CV19News - The Covid Report

COVID19 – EVIDENCE OF GLOBAL FRAUD

Perhaps the most damning article of all to the RT-PCR narrative came from some brilliant researchers who
used officially published data from Wuhan China, the CDC, the WHO, and GenBank (the genetic database of
all known genomic sequences and plants, animals, and humans). They ran the published SARS-COV2 genetic
code fragments, or genetic fingerprints of the alleged-to-exist virus, through an online search tool called BLAST
or Basic Local Alignment Search Tool. This is the biological forensics equivalent to AFIS (the automated
fingerprint identification system) that the FBI might use to search for fingerprint matches of a partial suspect
print collected at a crime scene.

When China first published their partial sequence for the Covid19 spike protein, which they claim is unique or
novel meaning, nothing else in biology is like it, they committed scientific fraud which has misled the world ever
since. Here is what the researchers found (see https://off-guardian.org/2020/11/17/covid19-evidence-of-global-
fraud/?fbclid=IwAR1Q-GV_Zh1jrNv0aQKRR33UAfuRCkeFSfA7npwfr0_kw48yHdzjJIlv0K0 for full details).

The November 17, 2020 article by Iain Davis opens with:

“COVID 19, and the subsequent governmental responses, appear to be part of an international
conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a
disease called COVID 19. The research was published by the Spanish medical journal D-Salud-
Discovery. Their advisory board of eminently qualified physicians and scientists lends further credibility
to their research. Their claim is astounding.

The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything
specific. D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently,
all claims about the alleged impact of COVID 19 on population health are groundless.

The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for
any part of it.”

The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has
been clearly identified by researchers in Wuhan. The WHO clearly suggest the SARS-CoV-2 virus was isolated
(meaning purified for study) and then genetic sequences were identified from the isolated sample. From this,
diagnostic kits were developed and distributed globally to test for the virus in towns, cities, and communities
around the world. (See the Legal Cases section below for evidence that these kits were manufactured,
labelled as Covid19 test kits, and then shipped in 2017, 3 years BEFORE they could be named or
needed!) According to the WHO and Chinese researchers, these tests will find the virus that causes COVID19.

Yet the WHO also state:
Working directly from sequence information, the team developed a series of genetic amplification
(PCR) assays used by laboratories.”

The Wuhan scientists developed their genetic amplification assays from “sequence
information” because there was no isolated, purified sample of the so-called SARS-CoV-2 virus. They
also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the
viral RNA.) However, such protein structures are not unique. They look just like other round vesicles, such as
endocytic vesicles and exosomes.

Copyright ©2021 P a g e | 101 CovidReport.CV19News.ca

The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together
by matching fragments found in samples with other, previously discovered, genetic sequences. [This is akin to
a fingerprint examiner at the FBI piecing together a fingerprint using other previously identified
fingerprint samples!] From the gathered material they found an 87.1% match with SARS coronavirus (SARS-
Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6%
sequence match to SARS-CoV. They had to use de novo assembly because they had no priori knowledge of
the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese
researchers isolated the virus on the 7th of January is false. The Wuhan team used 40 rounds of RT-qPCR
amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with
the published SARS coronavirus genome (SARS-CoV). Unfortunately, it isn’t clear how accurate the original
SARS-CoV genome is either.

This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was
just “there.” Sequenced data was produced and recorded as a new genome as GenBank Accession
No. AY274119. The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and
therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at
any stage of this process, had produced any isolated, purified sample of any virus. All they had were
percentage sequence matches to other percentage sequence matches.

In Australia scientists from the Doherty Institute, announced that they had isolated the SARS-CoV-2 virus.
When asked to clarify the scientists said:

“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests.”

This explains why the Australian government state:
The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited
evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”

In the UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in
which they asked him to:

Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been
isolated.”

To date they have not received a reply.

Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England
(PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To
which they responded:

PHE can confirm it does not hold information in the way suggested by your request.”

Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian
government the same. To which the Canadian government replied:

Having completed a thorough search, we regret to inform you that we were unable to locate any records
responsive to your request.”

In the U.S. the Centre for Disease Control (CDC) RT-PCR Diagnostic Panel state:
…No quantified virus isolates of the 2019-nCoV are currently available……..Detection of viral RNA may
not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical
symptoms.”

Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have
the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present
or causes COVID 19.

Copyright ©2021 P a g e | 102 CovidReport.CV19News.ca

We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we
must accept pictures of things we know could be something else and genetic sequences (which could be
anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.

TESTING FOR NOTHING
The WHO, and every government, think tank, policy steering committee, government scientific advisor,
supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2
causes COVID-19.

While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been
published. It is in the public domain.

Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target
proteins that scientists test for to identify the presence of the “virus”. These include:

 RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm
of COVID 19 diseased epithelial cells.

 S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly
facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion
protein shell (capsid) to pass into the now infected cell.

 E gene (Orf1ab) – small membrane protein used in viral assembly
 N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation

The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-
CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of
the synthesised cDNA (called forward and reverse primers respectively.)

The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences
called probes are introduced to anneal to specific target regions of the suspected viral genome. During
amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays
releasing a fluorescent or dye which can then be read by researchers.

It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in
a sample.

Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows
anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of
Health (NIH) genetic database called GenBank. Therefore, we can BLAST the claimed SARS-CoV-2 primers,
probes, and target gene sequences.

The WHO’s forward, reverse primers, and probe protocols for the alleged SARS-CoV-2 viral genome are
based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.
The vital RdRP nucleotide sequence used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a
nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity.
Similarly, the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of
the Orf1ab sequence which also identifies SARS-CoV-2.

However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If
we search for the RdRp SARS-CoV-2 sequence, it reveals 99 human chromosomes with a 100% sequence
identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.
Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the
SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2
RdRp gene.

Copyright ©2021 P a g e | 103 CovidReport.CV19News.ca

Whenever we check the so-called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols,
we find complete or high percentage matches with various fragments of the human genome. This suggests
that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be
anything from microbial sequences to fragments of human chromosomes.

The SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target
sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial
matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is
95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.
No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test
protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the
existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.

If so, as there are no isolates or purified samples of the virus; without a viable
test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any
evidence that a disease called COVID-19 exists.

This infers that there is no scientific basis for any claims about COVID-19 case
numbers, hospital admissions, or mortality figures. All measures taken to
combat this deadly virus are quite possibly founded upon nothing.

CONCLUSIVE FRAUD

Fraud is a criminal act. The legal definition of fraud is:
“Some deceitful practice or willful device, resorted to with intent to deprive another of his right, or in
some manner to do him an injury.”

