respectively. MBCs against
S. salivarius of CA, TG and CGA were 1.2, 1.2 and 2.6 mg/ml, respectively. Due to the limited content of the
active compounds (CA, TG and CGA) and the presence of sugars in the crude extracts, the MICs of RB4, -6,
-9 must be up to 23.8 mg/ml. In summary, the crude extracts had small differences in the content of active
substances and bioactivities, but RB6 had a better odor and flavor, as well as antibiofilm activity.
Consequently, RB6 was chosen to make coffee caviar to be added as a topping in drinks.

Keywords : antibacterial; antibiofilm; cold brew; Robusta; Streptococcus

Introduction
Coffee is one of the most popular beverages among Thai people and most people in the world.

Robusta (Coffea canephora) is the major coffee crop grown in Thailand. Robusta can be grown from 200-
800 meters above sea level. Therefore, coffee planting at the junction of the plantation area with the forest is

OB3_07_01/1
217

12th SCiUS Forum

promoted as a line to prevent deforestation. The Sueb Nakhasathien Foundation has promoted the cultivation
of Robusta coffee at Laiwo Subdistrict. Sangkhlaburi District, Kanchanaburi with the goal of improving
coffee quality and preserving the western forest. The strength of Robusta coffee compared to Arabica
(Coffea arabica) is that it has 2-3 times more caffeine and lower sugar content. In addition to the intense
flavor of Robusta, the main substances in the coffee (caffeine, CA, CGA, and TG) also inhibit film
formation of S. mutans, which is an opportunistic cariogenic bacterium within biofilms, better than Arabica
[1]. However, S. salivarius, which is classified as a probiotic and normal flora in the oral cavity and does not
form biofilms, should be kept in balance for oral health [2]. The active ingredients in coffee beans vary by
species, environment of planting area (e.g. soil minerals, temperature and humidity), roasting method,
roasting temperature and time and extraction method. High-temperature roasting causes a Maillard reaction,
which creates a distinctive coffee flavor, but also degrades the active substances that have the antimicrobial
activity [3]. In addition, Cold brew has become very popular with Thai coffee lovers due to its softness,
mellow and still the value of natural phytochemicals.

Therefore, the objectives of this research are to study the effects of light roasting time and cold
brewing of a Thai Robusta bean on antibacterial activity against S. mutans and S. salivarius. Major
phytochemicals and antioxidant activity of the crude extracts from the roasted beans were investigated.
Finally, the crude coffee extract with good properties in terms of effect and good aroma was selected to
make a prototype of coffee caviar.

Methodology
Coffee extraction: Robasta (Coffea canephora) organic green bean was obtained from Lai-Wo

Subdistrict coffee producer community enterprise group, Nong Lu, Laiwo Subdistrict, Sangkha Buri Sub-
District, Kanchanaburi. The green beans were roasted by a household electric coffee roaster at 240°C for 2, 4,
6, and 9 minutes. Each roasted bean was ground and sieved through a 100-mesh sieve. Cold brew was carried
out by packing the ground coffee in a filter bag and soaking in water with a 1:10 ratio, at 4°C for 12 hours.
The extraction system was shaken hourly for the first three hours. Then, the extract was filtered through
Whatman filter paper no.4, before freeze-dried by a freeze dryer for 24 hours.

Chemical analysis: Total sugar and reducing sugar in the coffee extracts were analysed by the phenol-
sulfuric acid method and 3, 5-dinitrosalicylic acid (DNSA) method, respectively. Total phenolic content
(TPC), total flavonoid content (TFC) and antioxidant activity were carried out by the modified methods of
Folin-Ciocalteu method, aluminium chloride colorimetric method and DPPH (2,20’-diphenyl-1-
picrylhydrazyl radical) assay, respectively. High Performance Liquid Chromatography (HPLC), with diode
array detector (DAD) and C-18 reversed phase column was used for quantitative analysis of CA and CGA,
and C-8 reversed phase column was used for TG analysis.

Microbiological assay: S. mutan DMST 18777 was provided from Faculty of Pharmacy,
Mahasarakham University. S. salivarius BSS6 was isolated from the saliva of one of the researchers in this
team. The pure isolate was obtained from the quadrant steak method on selective media of blood ager
(Himedia, India) and mitis salivarius agar (Himedia, India). The bacterial identification was performed by 16S
rRNA gene sequence analysis. MIC and MBC were evaluated by resazurin-96-well plate microdilution
method. The bacterial suspension (106 CFU/ml) was separately inoculated in Mueller-Hinton broth spiked

OB3_07_01/2

218

12th SCiUS Forum

with various concentrations of the coffee extracts and chemical standards. Then, the viability of the bacteria
was checked by dropping of the bacterial suspension on the selective agar plate. The Biofilm susceptibility
assay was carried out with a biofilm formation assay, in which the bacterial inoculum (106 CFU/ml) was
cultured in Brain–heart infusion broth supplement with 2% (w/v) sucrose. Various concentrations of the coffee
extracts were spiked into the cultivation system. A biofilm formation was detected by staining with crystal
violet dye. The standard chemicals of CA, CGA and TG, which are substances contained in coffee, were used
as reference samples.

Coffee caviar preparation: A 2.5 g of the freeze-dried coffee extract and 0.75 g of sodium alginate
were dissolved in 50 ml of distilled water and stir gently until homogeneous. The mixture was dropped into
1% (w/v) calcium chloride, and left the caviar in the solution for 30 minutes to stabilize before rinse three
times with water.

Statistical analysis: The experiments were carried out in triplicate. The data were expressed as the
means and standard deviations (SD). The analysis was performed using SPSS statistical software (SPSS 14,
SPSS Inc., IL. USA). Analysis of variance (ANOVA) was significantly determined for difference between
means under Duncan’s new multiple range test (DMRT).

Results, Discussion and Conclusion
The colour of cold brew coffee obtained from green beans (GB) and the roasted beans for 2, 4, 6, and

9 minutes were hunter green, hunter green, avocado green, old gold and gold, respectively. The colour
indicated that RB2, RB4, RB6 and RB9 represented the roasting stages of drying phase, starting the Maillard
reaction, the middle phase and the first crack, respectively. The crude coffee extracted was obtained by the
freeze-drying process in order to protect thermal conversion. Table 1 show pH, total sugar, reducing sugar,
TPC, TFC and antioxidant activity in term of IC50, which is the concentration required to result in a 50%
antioxidant activity of DPPH (0.8 mM). The Maillard reaction accelerates caramelization in the first crack [3].
Therefore, RB9 clearly showed a decrease in total sugar, an increase in reducing sugar, and a weakly acidic
start (pH 6.8). The TPC and TFC of the crude coffee extracts differed slightly, but peaked at RB4. Compared
to GB, roasting increased the antioxidant effect. However, the antioxidant activities (IC50) of the crude extracts
were not significantly different.

Table 1 pH value, total sugar, reducing sugar, TPC, TFC and IC50 of the crude coffee extracts

Sample pH Total sugar Reducing sugar TPC TFC IC50

(mg/g crude extract) (mg/g crude extract) (mg GAE/g crude extract) (mg ECE/g crude extract) (mg crude extract/ml)

GB 7.62 988.53±35.30b 140.90±15.42bc 62.20±3.97c 72.30±8.07c 0.031±0.002a

RB2 7.40 932.70±25.34b 123.79±7.46cd 81.72±5.34b 98.14±8.93ab 0.020±0.002b

RB4 7.31 1096.65±86.95a 120.13±8.47d 98.25±4.53a 111.67±14.01a 0.024±0.005b

RB6 7.32 808.89±38.42c 145.10±6.26b 86.37±4.48b 108.06±11.46ab 0.020±0.002b

RB9 6.80 662.61±36.14d 241.32±8.33a 78.53±9.83b 90.02±4.73bc 0.019±0.003b

Table 2 indicates that CA and TG were the highest in RB9, and CGA was the highest in RB4. The
amounts of CA and TG in RB4, -6, -9 were not clearly different. Whereas, the increasing of roasting time from

OB3_07_01/3
219

12th SCiUS Forum

4 to 9 minutes resulted in the decreasing of CGA. MICs against S. mutans of CA and TG were 1.9 and 3.8
mg/ml, respectively, and MBCs against S. mutans of CA and TG were 2.4 and 4.3 mg/ml, respectively. MBCs
against S. salivarius of CA, TG and CGA were 1.2, 1.2 and 2.6 mg/ml, respectively. The antimicrobial results
indicated that S. salivarius, non-biofilm-forming streptococci, had lower resistance to the active compounds
in coffee than S. mutans [2]. Based on the MICs and MBCs of the standard compounds, Table 2 shows that
the MICs of coffee extracts to be as high as 23.8 mg/ml might be due to insufficient active compound content
in the extracts. In addition, the sugar contained in the coffee extracts could promote the growth of bacteria and
impair the activity of the active ingredient [1]. RB4, -6, -9, RB6 showed slight differences in the antioxidant
and antimicrobial properties. Therefore, RB6, which featured a distinctive aroma and flavor was selected for
biofilm susceptibility assay and prepare a coffee caviar prototype. The results showed that RB6 had a reduction
in biofilm formation of S. mutans.

Table 2 CGA, CA and TG in the crude extracts, and the amount of each substance contained in the MICs

Sample CGA CA TG The content in MIC (23.8 mg crude extract/ml)

(mg/g crude extract) (mg/g crude extract) (mg/g crude extract) CGA CA TG

GB 60.69±2.42d 38.28±0.61c 54.17±1.48c 1.45 0.91 1.29

RB2 120.51±3.78b 41.61±1.55b 55.02±1.36c 2.87 0.99 1.31

RB4 131.96±2.84a 42.71±0.71ab 55.60±1.93bc 3.14 1.02 1.32

RB6 122.14±3.95b 43.58±1.38ab 59.03±1.60ab 2.91 1.04 1.41

RB9 106.21±5.24c 45.67±2.68a 60.85±3.43a 2.53 1.09 1.45

The coffee caviar prepared from 5% (w/v) of RB6 in 1.5% calcium alginate was good properties in
appearance, color, aroma, texture, chewiness and gel strength. When left the caviar in the air for 2 hours, the
water will evaporate causing the size to shrink from 8 mm to 4 mm, but the gel still retains its spherical shape.
This suggests that caviar should be stored in high humidity or refrigerated. In addition, the coffee extract is
well immobilized in caviar and can be used as a topping in drinks for reduce biofilm formation by S. mutans.

Acknowledgements
The authors would like to thank Ms. Ruttanakorn Munjit for statistical analysis, and acknowledge

Faculty of Pharmacy, Mahasarakham University, for providing the S. mutans DMST 18777. This project was
supported by Science Classroom in University Affiliated School (SCiUS). The funding of SCiUS is provided
by Ministry of Higher Education, Science, Research and Innovation. This extended abstract is not for citation.

References
1. Antonio AG, Moraes RS, Perrone D, et al. Species, roasting degree and decaffeination influence the

antibacterial activity of coffee against Streptococcus mutans. Food Chemistry 2010; 118:782-788.
2. Baker JL., Edlund A. Exploiting the oral microbiome to prevent tooth decay: Has evolution already

provided the best tools? Frontiers in Microbiology 2019; 9: 3323.
3. Buffo RA, Cardelli-Freire C. Coffee flavor: an overview. Flavour and Fragrance Journal 2004; 19: 99-104.

OB3_07_01/4
220

12th SCiUS Forum

Title : Production of xylanase and cellulase from the OB3_03_01
fermentation of marijuana roots by lactic acid bacteria

Field : Biology and Biodiversity

Author : Miss.Phitchaya Yingtrakoon

Miss.Yada Ketiam

School : Naresuan University Secondary Demonstration School, Naresuan University

Advisor : Assoc. Prof. Dr. Sirilux Chaijamrus

Abstract
Marijuana is a biennial plant as the oldest known medicinal plants. The main medicinal substance

in marijuana is cannabinoids (CBD), also contains tetrahydrocannabinol (THC), which has a stimulating effect
on the nervous system. Both substances are mainly found in the inflorescences. The marijuana root has a
significant role in the absorption of nutrients, glowing the leaves and flowers. There are some compounds in
the root which are different from those in leaves and inflorescences were, for example, terpenoids and
flavonoids. According to those reasons, marijuana roots were fermented with synbiotics, which are two types
of Lactic Acid Bacteria, Bacillus subtilis and Lactobacillus sp., by solid-state fermentation. The different
sucrose concentrations (0%, 10% and 14%) which added to the fermentation of marijuana roots effects on the
bacteria growth rate and enzyme production. In addition, the fermented products were collected on 30-day and
45-day interval time of fermentation for xylanase and cellulase assays. The fermented products were dried
before ethanol extraction for bioactive compounds and analyzed by Liquid chromatography mass spectrometry
(LC-MS). The results describe that Bacillus subtilis and Lactobacillus sp. had the highest growth rate in solid-
state fermentation at 10% added sucrose and showed also the highest cellulase activity was at 10% sucrose
significantly (p≤0.05) after 30-day incubation. In addition, the chemical profiles of bioactive compounds were
found embelin which have treating inflammation properties and dipeptide that contains 2 types of amino acids,
isoleucine and threonine. The dipeptide can increase nutritional properties. Therefore, the fermentation of
marijuana roots was suitable production for feed additive.

Keywords : Marijuana roots, Solid-state fermentation, Xylanase, Cellulase, Feed additives

Introduction
From past to present, marijuana is one of the oldest known medicinal plants. Marijuana is described

in the ancient herbal medicine manual. Marijuana was widely used for industrial and medical purposes.
Marijuana is a biennial plant. There are small inflorescences along the branches and stems. The main substance
in marijuana is cannabinoids (CBD), which has more than 100, also contains tetrahydrocannabinol (THC),
which is mainly found in the tops of marijuana inflorescences. It is essential that has a stimulating effect on the
nervous system. The part of the inflorescence that contains a lot of CBD and THC will be sent to the Department
of Medicine for using. The rest from the cuttings, the leaves, stems and roots, can be sold. However, the root

OB3_03_01/1

221

12th SCiUS Forum

of marijuana has the same healing properties as the leaves or flowers and has a long history of healing. The
root of marijuana has a significant role in the absorption of nutrients, glowing the leaves and flowers. There
are some compounds in the root which are different from those in leaves and flowers, for example, containing
few cannabinoids. Furthermore, there are substances that are precursors before the cannabinoids. Therefore,
there is no sedative effect. Therefore, in this research aims to apply beneficial substances from the marijuana
root as a residue from inflorescence cutting, which are fermented with synbiotics, two types of lactic acid
bacteria, Bacillus sp. and Lactobacillus sp. Marijuana roots is used as a culture food source for Bacillus subtilis
KL-007 to produce xylanase and cellulase. The growth rates are measured by cell counting and their enzyme
activity was measured reducing sugar quantity by DNS method after reacting of enzymes and the specific
substrate. In addition, the kinetics of enzymes are determined during on the fermentation of marijuana roots.
The fermented marijuana root was evaluated as a feed additive in further.

Methodology
The experiments were divided int parts as follows,

Part 1: Solid-state fermentation. Marijuana roots were dried and milled. Then, marijuana roots were stored in
a desiccant cabinet. Bacillus sp. and Lactobacillus sp. were added 2 % intensity (w/w) to dry- weight marijuana,
mixed with 100 ml of 10 and 14 % (w/v) sucrose solution. The mixture was put into a 1.5 liters wide-mouth
jar, cover the lid, and place it in an incubator at 30°C for 45 days. The bacterial growth is measured every 0,
30 and 45 days by counting cells on a Counting chamber (Neubauer®) plate under a microscope.
Part 2: Enzyme assays.
2.1 Analysis of xylanase activity. First, add 0.5 ml of xylan dissolved in citrate buffer pH 5 concentrations of
0.1, 0.3, 0.6, 0.9, 1.2 % (w/v) to the micro tube. Then, incubate to adjust the substrate temperature at 50 °C for
2-3 minutes. After that, ad 0.5 ml of fermented solution sample and incubate at 50 °C for 15 min. Finally, the
amount of reducing sugar is measured by using the DNS method.
2.2 Turning to analysis of cellulase activity. Carboxymethyl cellulose (CMC) dissolved in phosphate buffer
pH 7 concentration 0.1, 0.3, 0.6, 0.9, 1.2 % (w/v) volume 0.5 ml was added to the micro tube. Then, incubate
to adjust the substrate temperature at 50 °C for 2-3 minutes. 0.5 ml of the fermented sample solution is added
and incubate at 50 °C for 30 min. The amount of reducing sugar is measured by using the DNS method.
2.3 Protein analysis, Protein quantity is analyzed by Lowry’s method (BSA std.). After that, absorbance was
measured at a wavelength of 750 nm by using distilled water for a blank.
2.4 Analysis of reducing sugar by Miller et al.’s 3, 5-dinitrosalicylic acid (DNS method)
2.5 Qualitative analysis of metabolites by LC-MS/MS
Part 3: Statistical data analysis by using Analysis of Variance (ANOVA). Moreover, the difference between
the mean was compared with the method which is Duncan's new Multiple Range Test (DMRT) at 95%
confidence intervals.

OB3_03_01/2

222

12th SCiUS Forum

Results

LABS growth

Table 1. Effect of different sucrose concentration on growth of B. subtilis and Lactobacillus sp.

Sucrose B. subtilis Lactobacillus sp.

(%) Growth rate (d-1) Doubling time (d) Growth rate (d-1) Doubling time (d)

0 0.28 2.47 0.036 19.52

10 1.29 0.54 0.72 0.96

14 0.89 0.78 0.011 65.63

10% sucrose is the most effective concentration on growth of B. subtilus and Lactobacillus sp. The
highest growth rate is at 10% sucrose. Furthermore, doubling time is less than others so It can increase the
amount of LABs than other concemtration.