The Legal definition of a conspiracy is:
“A combination or confederacy between two or more persons formed for the purpose of committing, by
their joint efforts, some unlawful or criminal act”

It seems, those who claim we face a pandemic have not provided any evidence to show that a virus called
SARS-CoV-2 causes a disease called COVID-19. All of the information strongly suggesting this possibility is
readily available in the public domain. Anyone can read it.

For there to be a fraud the deceit must be wilful. The intention must be to deliberately deprive others of their
rights or injure them in some other way. If there is evidence of collusion between individuals ad/or
organisations to commit fraud, then this is a conspiracy (in Common Law jurisdictions) or a Joint Criminal
Enterprise (JCE) under International Law.

It seems COVID-19 has been deliberately used as a casus belli to wage war on humanity. We have been
imprisoned in our own homes, our freedom to roam restricted, freedom of speech and expression eroded,
rights to protest curtailed, separated from loved ones, our businesses destroyed, psychologically bombarded,
muzzled, and terrorised.

Worse still, while there is no evidence of unprecedented all cause mortality, there were unseasonable spikes
in deaths. These correlate precisely with Lockdown measures which saw the withdrawal of the health
services we pay for and a reorientation of public health services to treat one alleged disease at the exclusion of
all others.

Copyright ©2021 P a g e | 104 CovidReport.CV19News.ca

Further, it is proposed by those who have forwarded the COVID-19 story, that this alleged disease provides
justification for the complete restructuring of the global economy, our political systems, societies, cultures
and humanity itself.

To be allowed to participate in their so called “new normal,” which is the wholesale transformation of our entire
society without our consent, they insist we submit to their conditions.

These include, but aren’t limited to, bio-metric surveillance of everyone, the centralised control and monitoring
of all of our transactions, oppressive business and social restrictions and an effective demand that we have no
right to sovereignty over our own bodies. This constitutes the condition of slavery.

There is no doubt that we have been deprived of our rights and injured. In Common Law jurisdictions
innocence is presumed, but the evidence that harm has been deliberately caused by an international
conspiracy is overwhelming. Destructive policies, enacted by governments across the world, clearly originated
among globalist think tanks and supranational institutions long before the emergence of this nonexistent
pandemic.

In Napoleonic Code jurisdictions, guilt is presumed. In order for the accused conspirators to prove their
innocence they must show that, despite their immeasurable resources, they have collectively been unable to
access or understand any of the freely available evidence suggesting COVID-19 is a myth.

Those responsible for the crime of conspiracy to commit global fraud should be tried. If found guilty they should
be imprisoned while the rest of us get on with trying to repair the damage they have already inflicted.

RECOMMENDED SUPPORTING VIDEOS

COVID-19 - EVIDENCE OF A GLOBAL FRAUD - RT-PCR TEST REVIEW BY DR. TOM COWAN
https://www.bitchute.com/video/65NcQ7rAJs3c/

Dr. Tom Cowan reviews the Off-Guardian article of the same title that completely reveals the evidence of how
this global SCAMdemic is being done. As it turns out, there are hundreds of gene sequences along both the
human genome as well as along the genomes of hundreds of microbes that have a 100% identity match to the
alleged-to-exist "novel" coronavirus they are calling SARS-CoV2. Using the BLAST (Basic Local Alignment
Search Tool) to run a search query in the National Institute of Health's database called GenBank, anyone can
see the evidence for themselves. What this means is that ALL RT-PCR tests that are being used to identify a
supposed Covid19 infection are actually finding nothing more than existing parts of your existing genetic
sequence and saying that you have Covid19! This is a MASSIVE fraudulent deception designed to coerce you
into taking the vaccine, accepting lockdowns, and the coming financial bailouts in exchange for forfeiting all
your personal property forever!

CV19NEWS - TODAY THEY WERE FORCED TO ADMIT THAT 'COVID-19' DOES NOT EXIST - GEMMA
O'DOHERTY REPORTING
https://www.bitchute.com/video/pw8HGUDjYa9U/

Find the link to our post about this article including the full transcript.
https://cv19news.wixsite.com/main/post/today-they-were-forced-to-admit-that-covid-19-does-not-exist-gemma-
o-doherty-reporting.

CV19NEWS - DR. LORNA LEVESQUE EXPOSES COVID19, RT-PCR TEST, AND VACCINES - CALGARY,
AB, CA 20201219
https://www.bitchute.com/video/gKPik5WWDEdq/

Copyright ©2021 P a g e | 105 CovidReport.CV19News.ca

In their 2007 story the New York Times cited a prescient quote from Dr. Elizabeth Talbot, deputy
state epidemiologist for the New Hampshire Department of Health and Human Services,
https://archive.is/o/MdDCX/topics.nytimes.com/top/reference/timestopics/organizations/h/heal
th_and_human_services_department/index.html?inline=nyt-org who said:

“One of the Most Troubling Aspects of the Pseudo-Epidemic is that
All the Decisions Seemed So Sensible at the Time.”

Those who run our public institutions have allowed history to repeat itself. At the head of
the line of incompetence and malfeasance is the UN itself. At the media briefing on COVID-19
on March 16, 2020, the WHO Director General Dr Tedros Adhanom Ghebreyesus (photo, below)
said:

“We Have A Simple Message for All Countries: Test, Test, Test.”

This insanity of testing anyone
and everyone, even without
symptoms has been an
unmitigated global public health
scandal and must be stopped. All
officials in high places complicit
in this crime must be prosecuted.

About the author: John
O’Sullivan John is CEO and co-
founder (with Dr Tim Ball) of
Principia Scientific International
(PSI). John is a seasoned science
writer and legal analyst who assisted Dr Ball in defeating world leading climate expert, Michael
‘hockey stick’ Mann in the ‘science trial of the century‘. O’Sullivan is credited as the visionary who
formed the original ‘Slayers’ group of scientists in 2010 who then collaborated in creating the
world’s first full-volume debunk of the greenhouse gas theory plus their new follow-up book.

[1] Kary Mullis : « Le test PCR ne permet pas de savoir si vous êtes malade », vidéo accessible
sur YouTube, 9 octobre 2020. https://fr.sott.net/article/36162-Kary-Mullis-Le-test-PCR-ne-
permet-pas-de-savoir-si-vous-etes-malade

[2] David DeGraw, Torsten Engelbrecht and Konstantin Demeter,
https://www.globalresearch.ca/national-security-alert-covid-tests-scientifically-fraudulent-
epidemic-false-positives/5720271

[3] New York Times, ’Faith in Quick Test Leads to Epidemic That Wasn’t,’ Gina Kolota, Published:
January 22, 2007 https://archive.is/MdDCX#selection-511.0-517.27

Learn much more about the RT-PCR testing procedures,
errors, and other facts at www.rtpcrtests.cv19news.ca.