Enzyme activity

A B

Figure 3 Enzyme activity of the fermented marijuana roots: (A) after 30 days incubation (B) after 45 days
incubation

Specific enzyme activity

Figure 4. Specific enzyme activity of the fermented marijuana roots: (A) after 30 days incubation (B) after 45
days incubation.
After 30 days incubation: only cellulase activity was significantly at p < 0.05. Furthermore, after 30-day and
45-day incubation: only specific cellulase activity were significantly at p < 0.01. The highest cellulase

OB3_03_01/3

223

12th SCiUS Forum

production is at 10% sucrose. On the other hand, The lowest specific cellulase activity at 10% sucrose. The
LABs produced various enzymes, thus specific cellulase activity was reduced.

Chemical profile of bioactive compounds
Figure 5. Chemical profile of bioactive compounds from the
fermented marijuana roots after 45-day incubation with different
sucrose concentration.
It can be concluded that the fermented with 10% sucrose occurred
higher embelin for treating inflammation than 14% sucrose. The
fermented with 14% sucrose occurred higher isoleucyl-threonine as
dipeptide than 10% sucrose.

Conclusion
In conclusion, the fermentation of marijuana roots by lactic acid bacteria, which were fermented

by Solid-state fermentation at 10% sucrose for 30 days, provides embelin and dipeptide. These conditions were
suitable for additive feed production.

Acknowledgements
This project was supported by Science Classroom in University Affiliated School (SCiUS). The

funding of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This
extended abstract is not for citation.

References

1. Eryvaldo , T. S., Acarília, d. E., Henrique , M. R., Monique, S. C., Elquio, O. E., & Toshiyuki, J. N.

(2012). Xylan, a Promising Hemicellulose for Pharmaceutical Use. Products and Applications of
Biopolymers,61-84.

2. Gaggìa Francesca , Paola Mattarelli, and Bruno Biavati. (2010) Probiotics and prebiotics in animal

feeding for safe food production. International Journal of Food Microbiology. Volume 141, 15-28.

3. Kang, T. W., A. T. Adesogan, S. C. Kim, and S. S. Lee. 2009. Effects of an esterase-producing

inoculant on fermentation, aerobic stability, and neutral detergent fiber digestibility of corn silage. J.
Dairy Sci. 92:732–738.

4. Nsereko, Victor L., Smiley, Brenda K., Rutherford, William M., and Spielbauer, Annette. (2008)

Influence of inoculating forage with lactic acid bacterial strains that produce ferulate esterase on
ensilage and ruminal degradation of fiber. Animal feed science and technology. 145:122-135.

5. Patindol J., Wang L., and Wang Y.J. (2007) Cellulase-assisted extraction of oligosaccharides from

defatted rice barn. Journal of Food Science. Vol.72: 516-521.

6. Sorokulova Iryna B., Pinchuk Iryna V., Muriel Denayrolles, Irina G. Osipova, Huang M., Simon M.

Cutting, Maria C. Urdaci. (2008) The Safety of Two Bacillus Probiotic Strains for Human. Dig Dis
Sci. 53:954–963.

OB3_03_01/4

224

12th SCiUS Forum

Title : Antimicrobial effects of rice extract on acne OB3_08_02
Field : causing bacteria Cutibacterium acnes
Biology and Biodiversity

Author : Mr. Pongsakorn Chaiyasit
Mr. Pasin Nilthanapakorn
Mr. Chutiwat Pattanajak

School : Lukhamhan Warinchamrab School, SCiUS Project–Ubon
Ratchathani University
Advisor : Asst.Proof.Kanchiyaphat Ariyachaokun (Ph.D.) (Ubon-Ratchathani University) and
Mr.Kampanart Chayajarus (Ph.D.) (Ubon Ratchathani University)

Abstract
Acne vulgaris is a chronic inflammatory disease of the pilosebaceous unit. A wide variety of treatment

regimens exist for acne vulgaris including antibiotic, chemical compound as well as hormonal and anti-androgen.
However, none of these methods is free of side effects and their exact role in therapy is not clear. Medicinal plants
have a long history of use and have been shown to possess low side effects. These plants are a reliable source for
preparation of new drugs. Rice is an important cereal crop for a large population in the world, especially in Thailand
which produces several traditional rice varieties. It is a source of many bioactive non-nutrient compounds known as
phytochemicals. Therefore, 4 rice (Oryza sativa L.) varieties from local cultivators, Thailand were studied for
antibacterial properties. In vitro efficacy of two organic solvent (hexane and methanol) extracts of rice seed were
tested against Cutibacterium acnes ATCC 6919, acne causing bacteria. The antimicrobial activity of the crude
extract was evaluated by detection of clear zone of inhibition using agar well diffusion assay. Hexane extract of
jasmine (Hom-Mali) and red jasmine (Hom-Mali dang) rice showed good antimicrobial activity against C. acnes.
Moreover, methanolic extract of red jasmine rice exhibited the best antimicrobial activity against the test bacteria.
The consequences of this investigation suggest that the rice extracts could be possible to use as the natural anti-acne
formulations, especially for the anti-acne causing bacteria application.

:Keywords acne, rice extract, antimicrobial activity and inhibition zone

Introduction

1.1 Pathogenesis of Acne Vulgaris
Acne is a chronic inflammatory skin disease that involves epidermis and pilosebaceous units [1].
The colonization of Cutibacterium acnes (formerly Propionibacterium acnes) is considered an important
factor throughout the whole development of acne. C. acnes is a Gram-positive aerotolerant anaerobic
bacteria found in the sebaceous follicle. The bacteria promote the abnormal proliferation and
differentiation of keratinocytes and increases sebum production [2]. C. acnes was first included in the
genus Bacillus as Bacillus acnes, and then in the genus Corynebacterium as Corynebacterium acnes
because of its morphology. Based on its ability to produce propionic acid via its anaerobic catabolism, it
was then assigned to the genus Propionibacterium, subsequently renamed Cutibacterium. C. acnes is
described as diphtheroid or coryneform because it is rod-shaped and slightly curved with a width of 0.4 to
0.7 μm and length of 3 to 5 μm. Anaerobic bacteria are characterized by their inability to grow on solid
media in the presence of atmospheric oxygen. However, C. acnes is considered an aerotolerant anaerobe
because it possesses enzymatic systems able to detoxify oxygen, allowing it to be sustained on the surface
of the skin [3].

1.2 Acne Treatment and Limitations
Topical antibiotics and/or chemical peeling agents can be used in the first-line treatment of acne vulgaris but should
not be used as monotherapy because of the rapid development of high rates of antibiotic resistance after weeks to
months [4]. Treatments can also include daily oral antibiotics, retinoids, or hormones. The most commonly used
oral therapies include the tetracyclines (tetracycline, minocycline, and doxycycline), trimethoprim/
sulfamethoxazole, and macrolides (erythromycin and azithromycin) [5]. A major disadvantage of current treatments
is that daily intake of antibiotics places great selective pressure on bacteria to develop multidrug resistance [6].
Many countries have reported increasing resistance of C. acnes strains to topical macrolides [7].

OB3_08_02
225

12th SCiUS Forum

In light of the growing concern for increasing antibiotic resistance of C. acnes due to antibiotic use in acne
treatment, alternative therapies are urgently needed.

1.3 Bioactive Compounds of Rice
Rice (Oryza sativa L.) consumes as a staple food for more than half of the world population, especially in Asia [8]
and also is one of the main economic plants in Thailand. Rice can be classified into 2 types by its color; non-
pigmented (white) rice and pigmented rice. There are diverse secondary metabolites produced in rice. They show
various kinds of biological activities, such as antimicrobial, antioxidant, cytotoxic, and anti-inflammatory
properties, which are implicated in various health-promoting and disease-preventive effects. Pigmented rice is
known as source of antioxidant compounds including flavonoid, anthocyanin, phytic acid, proanthocyanidin,
tocopherols, tocotrienols, γ-oryzanol, and phenolic compounds [9, 10]. There are many varieties of rice that
contained color pigments. The pigment of rice is located in the aleurone layer of rice grain and can be classified into
black, purple and red color by the kinds of pigment compounds such as anthocyanin and proanthocyanidin [11, 12].
Thus, the objective of this study was to determined antimicrobial effects of four Thai rice extracts including white
rice, red rice, purple rice and black glutinous rice against acne causing bacteria.

Methodology
2.1 Rice samples

Four varieties of rice were collected from the local cultivators at Warin chamrap district, Ubon Ratchathani,
Thailand including white rice (local name Hom-Mali), red rice (local name Hom-Mali Dang), purple rice (local
name Rice Berry), and black glutinous rice (local name Luem-Pua).

2.2 Preparation of rice extracts
The rice grains were extracted by maceration using organic solvents, namely hexane and methanol. The maceration
was carried out for 3 days at room temperature (30 ± 2 °C). The supernatant was filtered through filter paper
(Whatman® No.1). Then, supernatant was collected and subsequently evaporated under reduced pressure at 45 °C
until the weight remained unchanged. The extracts were kept at 4°C until use. The rice extracts were determined for
antimicrobial activities by agar diffusion.

2.3 Test organisms
Cutibacterium acnes strain ATCC 6919 was purchased from the American Type Culture Collection (ATCC). The
bacteria were then placed in 20% glycerol and stored at − 80 °C.

2.4 Confirmation of Test Bacteria
The test bacteria in the form of C. acnes strain ATCC 6919 was confirmed through microscopic using the
observation using Gram stain and through colony morphology on BHI agar.

2.5 Preparation of Standard Turbidity Solution (Solution Mc. Farland)
McFarland number 0.5 standard (approximately 1.0 × 108 CFU/ml) was prepared by mixing 9.95 ml 1% H2SO4 and
0.05 ml 1% BaCl2 in distilled water. Then shaken until a cloudy solution is formed. This turbidity can be used as a
standard for the turbidity of the test bacteria suspension. The preparation was stored in an air tight bottle and used
for comparison of bacterial suspension whenever required.

2.6 Preparation of Test Bacterial Suspension
Cutibacterium acnes bacteria that have been inoculated are taken with a sterile loop and then suspended into a tube
containing 10 ml of 0.9% NaCl solution until the turbidity is the same as the turbidity standard of Mc.Farland's
solution.

2.7 Antibiotic susceptibility test
Antibiotics susceptibility testing was performed using the disc diffusion method [13] for the following antibiotics;
Penicillin G (P 10 μg), Streptomycin (S 10 μg), Tetracycline (T 30 μg) and Methicillin (M 10 μg). C. acnes was
incubated in BHI agar for 72 h under anaerobic conditions and adjusted to yield approximately 1.0 × 108 CFU/ml by
direct colony suspension method. The bacterial inoculums were uniformly spread using the sterile cotton swab on a
BHI agar plate. Antibiotic disc was placed on the agar. Plates were then incubated at 37 ◦C for 72 h under anaerobic
conditions. The results were inferred according to the guidelines of the Clinical and Laboratory Standards Institute
(CLSI) [14].

2.8 Assay for antibacterial activity
The initial screening of the extracts for antibacterial activities was conducted by the Agar well diffusion method
[15]. The dried extracts were dissolved in dimethyl sulfoxide (DMSO) with a concentration of 100 mg/mL. C. acnes
was incubated in brain heart infusion (BHI) agar at 37 ◦C for 72 h under anaerobic conditions and adjusted to yield
approximately 1.0 × 108 CFU/ml by direct colony suspension method. A prepared inoculum was added to BHI agar
(melted at 45 oC), mixed and poured on sterile Petri dishes (90 mm in diameter) and left to solidity. A sterile Cork
borer was used to punch holes with a diameter of 6 mm and 20 μL of the stock solution of the extract (100 mg/mL)
was introduced into the well. DMSO was used as a negative control. The inoculated agar plates were incubated at
37 oC for 48 h under anaerobic conditions. Diameters of the inhibition zones were measured as (mm). Each assay
was performed in triplicate and repeated three times.

OB3_08_02

226

12th SCiUS Forum

Results
3.1 Morphology of test bacteria
C. acnes strain ATCC 6919 was confirmed by grow on BHI agar. These colonies were selected for microscopy and
stained using the Gram staining technique. C. acnes are Gram positive rods (Figure 1A) and formation of small
white colonies (Figure 1B).

Figure 1. Morphology of C. acnes. (A) C. acnes under the light
microscope magnified 1000x, cells occur singly or in pairs and
arranged in Chinese letters. (B) Pure culture of C. acnes on BHI agar.

3.2 Antibacterial activities of rice extracts
The results of the screening activity of rice extracts showed antibacterial activity against C. acnes by agar diffusion
method. It was found that the methanolic extract of Hom-Mali Dang showed the strongest inhibitory effect against
C. acnes, followed by hexane extract and hexane extract of Hom-Mali with the diameters of inhibition zone of
15.50±(0.50), 10.50±(0.05) and 9.10±(0.20) mm, respectively. In addition, the control well (DMSO, hexane and
methanol) exhibited no zone of inhibition for tested bacteria. The diameters of the inhibition zones obtained using
all the rice extracts are shown in Figures 2 and summarized in Table 1.

Diameter of Inhibition

No. Rice Zone (Mean ± SD) (mm)
varieties Hexane Methanolic

extracts extracts

1 Hom-Mali 9.10±(0.20) 0.00±(0.00)

2 Luem-Pua 0.00±(0.00) 0.00±(0.00)

3 Mali Dang 10.50±(0.05) 15.50±(0.50)

4 Rice Berry 0.00±(0.00) 0.00±(0.00)

5 hexane 0.00±(0.00) 0.00±(0.00)

6 methanol 0.00±(0.00) 0.00±(0.00)

Figure 2. The inhibition zone (mm) of hexane (A) and C DMSO 0.00±(0.00) 0.00±(0.00)
methanolic extracts (B) of Hom-Mali (1), Luem-Pua
(2), Hom-Mali Dang (3), and Rice Berry (4) against Table 1. Anti-bacterial activities of rice extracts (100 mg/mL)
C. acnes, at concentration of 100 mg/mL, (C) against C. acnes by the agar diffusion method.
represent the negative control, DMSO, hexane (5)
for hexane extracts, and methanol for methanolic
extracts.

3.3 Antibiotic susceptibility testing

The antibiotic susceptibility testing using the disc diffusion method. It was found that C. acnes resistance to
penicillin G (10 μg) and streptomycin (10 μg) with the diameters of inhibition zone of 7.10±(0.70) and
13.50±(0.30) mm, respectively However, the bacteria susceptible to methicillin (10 μg) and tetracycline (30 μg) with

the diameters of inhibition zone of 18.05±(0.50) and 24.90±(0.50) mm, respectively. The diameters of the inhibition

zones obtained using all the antibiotics are shown in Figures 3 and summarized in Table 2.

No. Antibiotics Diameter of Inhibition
Zone (Mean ± SD) (mm)
1 Streptomycin
2 Methicillin 13.50±(0.30)
3 Penicillin G 18.05±(0.50)
4 Tetracycline 7.10±(0.70)
24.90±(0.50)

Figure 3. The inhibition zone (mm) of antibiotics against Table 2. Anti-bacterial activities of rice extracts
C. acnes, penicillin G (P, 10 μg), streptomycin by the agar diffusion method.
(S, 10 μg), tetracycline (T, 30μg) and methicillin
(M, 10 μg).

OB3_08_02

227

12th SCiUS Forum

3.4 Testing the anti-C. acnes activity of cosmetic products with anti-acne properties
To study the inhibition ability of C. acnes of 7 anti-acne cosmetic products available in the market in Thailand,
consisting of Skinoren containing acne inhibitor azelaic acid 0.2g/g. As an element, Benzac®AC5 contains 5%
benzoyl peroxide as its constituent. And various acne gels: Nivea acne care (salicylic acid), Mizumi peptide acne
gel (oligopeptide-10), Clear nose acne gel (salicylic acid), Baby bright (resin extract), and Smooto tomato aloe snail
white sleeping serum. These agents were tested using a disc diffusion method (Figure 4). No inhibitory zones were
found when all five acne gels were used, but it was found to inhibit with Benzac®AC5 (5% benzoyl peroxide) and
Skinoren. (azelaic acid 0.2g/g) with sizes of 20.05±(0.20) and 10.95±(0.50) mm, respectively (Table 3). The size is
larger compared to the skin that contains azelaic acid as an active ingredient.

Figure 4 Inhibition zone sizes generated by 7 cosmetic brands when
tested for C. acnes by disc diffusion method: (A) Skinloren, (B)
Benzac®AC5 and (C) Acne Gel: (1 ) Nivea acne care, (2) Mizumi
peptide acne gel, (3) Clear nose acne gel, (4) Baby bright and (5)
Smooto tomato aloe snail white sleeping serum.

Brands Inhabition Zone (Mean ± SD) (mm) Table 3 Sensitivity to
Skinoren 10.95±(0.50) commercially available
Benzac® AC5 20.05±(0.20) anti-acne cosmetic
Nivea acne care 00.00±(0.00) products for C. acnes
Mizumi peptide acne gel 00.00±(0.00)
Clear nose acne gel 00.00±(0.00)
Baby bright 00.00±(0.00)
Smooto tomato aloe snail white 00.00±(0.00)

Conclusion
In this study, the anti-acne bacterial properties of rice extracts were firstly screened by using the agar well

diffusion method. It was found that the methanolic extract of Hom-Mali Dang showed the strongest inhibitory effect
against C. acnes, followed by hexane extract and hexane extract of Hom-Mali with the diameters of inhibition zone
of 15.50±(0.50), 10.50±(0.05) and 9.10±(0.20) mm, respectively. Comparison of the antibacterial effect of rice
extracts with standard antibiotics revealed that the size of inhibition zone of methicillin and tetracycline against C.
acnes was larger than the rice extracts with the diameters of inhibition zone of 18.05±(0.50) and 24.90±(0.50) mm,
respectively. However, the methanolic extract of Hom-Mali Dang showed more powerful antibacterial activity
compared to penicillin G and streptomycin with the diameters of inhibition zone of 7.10±(0.70) and 13.50±(0.30)
mm, respectively. The experiment confirmed the efficacy of rice extracts as natural antimicrobials and suggested the
possibility of employing them in drugs for the treatment of acne causing bacteria.
Acknowledgements

This project was supported by Science Classroom in University Affiliated School (SCiUS) under

Ubon-Ratchathani University and Lukhamhan Warinchamrab School. The funding of SCiUS is provided by

Ministry of Higher Education, Science, Research and Innovation, which is highly appreciated. This extended

abstract is not for citation.