Copyright ©2021 P a g e | 106 CovidReport.CV19News.ca

CHAPTER 5: THE LAW
& LEGAL ACTIONS

Copyright ©2021 P a g e | 107 CovidReport.CV19News.ca

INTERNATIONAL AND NATIONAL LAWS & CODES

Excerpts from The Nuremberg Code (1949)
1. The voluntary consent of the human subject is absolutely essential.

This means that the person involved should have legal capacity to give consent;
should be so situated as to be able to exercise free power of choice, without the
intervention of any element of force, fraud, deceit, duress, over-reaching, or other
ulterior form of constraint or coercion; and should have sufficient knowledge and
comprehension of the elements of the subject matter involved, as to enable him
to make an understanding and enlightened decision. This latter element requires
that, before the acceptance of an affirmative decision by the experimental
subject, there should be made known to him the nature, duration, and purpose of
the experiment; the method and means by which it is to be conducted; all
inconveniences and hazards reasonably to be expected; and the effects upon his
health or person, which may possibly come from his participation in the
experiment.

2. The experiment should be such as to yield fruitful results for the good of
society, unprocurable by other methods or means of study, and not random and
unnecessary in nature.

4. The experiment should be so conducted as to avoid all unnecessary physical
and mental suffering and injury.

5. No experiment should be conducted, where there is an a priori reason to
believe that death or disabling injury will occur; except, perhaps, in those
experiments where the experimental physicians also serve as subjects.

"Trials of War Criminals before the Nuremberg Military Tribunals under Control
Council Law No. 10", Vol. 2, pp. 181-182. Washington, D.C.: U.S. Government
Printing Office, 1949.]

Copyright ©2021 P a g e | 108 CovidReport.CV19News.ca

Copyright ©2021 P a g e | 109 CovidReport.CV19News.ca

All officers, bylaws enforcement, and private security forces have taken an oath to the
Queen and to uphold the constitution. The inalienable rights of common law private
people are not something one can give up to government. Rather, the constitution
enshrines many of them in writing to specifically highlight the protections we are all to
receive. ANY law that is subservient to common law and to the constitution, is required
to be consistent with that controlling document. Unconstitutional laws are of no force
or effect, and any officer who tries to enforce an unconstitutional law, is committing a
violation of their oath of office. They are in fact duty bound to disobey such unlawful
orders that infringe on constitutionally protected rights, whether or not a court has yet
ruled on the matter. If they violate that duty, they lose all their liability protection in the
process and can be held personally and criminally responsible for their malfeasance or
misfeasance of office.

Copyright ©2021 P a g e | 110 CovidReport.CV19News.ca

Remembering Nuremberg: Is History Repeating Itself?

By Jefferey Jaxen

In 1947, The Nuremberg Code was
established. It was a tragic necessity
after the world witnessed the
abominable atrocities of criminal
medical experimentation enacted
upon people during World War II.

IG Farben (later dissolved into Bayer,
BASF and others), along with Germany’s Nazi party, brought untold horrors upon large
numbers of people in the name of science, research and medicine.

Post-World War II, the planet enacted moral and ethical guardrails – codes of conduct that
codified a ‘Never Again’ high-water mark of human compassion. The Nuremberg Code laid
out basic principles which must be observed in order to satisfy moral, ethical and legal
concepts in the sphere of medical experimentation. It states:

“The voluntary consent of the human subject is absolutely essential. This means that
the person involved should have legal capacity to give consent; should be so situated
as to be able to exercise free power of choice, without the intervention of any element
of force, fraud, deceit, duress, overreaching, or other ulterior form of constraint or
coercion; and should have sufficient knowledge and comprehension of the elements
of the subject matter involved as to enable him to make an understanding and
enlightened decision.”

Fast-forward to now. Fear has been purposely and malignantly amplified. A failed public
health pandemic response, missing science and data from day one, has predictably led to
confusion, widespread collateral damage and unnecessary suffering. A carrot-and-stick
approach that some have called ‘a totalitarian tip-toe,” has been used to enroll the public
into the world’s largest medical experiment.

All Covid shots are currently considered experimental. In the U.S., this is denoted by an
Emergency Use Authorization (EUA) by the U.S. Food and Drug Administration (FDA).
Therefore, those receiving the shot, whether they know it or not, are agreeing to be part of
an ongoing medical experiment with zero long term safety data and a litany of other
unknowns.

In no uncertain terms, The Nuremberg Code demands voluntary consent of participants in
medical experiments. It forbids duress, overreach, and coercion to obtain such
consent.

A look at recent headlines will tell readers all they need to know about this unfortunate
chapter in medical and public health folly.

Copyright ©2021 P a g e | 111 CovidReport.CV19News.ca

The vaccine passport effort rages on. It attempts to make anyone unwilling to enroll in a
medical experiment, second-class citizens, effectively eliminating them from society. Yet
increasingly overt duress and coercion are now in your face daily.

Over the past month, Budweiser and Sam Adams began offering a free beer to get your
shot. Krispy Kreme is offering a free glazed donut. Major League Baseball’s Cincinnati Reds
are offering $10 off tickets to enroll in this medical experiment.

As demand to be injected with an experimental medical product began to taper off, bribery
efforts increased.

Studies on how best to psychologically manipulate citizens to consent to enrolling in an
experiment were undertaken by, among others, UCLA’s COVID-19 Health and Politics
Project. Marketing, not science was part of the focus.

Cash payments were shown to be the best persuasive method. Enter West Virginia’s
governor who is offering $100 savings bonds to anyone 16-35 years old who gets the shot.

Beyond the overt Homer Simpson-ish coercion of donuts, beer and money, Covid-era public
health ‘officials’ and the medical community have recently fallen in love with a new level of
manufactured duress. It’s rooted in military psychological operation or PSYOP techniques.

Despite shots not being approved under emergency use for children, schools are
backing mass vaccination campaigns for kids using ‘peer pressure’ to ‘boost uptake.’
Speaking to The Telegraph, Geoff Barton, general secretary of the Association of School
and College Leaders (ASCL) stated: “The peer pressure of seeing that your friends are

lining up to do it is likely to make the overall numbers taking up the vaccine higher,”

The duress PSYOP isn’t stopping with schools. With a straight face, USA Today ran an
opinion piece titled It’s time to start shunning the ‘vaccine hesitant.’ They’re blocking COVID
herd immunity. The article calls people who refuse to enroll in medical experiments “human
petri dishes,” crossing an alarming and dangerous line of open dehumanization of a people.