References
1. Williams, H.C., Dellavalle, R.P. & Garner, S. (2021). Acne vulgaris. Lancet, 379, 361–72.

2 . Pereira-Caro, G., Cros, G., Yokota, T. & Crozier, A. (2013). Phytochemical profiles of black, red, brown, and

white rice from the Camargue region of France. Journal of Agricultural and Food Chemistry, 61(33), 7976-7986.

3 . Bauer, A. W., Kirby, W. M. M., Sherris, J. C. & Turck, M. (1996). Antibiotic susceptibility testing by a

standardized single disk method. American Society of Clincal Pathogists, 36, 493-496.

OB3_08_02
228

12th SCiUS Forum

Title : The study of Amylose content in rice flour mixed with OB3_05_01

Field : carboxymethyl cellulose as a coating material
Authors : on the prollongation of egg
School : Biology and Biodiversity
Advisors :
Miss Nannapas Tuaykom

Miss Wilasinee Kittisaktrakul
Demonstration School of Khon Kaen University
Assoc. Prof. Dr. Patimakorn Pasuwan, Department of Food Technology, Faculty of

Technology, Khon Kaen University
Miss Chutika Srisawat , Demonstration School of Khon Kaen University

Abstract
All foods are prone to spoilage. Moisture, gas, and food contamination are all the potential spoiling

reasons. The surface of the egg shell is porous, which allows moisture and carbon dioxide to pass through,
causing the eggs to deteriorate. As a result, the aim of this research is to create the coating using low-cost
natural raw ingredients to extend the shellife of eggs. Hom Mali 105 flour (HML105) and Lueang Prathew 123
(LPT123) flour can be used to as a coating material. Finely 2% of 20 mesh crushed rice flour was mixed with
2% carboxymethyl cellulose (CMC) dissolved in water mixed with ethanol, and heated at 80°C for 10 minutes,
then cooled to 50°C, after that added 2% glycerol. Each egg was subjected into the solution and dried in the hot
air oven at 50°C for 15 min. The eggs were kept at 28±3°C for 5 weeks. The weight loss, Haugh Unit
measurement, albumen and yolk pH, and yolk index were measured during the storage time. The difference
between the two flour that we studied was their amylose content. The amylose content of HML105 and LPT123
were 9.19% and 19.77%, respectively. The percentage of weight loss of storage eggs coated with LPT123
cooperated with 2% CMC represented the lower value comparing to eggs coated with HML105 cooperated
with 2% CMC. Furthermore, the uncoated eggs were the poorest quality. As a result, extending the appearance
of eggs by coating them with an amylose-rich starch coating is a viable option.

Keywords : Haugh Unit measurement, egg, CMC, rice flour, yolk index, extend life

Introduction
Eggs are a source of proteins, lipids and and importance nutrients popular raw materials in many

food products on the market. When stored for a while, they would become rotten caused by microorganisms,
contamination and water and gases loss. Coatings are used to preserve the quality of eggs and extend the shelf
life of food. There are many kinds of coatings that are used in the industry and polysaccharide coating is one
of them. Carboxymethyl cellulose and flour both have viscous feature to keep water and gases from
evaporating from the eggshell.

OB3_05_01/1
229

12th SCiUS Forum

The viscosity of the starch occurs when the starch is heated to pasting temperature. Starch granules
become viscous and begin to absorb water and swell. When the viscosity increases to the point of maximum
viscosity called peak viscosity, amylose and amylopectin in starch granules will break out and cause lower
viscosity. Then the temperature decreases make the amylose molecules restructure and creates viscous again.
This procedure is called retrogradation.

This work has an objective to preserve the quality of eggs by using coatings from Hom Mali 105 rice
flour and Lueang Prathew 123 rice flour mixed with carboxymethyl cellulose and to determine the relationship
between amylose content in starch and the ability to extend egg life as Hom Mali 105 rice flour and Lueang
Prathew 123 rice flour has different amylose content so restructuring step in retrogradation process could be
different because the structure of amylose is easier for combination than amylopectin. Thus, different viscosity
results in different coating quality.

Methodology
Part 1 : The analysis of amylose content in H105 and LPT123 flour

1.1 Preparation of the test sample
We used Ultra Centrifugal Mill to blend LPT123 rice and HML105 rice into 20 mesh crushed rice flour.

1.2 Preparation of the test solution
Weigh 100 mg of the test sample. Carefully add 1 ml of 95% ethanol. Add 9.0 ml of 1 mol/l sodium

hydroxide solution and mix. Then heat the mixture on a boiling water bath for 10 min. Transfer to a 100 ml
volumetric flask.

1.3 Preparation of the blank solution
Prepare a blank solution using the same process and quantities of all reagents as in 1.2, but using 5.0 ml

of 0.09 mol/l sodium hydroxide solution instead of the test sample.
1.4 Preparation of the calibration graph

1.4.1 Preparation of the set of calibration solutions
Mix the potato amylose and amylopectin standard suspensions (use the procedure in 1.2, but use
amylose and amylopectin instead of the test sample) and the 0.09 mol/l sodium hydroxide solution according

to the table.

Table 1 : the ratio of the calibration solutions

amylose potato amylopectin 0.09M
mass amylose (ml) sodium
hydroxide
fraction (ml) 18
(%) 16 (ml)
0 14
0 2 13 2
10 4 12 2
5 11 2
20 6 2
25 7 2
2
30

35

OB3_05_01/2
230

12th SCiUS Forum

1.4.2 Color development and spectrophotometric measurements
Pipette a 5.0 ml of each calibration solution into a series of 100 ml volumetric flasks, each containing
about 50 ml of water. Add 1.0 ml of 1 M acetic acid and mix. Then add 2.0 ml of iodine solution, make up to
the mark with water and mix. Measure the absorbance at 720 nm using the spectrophotometer. Then use the
test solution instead of each calibration solution.
Part 2 : Preparation of the coating solution
Weigh 20 g of LPT123 test sample into a 2000 ml beaker glass. Add 818 ml of water, 200 ml of 95%
ethanol and 20 g of glycerol and mix. Then slowly add 2.0 g of CMC and heat the mixture to 75°C. Mix them
together. Allow to cool to 50°C. Then use HML105 test sample instead of LPT123 test sample.
Part 3 : Coating eggs
All eggs were washed in water heated to 40°C with vinegar (5 % acetic acid). Each clean egg were
then soaked in the coating solution for 15 sec at 50°C. After that, they were dried in the hot air oven at 50°C
for 15 min.
Part 4 : Examination of the egg quality
There were three types of eggs in the present study: eggs with no coating solution, eggs coated with
LPT123 solution, and eggs coated with HML105 solution. After storing the eggs at room temperature for 0, 7,
14, 21, 28, and 35 days, their quality was examined. Weight loss, Haugh Unit measurement, albumen and yolk
pH, and yolk index are the criterion.

Results
Since the eggshell is full of pores, it allows moisture to diffuse in and out of the eggshell which will

result in the loss of water in the egg. The cumulative weight loss of eggs at 5 weeks is shown in figure 1. Eggs
coated with LPT123 cooperated with CMC had the lowest weight loss. An egg’s weight tends to decrease
with longer periods of time. Uncoated eggs as control group had the greatest weight loss at 8.59%.

Haugh unit [HU] results are shown in figure 2. HU values decreased over the storage time. Crucial

factor which made HU values decreased was lower height of albumen caused by the exchange of gases and
other substances between the inside and outside of the egg leads to the deterioration of the protein in the egg.

10Weight loss (%) 90
8 Haugh unit 75
6 60
4 14 21 28 35 45 7 14 21 28 35
2 Storage time (days) 30 Storage time (days)
0 15

7 0

0

Control HML105 LPT123 Control HML105 LPT123

Figure 1 : Change in weight loss of uncoated and coated eggs Figure 2 : Change in haugh unit of uncoated and coated eggs

OB3_05_01/3
231

12th SCiUS Forum

Inside of the egg changes all the time, as it can be seen from the change in of pH of the yolk and
albumen. CO2 liberation through the pores is the main reason of the pH changing for both in yolk and albumen.
Figure 3 and 4 showed that as the eggs are kept for long periods of time, the pH of yolk and albumen increased.
After 5 weeks of storage, uncoated eggs had the highest pH value for both yolk and albumen at 6.93 and 9.23
respectively.

10Albunen pH 8
8 Yolk pH 6
6 4
4 7 14 21 28 35 2 7 14 21 28 35
2 Storage time (days) 0 Storage time (days)
0
0
0

Control HML105 LPT123 Control HML105 LPT123

Figure 3 : Change in albumen pH of uncoated eggs and coated eggs Figure 4 : Change in yolk pH of uncoated eggs and coated eggs

After 5 weeks of storage, yolk index decreased as water moves from albumen to the yolk. increase
the weight of the yolk. The yolk membrane is less flexible and may rupture. According to the experiment,
coated eggs had a higher yolk index than uncoated eggs at 5 weeks.