The dark irony, of course, is that same kind of propaganda was a key method that led to
the horrors of WW2 Nazi experiments in which the Nuremberg Code was meant to lead us
away from. In Hitler’s Germany, Jews were labeled disease carriers and a public health
risk to justify the creation of ghettos.

In the Covid fear fog of war, a full force blitzkrieg has been launched upon the
citizen/experimental patient. A 21st century enrollment propaganda campaign has been
blasted across captured media channels, news agencies, pharmaceutically lobbied
legislatures, and the medical establishment itself.

As much repugnant as it is unethical, through the eyes of long-standing codes of ethics and
robust protections once agreed upon across the global, many have been left stunned at how
rapidly manufactured fear campaign could evaporate ethical behavior, human dignity, and
essential safeguards.

The Washington Post is now calling for the application of a ‘Warp Speed to Vaccinate the
Global.’ The world is at an important inflection point. What the past year has taught us is
that, in the face of unjust edicts, silence is seen as compliance.

Copyright ©2021 P a g e | 112 CovidReport.CV19News.ca

LEGAL CASES

An appeals court in Portugal has just ruled that the PCR
process is not a reliable test for SARS-Cov-2 and therefore,
any enforced quarantine based on those test results is
unlawful. Further, the ruling suggested that any forced
quarantine applied to healthy people could be a violation of
their fundamental right to liberty. Most importantly, the
judges ruled that a single positive PCR test cannot be used
as an effective diagnosis of infection. Most importantly, the
judges ruled that a single positive PCR test cannot be used
as an effective diagnosis of infection.

The specifics of the case concern four tourists entering the country from Germany – all of whom are
anonymous in the transcript of the case – who were quarantined by the regional health authority. Of
the four, only one had tested positive for the virus, whilst the other three were deemed simply of “high
infection risk” based on proximity to the positive individual. All four had, in the previous 72 hours,
tested negative for the virus before departing from Germany.

In their ruling, judges Margarida Ramos de Almeida and Ana Paramés referred to several scientific
studies. Most notably this study by Jaafar et al., which found that – when running PCR tests with 35
cycles or more – the accuracy dropped to 3%, meaning up to 97% of positive results could be false
positives.

The ruling goes on to conclude that, based on the science they read, any PCR test using over 25
cycles is totally unreliable. Governments and private labs have been very tight-lipped about the exact
number of cycles they run when PCR testing, but it is known to sometimes be as high as 45. Even
fearmonger-in-chief Anthony Fauci has publicly stated anything over 35 is totally unusable.

You can read the complete ruling in the original Portuguese here, and translated into English here.
There’s also a good write up on it on Great Game India, plus a Portuguese professor sent a long email
about the case to Lockdown Sceptics.

The media reaction to this case has been entirely predictable – they have not mentioned it. At all.
Anywhere. Ever.

The ruling was published on 11/11/20 and has been referenced by many alt-news sites since…but the
mainstream outlets are maintaining a complete blackout on it.

The reddit Covid19 board actually removed the post, because it was “not a reliable source”, despite
relying on the official court documents:

Lookout for a forced and disingenuous “fact-check” on this issue from HealthFeedback or some other
“non-partisan” outlet in the near future. But until they find some poor shlub to lend their name to it, the
media blackout will continue.

Whatever they say, this is a victory for common sense over authoritarianism and hysteria.

Via https://off-guardian.org/2020/11/20/portuguese-court-rules-pcr-tests-unreliable-quarantines-unlawful

Copyright ©2021 P a g e | 113 CovidReport.CV19News.ca

1,000 LAWYERS AND 10,000 DOCTORS HAVE FILED A
LAWSUIT FOR VIOLATIONS OF THE NUREMBERG CODE

https://adrenogate.net/wp/2021/05/23/1000-lawyers-and-10000-doctors-have-filed-a-lawsuit-for-violations-of-the-
nuremberg-code

https://adrenogate.net/wp/2021/05/12/covid-hoaxers-face-death-for-violating-nuremberg-code-dr-reiner-fuellmich-crimes-
against-humanity

“Hold your politicians, media,
doctors and nurses accountable
– that if they are complicit in this
crime against humanity, they too
are subject to the laws set forth
in the Geneva Convention and
Nuremberg Code and can be
tried, found guilty and put to
death. Legal proceedings are
moving forward, evidence has
been collected and a large
growing body of experts are
sounding the alarm.”

A team of over 1,000 lawyers and over 10,000 medical experts led by Dr. Reiner Fuellmich have begun
legal proceedings against the CDC, WHO & the Davos Group for crimes against humanity.

Fuellmich and his team present the faulty PCR test and the order for doctors to label any comorbidity death
as a Covid death as fraud.

The PCR test was never designed to detect pathogens and is 100% faulty at 35 cycles. All the PCR tests
overseen by the CDC are set at 37 to 45 cycles. The CDC admits that any tests over 28 cycles are not
admissible for a positive reliable result. This alone invalidates over 90% of the alleged covid cases /
”infections” tracked by the use of this faulty test.

In addition to the flawed tests and fraudulent death certificates, the “experimental” vaccine itself is in
violation of Article 32 of the Geneva Convention. Under Article 32 of the 1949 Geneva Convention IV,
“mutilation and medical or scientific experiments not necessitated by the medical treatment of a
protected person” are prohibited. According to Article 147, conducting biological experiments on
protected persons is a grave breach of the Convention.

The “experimental” vaccine is in violation of all 10 of the Nuremberg Codes which carry the death
penalty for those who seek to violate these International Laws…

Copyright ©2021 P a g e | 114 CovidReport.CV19News.ca

Nuremberg Code #1: Voluntary Consent is Essential

No person should be forced to take a medical experiment without informed consent. Many media, political and non-
medical persons are telling people to take the shot. They offer no information as to the adverse effects or dangers of
this gene-therapy. All you hear from them is “safe and effective” and the “benefits outweigh the risks.” … During the
Nuremberg trials, even the media were prosecuted, and members were put to death for lying to the public, along with
many of the doctors and Nazis found guilty of Crimes Against Humanity.

Nuremberg Code #2: Yield Fruitful Results Unprocurable by Other Means

The gene-therapy does not meet the criteria of a vaccine and does not offer immunity to the virus. There are other
medical treatments that yield fruitful results against Covid such as Ivermectin, Vitamin D, Vitamin C, Zinc and
boosted immune systems for flu and colds.