Conclusion
From the experiment, when considering the results of egg weight, haugh unit value, pH value and

Yolk Index value, it was found that the coating made from LPT123 rice cooperated with carboxymethyl
cellulose was most effective in extends the shelf of egg.

Acknowledgements
This project was supported by Science Classroom in University Affiliated School (SCiUS).

The funding of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation.
This extended abstract is not for citation.

References
1. da Silva Pires GP, Bavaresco C, da Silva Pires DP, Cardinal MK, Leuven FRA, Andretta I. Devrlopment of
an innovative green coating to reduce egg losses. Cleaner Engineering and Technology 2021;2:256-263.

2.Tedesco PM, dos Santos Garcia AV, Borges GJ, Osiro D, Vanin MF, Yoshida MPC, et al. Production of oral
films based on pre-gelatinized starch, CMC and HPMC for delivery of bioactive compounds extract from
acerola industrial waste. Industial Crops and Product 2021;170:125-139.

OB3_05_01/4
232

12th SCiUS Forum

Title : Multiplex PCR detection of disease resistance genes in rice OB3_14_01

Field : Biology and Biodiversity
Authors : Miss. Suphitsara Nunainam

Mr. Kornrawit Khoonthongchan
School : Phapayompittayakom School , Thaksin University
Advisor : Dr. Kedsirin Ruttajorn

Abstract
Rice diseases have severe outbreaks and damaged all major rice plantations in all parts of Thailand.

Bacterial leaf blight disease and blast disease are significant problems affecting the reduced yield. The use of
resistant varieties to prevent rice diseases is a good way. Bacterial leaf blight resistance genes have two major
resistance genes; Xa21, Xa13 blast resistance genes have three major resistance genes; Pi5, Pigm( t) and Pi9.
These resistance genes are typically detected using primers specific. We designed a single-tube multiplex PCR
assay for simultaneous detection of all the three genes; bacterial leaf blight resistance genes ( Xa21) blast
resistance genes (Pigm(t), Pi9) with the actin gene as the internal control. We have applied multiplex PCR to
detect resistance genes in 5 rice varieties. All rice varieties showed the actin gene. Hahng Yi 71, Nam Sa-gui
19 and Majanu from Phatthalung Rice Research Center contained the Xa21 resistant gene and RD55 from
Phatthalung Rice Research Center and Tambon Lampam contained the Xa21 susceptible gene. Hahng
Yi 71 and Nam Sa-gui 19 contained the Pi9 resistant gene and all varieties contained the Pigm(t) resistant gene
and Nam Sa-gui 19 contained the Pigm(t) heterozygous condition. These results suggest that multiplex PCR
with primer sets could detect disease resistance genes and improve the breeding program in rice.

Keywords : rice, resistant gene, multiplex PCR

Introduction
Currently, damage from rice diseases is considered one-factor affecting rice production for

consumption and export. Rice diseases have severe outbreaks and damaged all major cultivated areas in all
parts of Thailand. Bacterial leaf blight disease and blast disease affect reduced yield. Most farmers prefer to
solve outbreaks with chemicals because they work well. It is convenient and fast, but chemicals cause a lot of
negative consequences, such as toxic residues in soil and water in cultivated areas, as well as environmental
impacts, so using resistant rice varieties to prevent rice disease is an excellent way to do so.

This research aims to detect the bacterial leaf blight disease and blast disease resistance gene in one
reaction with the actin gene as internal. The Bacterial Leaf Blight disease resistance gene Xa21, Xa13 blast
disease resistance gene Pi5, Pi9 and Pigm(t) could be detected with PCR multiplex reactions. The rice varieties
from Phatthalung Rice Research Center and farmland were used to extract DNA and the detected resistant
genes with a multiplex PCR.

OB3_14_01/1
233

12th SCiUS Forum

Methodology
Plant material and DNA extraction
Five rice varieties, including Hahng Yi 71, Nam Sa-gui 19, RD55, Chiang Phatthalung and Majanu were
derived from the Rice Research Center of Phatthalung and Phattani. Furthermore, RD55, Chiang Phatthalung
and MaJanu varieties were derived from agricultural areas; Lampam, Khuan Khanun and Sai Thong,
respectively. A total eight samples were extracted DNA using CTAB method. DNA was analyzed by 1%
agarose gel electrophoresis and optical density was detected at 260 nm (OD260) and 280 nm (OD280) using a
spectrophotometer.
Optimization of multiplex reaction

Singleplex PCR was used to test the primer efficiency viz actin-specific primers actin (F-5'-TGACG
GAGCGTGGTTACTCA, R-5'-GAGGAGCTGGTCTTGGCAGT-3') [1], Pi5-specific primers 40N23r (F-TG
TGGAGGCAACAATGCCTATTGCG, R-CTATGAGTTCACTATGTGGAGGCT) [2], Pi9-specific primers
pB8 (F-CCCAATCTCCAATGACCCATAAC, R-CCGGACTAAGTACTGGCTTCGATA) [3], Pigm( t) -
specific primers S29742 (F-CAGTGAAACGAACGCTATG, R-AATAGGAAGGGTTGATGTTG) [3],
Xa21-specific primers pTA248 (F-AGACGCGGAAGGGTGGTTCCCGGA, R-AGACGCGGTAATCGAA
AGATGAAA) [4], Xa13-specific primers Xa13-prom (F-GGCCATGGCTCAGTGTTTAT, R-GAGCTCCA
GCTCTCCAAATG) [4]. The reaction consists of 10X PCR buffer 2.5 L, 10 mM dNTP 0.5 L, 10 mM
MgCl2 0.75 L, 10 M of each primer 0.5 uL, 5 unit Taq polymerase, DNA 100 ng/L 4 L and deionized
water up to 12.5 ul.

The amount of template DNA was used in different concentrations (10 ng, 50 ng, 200 ng and 600 ng)
in a multiplex PCR reaction. The reaction consists of 10X PCR buffer 2.5 L, 10 mM dNTP 0.5 L, 10 mM
MgCl2 0.75 L, 10 M 3 set Forward + Reverse primer 4 L, 10 M Reverse primer 0.5 L, 5 unit Taq
polymerase, DNA 100 ng/L 4 L and Deionized water 12.13 L. Multiplex PCR amplifications were
performed in a Thermal cycler programmed to perform at 94°C for 3 min, followed by 35 cycles of 94°C for
30 sec, 53°C for 30 sec and 72°C for 7 min and a final extension step of 7 min at 72 °C was performed.

The temperature in the annealing step on multiplex PCR was analyzed using gradient PCR
amplification. The gradient PCR was performed in a thermal cycler programmed consists of initial
denaturation at 94°C for 3 min, followed by 35 cycles of denaturation at 94°C for 30 sec, annealing at 52-
60°C for 30 sec and extension at 72°C for 7 min and final extension step of 7 min.

PCR products with 1 uL of 6X loading dye were separated on 3% agarose gel electrophoresis,
visualized by SYBR green staining, and analyzed by Blueview Transilluminator.

Results
Primer Test

Results of singleplex PCR the PCR amplification products of amplicon size of 127 bp contained the
actin gene ( Fig. 1a) , the PCR amplification products of Xa13 amplicon size of 220 bp contained the Xa13
susceptible gene ( Fig. 1b) , the PCR amplification products of Xa21 amplicon size of 750 bp contained the
Xa21 resistance gene ( Fig. 1c) , the PCR amplification products of Pi5 amplicon size of 700 bp contained the
Pi5 resistance gene and amplicon size of 450 bp contained the Pi5 susceptible gene ( Fig. 1d) , the PCR
amplification products of Pi9 amplicon size of 500 bp contained the Pi9 resistance gene (Fig. 1e) and the PCR

OB3_14_01/2

234

12th SCiUS Forum

amplification products of Pigm(t) amplicon size of 555 bp contained the Pigm(t) resistance gene and amplicon
size of 461 bp contained the Pigm(t) susceptible gene (Fig. 1f).
Effect of DNA concentration on multiplex PCR amplification

To test the sensitivity of the multiplex PCR, we tested multiplex PCR using different DNA
concentrations (10 ng, 50 ng, 200 ng and 600 ng) and found that all three amplicons were detectable at template
amounts as low as 10 ng DNA (Fig. 1g)
Effect of annealing on multiplex PCR amplification

The optimum temperature was used the gradient PCR method at different annealing temperatures
(52.0°C, 54.1°C, 57.9°C and 60.0°C). The result found that all three amplicons were detectable at a
temperature range is 52-60 °C, and the best temperature is 58 °C (Fig. 1h,1f).

Fig. 1. Optimization on multiplex PCR.
(a-f) Primer test by singleplex; (a), actin; (b), Xa13-prom; (c), pTA248; (d),40N23r ; (e), pB8 ; (f), S29742.
(g) DNA concentrations test in multiplex PCR (h,f) Annealing temperature by Gradient PCR; lane 1-4,
annealing at 52.0, 54.1, 57.9 and 60.0 °C, respectively. M, 100-bp ladder marker.