Nuremberg Code #3: Base Experiments on Results of Animal
Experimentation and Natural History of Disease

This gene therapy skipped animal testing and went straight to human trials. In mRNA research that Pfizer used – a
candidate study on mRNA with rhesus macaques monkeys using BNT162b2 mRNA and in that study all the
monkeys developed pulmonary inflammation but the researchers considered the risk low as these were young healthy
monkeys from the age of 2-4.

Israel has used Pfizer and the International Court of Law has accepted a
claim for 80% of the recipients having pulmonary inflammation from
being injected with this gene-therapy. Despite this alarming
development Pfizer proceeded to develop their mRNA for Covid without
animal testing.

VIDEO: Crimes against Humanity - Dr. Reiner Fuellmich

https://www.bitchute.com/video/zIglttZymeRY

Copyright ©2021 P a g e | 115 CovidReport.CV19News.ca

Nuremberg Code #4: Avoid All Unnecessary Suffering and Injury

Since the rollout of the experiment and listed under the CDC VAERS (vaccine adverse events reporting system) over
4,000 deaths and 50,000 vaccine injuries have been reported in America. In the EU over 7,000 deaths and 365,000
vaccine injuries have been reported. This is a grievous violation of this code.

Nuremberg Code #5: No Experiment to be Conducted if There’s Reason to
Think Injury or Death Will Occur

See #4, based on fact-based medical data this gene-therapy is causing death and injury. Past research on mRNA also
shows several risks that have been ignored for this current trial gene-experiment. A 2002 study on SARS-CoV-1 spike
proteins showed they cause inflammation, immunopathology, blood clots, and impede Angiotensin 2 expression. This
experiment forces the body to produce this spike-protein inheriting all these risks.

Nuremberg Code #6: Risk Should Never Exceed the Benefit

Covid-19 has a 98-99% recovery rate. The vaccine injuries, deaths and adverse side-effects of mRNA gene-therapy far
exceed this risk. The use of “leaky” vaccines was banned for agriculture use by the US and EU due to the Marek
Chicken study that shows ‘hot-viruses’ and variants emerge… making the disease even more deadly. Yet, this has been
ignored for human use by the CDC knowing fully the risk of new deadlier variants emerge from leaky vaccinations.
The CDC is fully aware that the use of leaky vaccines facilitates the emergence of hot (deadlier)strains. Yet they’ve
ignored this when it comes to humans.

Nuremberg Code #7: Preparation Must Be Made Against Even Remote
Possibility of Injury, Disability or Death

There were no preparations made. This gene therapy skipped animal trials. The pharmaceutical companies’ own Phase
3 human clinical trials will not conclude until 2022 /2023. These vaccines were approved under an Emergency Use
only act and forced on a misinformed public. They are NOT FDA-approved.

Copyright ©2021 P a g e | 116 CovidReport.CV19News.ca

Nuremberg Code #8: Experiment Must Be Conducted by Scientifically
Qualified Persons

Politicians, media and actors claiming that this is a safe and effective vaccine are not qualified. Propaganda is not
medical science. Many retail outlets such as Walmart & drive-through vaccine centers are not qualified to administer
experimental medical gene-therapies to the uninformed public.

Nuremberg Code #9: Anyone Must Have the Freedom to Bring the
Experiment to an End at Any Time

Despite the outcry of over 85,000 doctors, nurses, virologists, and epidemiologists – the experiment is not being
ended. In fact, there are currently many attempts to change laws in order to force vaccine compliance. This includes
mandatory and forced vaccinations. Experimental ‘update’ shots are planned for every 6 months without any recourse
to the growing number of deaths and injuries already caused by this experiment. These ‘update’ shots will be
administered without any clinical trials. Hopefully, this new Nuremberg Trial will put an end to this crime against
humanity.

Nuremberg Code #10: The Scientist Must Bring the Experiment to an End
at Any Time if There’s Probable Cause of it Resulting in Injury or Death

It is clear in the statistical reporting data that this experiment is resulting in death and injury yet all the politicians, drug
companies and so-called experts are not making any attempt to stop this gene-therapy experiment from inflicting harm
on a misinformed public.

What You Can Do

What can you do to help put an end to this crime against humanity? Share this information. Hold your politicians,
media, doctors, and nurses accountable – that if they are complicit in this crime against humanity, they too are subject
to the laws set forth in the Geneva Convention and Nuremberg Code and can be tried, found guilty and put to death.
Legal proceedings are moving forward, evidence has been collected and a large growing body of experts are sounding
the alarm.

Visit the Covid Committee website at: https://corona-ausschuss.de/ and if you have been affected by this
crime, report the event, persons involved, and as much detail to the following
website: https://www.securewhistleblower.com/

Copyright ©2021 P a g e | 117 CovidReport.CV19News.ca

BILL S-201: GENETIC NON-DISCRIMINATION ACT OF CANADA 2017 -
AN ACT TO PROHIBIT AND PREVENT GENETIC DISCRIMINATION

https://www.parl.ca/DocumentViewer/en/42-1/bill/S-201/royal-
assent?fbclid=IwAR3Y1c3XzUYEk_GPJiiib3QgM6sTUsO8NVT17zp6BzM8TAgcNRVHz1sDj3w

SUMMARY

This enactment prohibits any person from requiring an individual to undergo a genetic test or
disclose the results of a genetic test as a condition of providing goods or services to,
entering into or continuing a contract or agreement with, or offering specific conditions in a
contract or agreement with, the individual. Exceptions are provided for health care practitioners
and researchers. The enactment provides individuals with other protections related to genetic
testing and test results.

The enactment amends the Canada Labour Code to protect employees from being required to
undergo or to disclose the results of a genetic test and provides employees with other protections
related to genetic testing and test results. It also amends the Canadian Human Rights Act to
prohibit discrimination on the ground of genetic characteristics.

Interpretation

Definitions
2 The following definitions apply in this Act.

disclose includes to authorize disclosure.
genetic test means a test that analyzes DNA, RNA or chromosomes for
purposes such as the prediction of disease or vertical transmission risks, or
monitoring, diagnosis or prognosis.
health care practitioner means a person lawfully entitled under the law of
a province to provide health services in the place in which the services are
provided by that person.

Prohibitions

Genetic test
3 (1) It is prohibited for any person to require an individual to undergo a genetic
test as a condition of

(a) providing goods or services to that individual;
(b) entering into or continuing a contract or agreement with that individual; or
(c) offering or continuing specific terms or conditions in a contract or agreement
with that individual.

Copyright ©2021 P a g e | 118 CovidReport.CV19News.ca

Refusal to undergo genetic test
(2) It is prohibited for any person to refuse to engage in an activity described in
any of paragraphs (1)(a) to (c) in respect of an individual on the grounds that the
individual has refused to undergo a genetic test.

Disclosure of results
4 (1) It is prohibited for any person to require an individual to disclose the results
of a genetic test as a condition of engaging in an activity described in any of
paragraphs 3(1)(a) to (c).

Refusal to disclose results
(2) It is prohibited for any person to refuse to engage in an activity described in
any of paragraphs 3(1)(a) to (c) in respect of an individual on the grounds that the
individual has refused to disclose the results of a genetic test.

Written consent
5 It is prohibited for any person who is engaged in an activity described in any of
paragraphs 3(1)(a) to (c) in respect of an individual to collect, use or disclose the
results of a genetic test of the individual without the individual’s written consent.

Offences and Punishment

Contravention of sections 3 to 5
7 Every person who contravenes any of sections 3 to 5 is guilty of an offence and
is liable

(a) on conviction on indictment, to a fine not exceeding $1,000,000 or to
imprisonment for a term not exceeding five years, or to both; or
(b) on summary conviction, to a fine not exceeding $300,000 or to
imprisonment for a term not exceeding twelve months, or to both.

Thus, by virtue of the GENETIC NON-DISCRIMINATION ACT OF CANADA 2017, an
employer, business, person, or public facility cannot require another person or
individual to undergo any form of genetic test, including a PCR or antigen test for
Covid-19, in order to be provided with goods or services, enter into a contract, or
continue the terms of an existing contract. Further, such entities may not
discriminate based on the person’s refusal to undergo a test or to disclose the
results of a test, and if so provided with such test results, may not disclose those
test results to another without the written consent of the individual. Punishment
and fines can range from $300,000 - $1 million and 1 - 5 years in prison!

Copyright ©2021 P a g e | 119 CovidReport.CV19News.ca

Canada Labour Code

8 The Canada Labour Code is amended by adding the following after
section 247.97:

DIVISION XV.3

Genetic Testing

Definitions
247.98 (1) The following definitions apply in this Division.

disclose includes to authorize disclosure.
genetic test, in relation to an employee, means a test that analyzes the employee’s
DNA, RNA or chromosomes for purposes such as the prediction of disease or vertical
transmission risks, or monitoring, diagnosis or prognosis.

Genetic test
(2) Every employee is entitled not to undergo or be required to undergo a genetic test.

Disclosure of results
(3) Every employee is entitled not to disclose or be required to disclose the results of a
genetic test.

Disciplinary action
(4) No employer shall dismiss, suspend, lay off or demote an employee, impose a
financial or other penalty on an employee, or refuse to pay an employee remuneration in
respect of any period that the employee would, but for the exercise of the employee’s
rights under this Division, have worked, or take any disciplinary action against or threaten
to take any such action against an employee

(a) because the employee refused a request by the employer to undergo a genetic test;
(b) because the employee refused to disclose the results of a genetic test; or
(c) on the basis of the results of a genetic test undergone by the employee.

Disclosure by third party
(5) No person shall disclose to an employer that an employee has undergone a genetic
test or disclose to an employer the results of a genetic test, without the written consent
of the employee.

Collection or use
(6) No employer shall collect or use the results of a genetic test without the written
consent of the employee who has undergone the test.

Copyright ©2021 P a g e | 120 CovidReport.CV19News.ca

Canadian Human Rights Act

9 Section 2 of the Canadian Human Rights Act is replaced by the
following:

Purpose

2 The purpose of this Act is to extend the laws in Canada to give effect, within the
purview of matters coming within the legislative authority of Parliament, to the
principle that all individuals should have an opportunity equal with other individuals
to make for themselves the lives that they are able and wish to have and to have
their needs accommodated, consistent with their duties and obligations as
members of society, without being hindered in or prevented from doing so by
discriminatory practices based on race, national or ethnic origin, colour, religion,
age, sex, sexual orientation, marital status, family status, genetic characteristics,
disability or conviction for an offence for which a pardon has been granted or in
respect of which a record suspension has been ordered.

10 (1) Subsection 3(1) of the Act is replaced by the following:
Prohibited grounds of discrimination

3 (1) For all purposes of this Act, the prohibited grounds of discrimination are
race, national or ethnic origin, colour, religion, age, sex, sexual orientation, marital
status, family status, genetic characteristics, disability and conviction for an offence
for which a pardon has been granted or in respect of which a record suspension
has been ordered.

(2) Section 3 of the Act is amended by adding the following after
subsection (2):

Idem
(3) Where the ground of discrimination is refusal of a request to undergo a genetic
test or to disclose, or authorize the disclosure of, the results of a genetic test, the
discrimination shall be deemed to be on the ground of genetic characteristics.

Thus, by virtue of the Canada Labour Code and the Canadian Human Rights Act, an
employer cannot require an employee to undergo any form of genetic test, including a PCR
or antigen test for Covid-19, or to disclose the results of a test, or discipline an employee
based on a refusal to undergo a test or to disclose the results of a test. Violations of the
Canadian Labour Code and/or the Canadian Human Rights Code are serious and
potentially expensive to the employer. Click the link in the header to read the Act in its
entirety.

Copyright ©2021 P a g e | 121 CovidReport.CV19News.ca

CRIMINAL CODE AND CEPA VIOLATIONS

The Criminal Code of Canada is the body of legislated legal statutes that govern criminal code offences in
this country.

The Canadian Environmental Protection Agency (CEPA) is our version of the EPA in the USA tasked with
overseeing protection of the environment and citizens’ exposure to toxic substances.

In researching material for this book, I came across an article, video, or Twitter tweet that mentioned the
following information in relation to the imposed wearing of face masks or forced vaccinations. With my
background in law, I was quickly able to realize the significance of this find and how it can be used to resist
such mandates by employers, businesses, and politicians.

Source: https://laws-lois.justice.gc.ca/eng/acts/C-46/section-245.html

First, under the CC Section 245 (1), it reads as follows:

Administering noxious thing:

245 (1) Every person who administers or causes to be administered to any other person or causes any other
person to take poison or any other destructive or noxious thing is guilty

 (a) of an indictable offence and liable to imprisonment for a term of not more than 14 years, if they did so
with intent to endanger the life of or to cause bodily harm to that person; or

 (b) of an indictable offence and liable to imprisonment for a term of not more than two years or of an
offence punishable on summary conviction if they did so with intent to aggrieve or annoy that person.