Effect of annealing on multiplex PCR amplification
The results of multiplex PCR amplification were based on examining the actin + Xa21 + Pi9 and actin

+ Xa21 + Pigm(t) genes in a total of five rice varieties, eight samples. The PCR amplification products of actin
+ Xa21 + Pi9 in all rice varieties amplicon size of 127 bp contained the actin gene. Hahng Yi 71, Nam Sa-gui
19 and Majanu from Pattani Research Center amplicon size of 750 bp contained the Xa21 resistance gene.
RD55 from Phatthalung Research Center and Tambon Lampam amplicon size of 660 bp contained the Xa21
susceptible gene. Hahng Yi 71 and Nam Sa-gui 19 amplicon size of 500 bp contained the Pi9 resistance gene
(Fig. 2.1). Furthermore, the PCR amplification products of actin + Xa21 + Pigm(t) in all rice varieties amplicon
size of 127 bp contained the Actin gene. Hahng Yi 71, Nam Sa-gui 19 and Majanu from Pattani Research
Center amplicon size of 750 bp contained the Xa21 resistance gene. RD55 from Phatthalung Research Center
and Tambon Lampam amplicon size of 660 bp contained the Xa21 susceptible gene. In all rice varieties,
amplicon size of 555 bp contained the Pigm( t) resistance gene and Nam Sa-gui 19 amplicon size of 5 5 5 bp
and 461 bp; as a result, heterozygous Pigm(t) resistance gene individuals amplify both the two fragments in a
co-dominant fashion (Fig. 2.2).

OB3_14_01/3
235

12th SCiUS Forum

Fig. 2. Amplification pattern of PCR based multiplex marker system for simultaneous detection (a) primer
sets of actin + Xa21 and Pi9 (b) primer set of actin + Xa21 and Pigm(t).
M, 100-bp ladder marker; lane 1, Hahng Yi 71; lane 2, Nam Sa-gui 19; lane 3, RD55 from Phatthalung
Research Center; lane 4, RD55 from Tambon Lampam; lane 5, Chiang Phatthalung from Phatthalung Rice
Research Center; lane 6, Chiang Phatthalung from Tambon Khuan Khanun; lane 7, MaJanu from Pattani Rice
Research Center; lane 8, MaJanu from Tambon Sai Thong.
Conclusion

In this research, multiplex PCR can be used to identify bacterial leaf blight (Xa21) and blast disease
resistance gene (Pi9, Pigm(t)) in reaction with actin as internal control and multiplex. PCR with primer sets
helps improve the rice breeding program for good quality rice varieties and resistance to disease in the future.

Acknowledgments
This project was supported by Science Classroom in University Affiliated School (SCiUS). The

funding of SCiUS is provided by Ministry of Higher Education, Science, Research and Innovation. This
extended abstract is not for citation.

References
[1] Chunthaburee S, Sujirat S, Teerawut W, Jirawat S, Wattana P, Piyada T. Changes in anthocyanin content

and expression of anthocyanin synthesis genes in seedlings of black glutinous rice in response to salt stress.
Asian Journal of Plant Sciences. 2016;15:56-65.
[2] Jeon J-S, Chen D, Yi G-H, Wang G L, Ronald PC. Genetic and physical mapping of Pi5(t), a locus
associated with broad-spectrum resistance to rice blast. Mol Gen Genomics. 2003;269:280-289.
[3] Gitishree D, Kritkittisak P, Eng-orn S, Chatchawan J, Tanee S, Sureeporn K. Screening Thai landrace rice
for blast resistance gene Pi9, Pi36, Pigm(t) using DNA markers. Thai Journal of Genetics. 2011;4(1):52-
62.
[4] Hajira SK, Sundaram RM, Laha GS, Yugander A, Balachandran SM, Viraktamath BC, et al. A single-
tube, functional marker-based multiplex PCR assay for simultaneous detection of major bacterial blight
resistance genes Xa21, xa13 and xa5 in rice. Science Direct Rice Science. 2016;23(3):144-151.

OB3_14_01/4
236

12th SCiUS Forum

List of Science Projects 12th SCiUS Forum
Oral presentation

Biology and Biodiversity Group 4
Saturday August 27, 2022

No. Code Title Author School
Kasetsart University
1 OB4_10_06 Genome-Wide Association Miss Punyisa Jannalao Laboratory School
Kamphaeng Saen
Mapping of genes associated Miss Sirigorn Nisasoka Campus Educational
Research and
with total root number and Miss Pawarisa Aungatichart Development Center
Demonstration School of
lateral root density at Khon Kaen University

seedling stage in rice (Oryza PSU Wittayanusorn
Surat Thani School
sativa)
Demonstration School,
2 OB4_04_01 Characterization of Mutations Miss Pandita Porasupattana University of Phayao

Induced by Helicobacter Mr. Rapatsit Tanwattanaseree Surawiwat School,
Suranaree University of
pylori in Human Technology

Cholangiocytes Naresuan University
Secondary
3 OB4_17_02 Optimal condition of Bacillus Miss Rawisara Kongprom Demonstration School
Mahasarakham
sp. to inhibit Fusarium solani Miss Natwalan Phiromnok University
Demonstration School
causes root rot diseases in (Secondary)
Engineering Science
soybean. Classrooms
(Darunsikkhalai School)
4 OB4_02_01 Polyphenols content and Miss Sanita Greethep

antioxidant capacity of Miss Tanatchaya Promraksa

Thunbergia laurifolia leaves

extract

5 OB4_18_02 Searching for bioactive Miss Bhornphat Sirijinda

compounds in Piper which Mr. Chanasit Phongphanit

inhibit the binding of TNF- Miss Nutticha Prawannago

alpha receptors

6 OB4_03_08 Influence of multiple stresses Miss Kwandai Janpleng

on the growth and viability of Miss Warinrada Sornso

yeast

7 OB4_07_02 Finding multidrug-resistant Mr. Achira

Staphylococcus epidermidis: Charoenwattanamaneechai

Who wins or loses? Mr. Pritprapoan Wonkyai

Miss Jiranuch Kongkaem

8 OB4_09_02 A Study on Influence form Mr. Chayut Keeratichaowanakul

Temperature and Acidity to Miss Karima Nisub

Recombinant Bacteriocin Miss Chutikarn Viroonharat

Mechanism

237

12th SCiUS Forum

No. Code Title Author School

9 OB4_13_02 Efficacy of Bacillus spp. Mr. Ittikorn Samma Piboonbumpen

which inhibit Phytophthora Mr. Panitan Kunphai Demonstration School,

palmivora and Lasiodiplodia Mr. Thanapat Phona Burapha University

theobromae causal agent of

root and fruit rot of durian (

Durio ziberthinus Murr)

10 OB4_06_04 Investigation of oligomeric Mr. Tanit Yodsirawong Rajsima Witthayalai

states of MurE as potential Mr. Vachiravit Phitchuanchom School

antibacterial target Mr. Rujipat Permpornpipat

11 OB4_01_06 Allele Frequency Distribution Miss Yodsawimon Vongburinphan Chiang Mai University

of Microsatellite Locus Mr. Suphakarn Chaisuk Demonstration School

DXS6789 in Male Thais for

Forensic Science Application

12 OB4_05_02 Antiviral activity and Miss Wachiraya Phutthamart Demonstration School

cytotoxicity of the betanin Miss Panitnan Kerdsuktrakool of Khon Kaen

extract from red beets University

13 OB4_15_08 Mangosteen peel extract to Miss Pisada Chaisuwaseth PSU.Wittayanusorn
inhibit biofilm School
นายพชร โกฏสิ นิ

14 OB4_18_04 Isolation of Soil Bacteria Miss Supapich Phannon Surawiwat School,
Capable of Degrading Mr. Natthakit Thamasoparat Suranaree University of
Cellulose. Mr. Poneak Pornjirachat Technology

238

12th SCiUS Forum

Title : Genome-Wide Association Mapping of genes associated OB4_10_06
with total root number and lateral root density at seedling
stage in rice (Oryza sativa)

Field : Biology and Biodiversity

Authors : Miss Sirigorn Nisasoka
Miss Punyisa Jannalao
Miss Pawarisa Aungatichart

School : Kasetsart University Laboratory School Kamphaeng Saen Campus
Center for Educational Research and Development Academic

Advisor : Assoc. Prof. Dr. Siwaret Arikit

Abstract :

Climate change contributes to unpredictable precipitation that causes flooding or water scarcity and
affects water availability for consumption and agriculture. Therefore, scientists and researchers want to study
the mechanisms of drought tolerance and develop rice varieties with drought tolerance. Previous studies have
shown that root phenotype is considered one of the key components for improving drought tolerance because
roots are the major organ for absorbing water and nutrients from the soil.

In this study, we analyzed the phenotypic and genotypic characterization of total root number and
lateral root density in 116 rice accessions using genome-wide association studies (GWAS) to identify the
single nucleotide polymorphisms (SNPs) associated with root traits. The phenotypic results show that Hom
Maejo (UN11) and Khao Pama (UC02) have the highest and lowest root counts, respectively. Prae Nai Kao
(UN07) has the highest lateral root density, while Anoh Ma Doh (US18) has the lowest. In GWAS, we found
the SNPs related to the total root number on chromosomes 1,4 and 10 and the SNPs related to the later root
density on chromosomes 1, 3, and 4. We then examined the functions of each of the genes discovered on the
chromosomes and found 60 genes related to rice growth. One of the interesting genes associated with roots is
OsSAUR2, a member of the auxin-responsive SAUR gene family. This gene is associated with auxin, one of
the major plant hormones associated with plant growth and development, especially in roots. A previous study
about OsNPR1 mutant that affected OsSAUR2 expression showing the reduction in total root number at
seedling stage. Therefore, OsSAUR2 could involve in the development of the total number of roots in rice. We
found a candidate gene related to root development in lateral roots, LOC _Os3g55270 (TIP41- like protein
family protein). Overexpression of TIP41 has been reported that result in a lower total number of lateral roots.
Therefore, it is possible that TIP41 may be involved in the development of lateral root density.