Source: https://laws-lois.justice.gc.ca/eng/acts/C-15.31/section-sched67258.html?txthl=dioxide+carbon

Second, we find that Carbon Dioxide (CO2) is listed as item #74 under the CEPA’s Schedule 1 list of noxious
substances. It reads as follows:

SCHEDULE 1(Sections 56, 68, 71, 77, 79, 90, 91, 93 to 96 and 199)
List of Toxic Substances

74 Carbon dioxide, which has the molecular formula CO2

Third, in relation to the ingredients either contained in or used in the production of Covid-19 vaccines
and most other routine vaccines, we find that several of the following compounds are also listed under
CEPA’s Schedule 1 list of noxious substances:

8 - Mercury and its compounds
26 - Benzene that has the molecular formula C6H6
57 - Ethylene oxide, which has the molecular formula H2COCH2
58 - Formaldehyde, which has the molecular formula CH2O
115, 117, 121, 147-150 – Benzene in several forms
126 - Hydrazine, which has the molecular formula N2H4
163 - Plastic manufactured items

Copyright ©2021 P a g e | 122 CovidReport.CV19News.ca

Legal Interpretation of the Criminal Law

Thus, a possible legal interpretation of criminal law as it applies to mask mandates is that the mandator,
whether an employer, business, politician, or governmental agency is administer[ing] or caus[ing] to be
administered to any other person or caus[ing] any other person to take poison or any other destructive or
noxious thing and is therefore guilty of an offence punishable by up to 14 years in jail. The logical legal
argument is that forcing someone to wear a face mask provably causes the rebreathing of one’s own CO2,
which is listed as item #74 on CEPA’s own SCHEDULE 1 List of Toxic Substances.

There is also mounting evidence worldwide that some of these masks contain graphene oxide nano particles
within the filter mesh between the layers of the mask. They are also made of certain types of plastics which
breakdown from heat and moisture during long-duration wearing of a mask. These nanoparticles and fibres
separate from the mask and are then rebreathed into the lungs where they become trapped and cause
scarring damage much like fibrous asbestos will do.

Item 57 on the list is Ethylene
Oxide (EO) which is a strong
chemical used in the medical
industry to sterilize things. The
problem is that the Covid-19
testing swabs are coated with
EO on the tip of the swab. This
material is carcinogenic to
humans so why is it on the
test swabs that are inserted
high up into the nostrils, often
puncturing the cribriform
plate at the back of the nasal
cavity where it can deposit
this chemical directly into the
brain?

There are also many reports
that the tips of the swabs also
contain nanoparticles of
Graphene Oxide, once again
without full disclosure on the
packaging.

What
about
the
vaccines?

With regard to
the Covid-19 so-called
vaccines, medical mandates,
and vaccine passports, the list of toxic substances above is a short list of ingredients that I am already aware of
that are contained in one of more of the vaccines commonly being provided to world populations.

Copyright ©2021 P a g e | 123 CovidReport.CV19News.ca

Yet again, we learn that graphene oxide, which is extremely toxic to humans, is reportedly the KEY ingredient
in these Covid shots, although that detail it is NOT being reported on the package insert as required by law.

Independent research by
Spanish professor Dr. Pablo
Campra Madrid and
published on June 28, 2021,
shockingly reveals that each
dose contains 6 ng/uL of
RNA and 747 ng/uL or
99.203% graphene oxide by
volume in aqueous
suspension. Using advanced
chemical analysis, this
recent study of the Pfizer
Covid19 vaccine vials has
confirmed the presence of
this dangerous substance in
the injections.

To learn more about this scientific evidence that is being aggressively suppressed, see our reposted Dr. Jane
Ruby Bitchute video titled BREAKING DISCOVERY! The ACTUAL CONTENTS Inside Pfizer Vials EXPOSED! at
https://www.bitchute.com/video/I5s00dRtzEqZ.

In Summary

Based on an interpretation of the laws in Canada, it appears to me that someone affected by these ridiculous
mandates would have a potential legal case to have the various mandators charged with a criminal code
violation for administering or causing to be administered a toxic substance to another.

Of course, the law provides the escape clause that the perpetrator must do so with intent to endanger the
life of or to cause bodily harm to that person; or to do so with intent to aggrieve or annoy that person. No
doubt the mandators would argue that no intent to harm, aggrieve, or annoy was present at the time of
committing the offence. The mandators would win the case on these grounds UNLESS it can be shown that
they were previously notified of this information or that they did know this information and acted contrary to
that knowledge.

This is why it is critical to inform them of the truths they don’t yet know by sharing CV19News and The Covid
Report with them right away, so they go no longer rely on ignorance or stating, “I was just following orders”.

One way to trap these mandators is to send the information, or notices of liability, to them by registered mail
so you have a tracking that the information was delivered and received. Even better, file a civil lawsuit or
criminal complaint against them so that the discovery process reveals that information to them during the
proceedings.

Government officials and politicians can be held personally liable for damages caused by their polices when it
can be shown that they are guilty of misfeasance or malfeasance of public office, which is when they knew or
should have known that their policies could or did cause damage to people subject to them.

I believe that this is the avenue of attack that we must use on them to effect the change we want!

~ Arnold (AJ) Jameson

Copyright ©2021 P a g e | 124 CovidReport.CV19News.ca

INTERNATIONAL CRIMINAL COURT FILING: CRIMES AGAINST HUMANITY

New evidence, including a sworn affidavit from Prof. Luc A. Montagnier,
has been submitted to the International Criminal Court alleging World
Governments are complicit in genocide and crimes against humanity

HTTPS://DAILYEXPOSE.CO.UK/2021/08/22/NEW-EVIDENCE-SUBMITTED-ICC-ALLEGING-WORLD-
GOVERNMENTS-COMMITTED-GONOCIDE

BY DAILY EXPOSE ON AUGUST 22, 2021

New evidence, including sworn affidavits from leading experts such as Professor Luc A. Montagnier,
has been submitted to the International Criminal Court by lawyers in several countries alleging
Government’s across the world and their advisors are complicit in genocide, crimes against
humanity and breaches of the Nuremberg Code.

Attorney Melinda C. Mayne, and Kaira S. McCallum submitted a 27-page ‘Request for Investigation’
to the International Criminal Court (ICC) at The Hague back in April 2021 alleging the UK
Government and its advisors were complicit in crimes against humanity in the name of
Covid-19.