Keywords : genome-wide association study; rice; root; single nucleotide polymorphism

OB4_10_06/1
239

12th SCiUS Forum

Introduction

Rice (Oryza sativa) is one of the most important staple crops, feeding almost half of the world's
population. Especially in Thailand which mainly rice and is also the world's leading rice exporting country.
The impacts of climate change are interconnected. People are using more water, especially in agriculture.
Emphasize the need for more water in places where supplies are dwindling. Changing climatic conditions can
lead to significant food insecurity due to the race between population growth and food supply.

The main functions of the roots are to absorb water and plant nutrition and to anchor plant body to
the ground. The root system of a rice plant (Oryza sativa) consists of numerous nodal roots and their laterals.
Several studies have reported that roots are one of the most important keys to the adaptation and tolerance
mechanisms of many crops, including rice, such as demineralized, saline, and hard soil. The expression
characteristics of the rice roots were controlled by genetics. Therefore, rice roots vary among species.

Genome-wide association studies (abbreviated GWAS) is a research approach used to identify
genomic variants that are statistically associated with a particular trait. Especially in rice, researchers use
GWAS to analyze the genetic basis of agronomic traits. For example, the research found that OsSPL13 controls
grain length, qPSR10 controls cold tolerance, and qTIPS-11 is associated with lateral root number.

Therefore, the study of diversity and root adaptation in Thai rice varieties is an interesting and
important topic. Thus, the researchers used a genetically diverse set of rice and studied the relationship
between phenotypic and genotype traits by using the Genome-wide association study (GWAS) to identify
genes related to the adaptive traits of rice. In this study, we are interested in lateral root density and total root
number in Thai rice germplasm at the seedling stage and grown in gel system.

Methodology

1. Material and analysis tools
1. Rice seeds of 120 rice species (5 seeds per specie)
2. MS + 0.25% Phytagel medium
3. 300 ml medium
4. Alcohol burner
5. Plate
6. Filter paper
7. Biological safety cabinet
8. Forceps
9. Camera
10. Small photography studio

OB4_10_06/2

240

12th SCiUS Forum

11. ImageJ application
12. R application
2. Methods
1. Prepare rice seeds of each species.
2. Examine rice seeds and plant them.
3. Prepare 5L MS medium.
4. Build the small photography studio.
5. Collect the information.
6. Analyze the information.
7. Collect the information of rice roots.
8. Analyze the linking format using Genome-wide association study (GWAS).
Results, Discussion and Conclusion
In GWAS, we found the SNPs related to the total root number on chromosomes 1,4 and 10 and the
SNPs related to the lateral root density on chromosomes 1, 3, and 4.

Figure 1 Manhattan and quantile-quantile plots resulting from the genome-wide association study (GWAS)
results for total root number.

Figure 2 Manhattan and quantile-quantile plots resulting from the genome-wide association study
(GWAS) results for Lateral root density

Chromosomes 1,4 and 10 have low p-value and are above the cut-offline. Then, we analyzed the
functions of each of the genes discovered on the chromosomes and found a total of 60 genes associate with
rice growth.

OB4_10_06/3
241

12th SCiUS Forum

We found LOC_Os01g56240 (OsSAUR - Auxin-responsive SAUR gene family member), a candidate
gene associating with total root number, on chromosome 1. There is a previous study that demonstrated an
overexpression of NONEXPRESSOR OF PATHOGENESIS-RELATED GENES1 (OsNPR1) affects rice
growth and development by disrupting the auxin pathway at least partially through indirectly up-regulating
OsGH3.8 expression. The overexpression of OsNPR1 also affects OsSAUR2 by increasing the expression (Li
et al., 2016). Importantly, the mutant phenotype showed lower root number compared to wildtype. Therefore,
total root number could be enhanced by OsSAUR2.

We also found LOC_Os3g55270 (Os03t0760600 - TIP41-like protein family protein) on
chromosome 3, a candidate gene linked with rice root adaptation. According to one study, abolished expression
of TIP41 resulted in smaller plants with lower number of rosette leaves and lateral roots (Punzo et al., 2018).
Thus, TIP41 may be associated with lateral root density development.

Acknowledgements
This project was support by Science Classroom in University Affiliated School (SCiUS).

The funding of SCiUS is provided by Ministry of Higher Education, Science, Research, and
Innovation. This extended abstract is not for citation.

References
1. พณั ณ์ชิตา เวชสาร. ลกั ษณะทางสรีระและสณั ฐานวทิ ยาของรากขา้ วท่ีช่วยในการทนแลง้ [อินเทอร์เนต็ ]. 2562 [เขา้ ถึงเมอื่ 15 กุมภาพนั ธ์ 2565].
เขา้ ถงึ ไดจ้ าก: http://obrrd.ricethailand.go.th/images/pdf/seminar-rice/2562/20062019-06.pdf
2. Hazman, M., Brown, K.M. Progressive drought alters architectural and anatomical traits of rice roots
[Internet]. Rice 11, 62: Springer Publishing Company; 2018. [Cited 2022 April 11]. Available from:
https://doi.org/10.1186/s12284-018-0252-z
3. POWO, Plants of the World Online [Internet]. Facilitated by the Royal Botanic Gardens, Kew ;2022.
4. Published on the Internet; [cited 2 0 2 2 April 1 2 ] . Available from:
http://www.plantsoftheworldonline.org/Retrieved 12 April 2022.
5. Xu, X., Ye, J., Yang, Y. et al. Genome-Wide Association Study of Rice Rooting Ability at the
Seedling Stage [Internet]. Rice 13, 59; Springer Publishing Company; 2020. [Cited 2022 April 11].
Available from: https://doi.org/10.1186/s12284-020-00420-5

OB4_10_06/4
242

12th SCiUS Forum

Title : OB4_04_01Characterization of mutations induced by Helicobacter pylori in

Field : human cholangiocytes
Authors : Biology and Biodiversity
Mr. Rapatsit Tanwattanaseree
School : Ms. Pandita Porasupattana
Advisors : Demonstration School of Khon Kaen University
Prof. Dr. Banchob Sripa
Department of Pathology, Faculty of Medicine, Khon Kaen University
Mrs. Janjira Saisaeng
Demonstration School of Khon Kaen University

Abstract
Opisthorchis viverrini infection of the liver is a serious public health issue in the Mekong region, and it is

linked to deadly bile duct cancer, cholangiocarcinoma (CCA). Given that O. viverrini is a reservoir of Helicobacter
pylori, the carcinogenic bacteria may induce DNA mismatch repair gene (MMR) in the bile duct epithelium similar
to that occur in gastric cancer. This study, therefore, aimed to investigate mutations in cholangiocytes cocultured with
H. pylori. Human normal cholangiocytes (H69) were transfected with a green fluorescent protein reporter vector
pcDNA3.1-(CA)13-EGFP (pEGFP-CA13) which the insert disrupts the coding sequence of GFP and cocultured with
H. pylori or Escherichia coli. The number of GFP-positive cells was determined under a fluorescence microscope and
DNA was extracted and amplified using specific primers for the pEGFP-CA13 and sequenced. When H69 cells were
cocultured with H. pylori, the number of GFP-positive cells rose whereas no GFP-positive cells were observed in E.
coli cocultured and non-cocultured controls. DNA sequence analysis of H69 cells cocultured with H. pylori revealed
an increase in both point and frameshift mutations of the CA repeats compared to controls. This study reported for the
first time that H. pylori can induce genetic alterations in human cholangiocytes and may lead to an increased risk of
liver fluke - H. pylori associated cholangiocarcinoma.

Keywords : Helicobacter pylori, Cholangiocytes, Mutations, Cholangiocarcinoma

Introduction
Opisthorchis viverrini infection of the liver is a serious public health issue in the Mekong region including

Thailand, Laos, Cambodia, and Vietnam, with more than 12 million people infected. O. viverrini Ingestion of raw
freshwater fish carrying the metacercariae stage of the liver fluke causes illness. Many abnormalities in the bile duct
and liver are caused by liver fluke. And there is epidemiological evidence to support that liver fluke is one of the
causes of cholangiocarcinoma (CCA). In Thailand, it was found that the province of Khon Kaen is an opisthorchiasis
endemic location with the world's highest prevalence of CCA. O. viverrini infection also increases the risk of CCA
and is classified by the International Agency for Research on Cancer as a group 1 biological carcinogen in 2009.
Researchers also revealed co-infections involving liver fluke and H. pylori, as well as the fact that liver fluke is a

_____________________________________________________________________________________
OB4_04_01/1

243