On the 28th of April 2021, the pair received a formal acknowledgement from the ICC and were
assigned a case number – ‘141/21’. Since then, the pair have been gathering new evidence to use in
their ICC claim and have established connections with lawyers and research scientists from around
the world.

A new press release released on the 17th August, which can be viewed here, confirms that the pair
have received sworn affidavits from leading experts including research scientist and nuclear
cardiologist Dr. Richard M. Fleming, the Nobel Laureate virologist Professor Luc A. Montagnier,
and Dr. Kevin W. McCairn, a neuroscientist and expert on neurological disease.

Professor Luc A Montagnier, who won a Nobel prize
for his work on the HIV virus, claimed in April 2020 that
he believed the novel coronavirus was created in a
laboratory. Then in May 2021 the expert virologist
stated that “Mass vaccinations are a scientific error
as well as a medical error. It is an unacceptable
mistake. The history books will show that because
it is the vaccination that is creating the variants”.

Professor Luc A Montagnier

A new claim has also been submitted to the ICC due to
the vast amount of new evidence and information that
has come to light in the past few months, and the
lawyers say they now have compelling evidence that
“the SARS-CoV-2 virus and the Covid-19 ‘vaccines’
are deliberately engineered bioweapons that have
been released in two phases on unsuspecting
peoples of the world”.

Attorney Melinda C. Mayne, and Kaira S. McCallum
have also confirmed that they have now be joined by
lawyers who have filed similar Requests for
Investigation to the International Criminal Court, in
France, the Czech Republic and Slovakia.

Copyright ©2021 P a g e | 125 CovidReport.CV19News.ca

Because of this a letter was sent to the ICC on the 12th of August 2021 requesting they all be
allowed to submit a joint claim, whilst also submitting preliminary evidence for the allegations
common to everyone across the world, and requesting the right to have claims specific to individual
countries also investigated by the ICC.

One request specific to the United Kingdom is an examination of genocide of the elderly and
vulnerable that took place in care homes and hospitals through the inappropriate use of
midazolam and morphine. Another investigation specific to this issue has also now concluded and a
private criminal prosecution will proceed against the UK Government, Matt Hancock, Chris Whitty
and others if the team of lawyers and experts who have carried out the investigation do not receive
satisfactory answers to the extensive questions that have been forwarded to the aforementioned in
an open letter sent on the 17th August 2021.

Whilst in the joint claim between lawyers from several countries they have requested that there be
an immediate suspension on the entire Covid-19 injection program and an end to the testing
of asymptomatic people.

The lawyers say that they now eagerly await the decision of the International Criminal Court as to
whether they will allow a joint claim by several countries to be made and accept the Request for
Investigation.

They have made it clear to the ICC that due to the escalating medical apartheid, the loss of basic
freedoms and rights, and the ever-increasing, very high number of deaths and serious adverse
events suffered by recipients of Covid-19 injections, that there is an urgent need for the Court to
act swiftly and without further delay.

To that end the lawyers have requested a meeting at the Hague as soon as is practicable.

Whilst awaiting the response Attorney Melinda C. Mayne, and Kaira S. McCallum have confirmed
they are in discussions with lawyers in other countries who have not yet filed their individual
Requests to the ICC, but have indicated they wish to join them, and will issue an update as and
when there is further news.

Copyright ©2021 P a g e | 126 CovidReport.CV19News.ca

Chapter 6: EVIDENCE OF
PREPLANNING?

Was there a long-held globalist agenda that orchestrated this Covid-19
event and, if so, who is doing it and for what reasons?

We believe there is ample proof that a diabolical
New World Order | Illuminati plan was put into
place decades ago and has been written about
openly in all the media.

We are now witnessing one of their final BIG
moves on the grand chessboard, and this fake
pandemic is one important piece of an even
bigger and deadlier plan yet to come.

Copyright ©2021 P a g e | 127 CovidReport.CV19News.ca

So, if this was all PLANned, what is the real agenda?

The goal is multi-faceted and well-executed, but the ultimate goals are mass
depopulation through economic chaos caused by this fake pandemic; the excessive
use of an improper diagnostic test, social distancing, and masking to suppress our
immune systems; and the return to health for those who will submit to the Covid
vaccine scheme. Basically, it is the New World Order Agenda 2030.

Copyright ©2021 P a g e | 128 CovidReport.CV19News.ca

Wow! The Rockefeller Foundation Also "PREDICTED" It Would Happen!!

See: https://cv19news.wixsite.com/main/post/wow-the-rockefeller-foundation-also-predicted-it-would-happen

The elite cultists of the totalitarian world plan purposely manufacture such events
years in advance to usher in their New World Order.

All we need to do is read their documents and understand them as blueprints
rather than preemptive planning scenarios that they often use to justify them!

The 2014 interview with Harry Vox describes The Elites' Plan for 2020, based on
the Rockefeller strategic planning document called "Scenarios for the Future of
Technology and International Development" published in May 2010.

LOCK STEP – A world of tighter top-down government control and more
authoritarian leadership, with limited innovation and growing citizen pushback.

It mirrors precisely the Covid19 scenario playing out now. All such false flag world
events have been planned years in advance and can be seen in the published
papers of the global elites and the draconian laws they pass along the way.

You can take it with a grain of salt and go back to sleep or, you can realize that
the future is easily predictable by just opening your eyes and paying attention.

AND, turn off your mainstream "tel-a-vision" since it literally uses "channels" to
"program" your worldview based on fabricated lies, distortions, and reality-
bending propaganda, largely funded (70%) by Big Pharma ad revenue, which is
why you will never get the truth through mainstream media. Media really is a form
of magic or witchcraft used by the occultists to move the game pieces around on
the chessboard of life.

Copyright ©2021 P a g e | 129 CovidReport.CV19News.ca

Their agenda is hiding in plain
sight for those who open their
eyes long enough to see it
clearly.

In 2017, a military planning
website, Deagel.com,
forecasted a DROP of 227
million people in the US by the
year 2025.

How can they know that will
happen unless it is planned?

Deadly pathogens and forced
or coerced vaccinations
inspired by a fake pandemic are a sure-fire way to depopulate the US while blaming it
on a silent invisible enemy. The globalists openly speak about overpopulation so this
agenda should not come as a surprise to the awakened.

Of course, the mastermind behind much of this false depopulation agenda is Bill
Gates. He is openly telling us 3 years ago in a public interview that he will use
statistical trickery to con the world about this new virus.

Copyright ©2021 P a g e | 130 CovidReport.CV19News.ca

Perhaps what is most disturbing is the fact that this Covid19 event was PLANNED and the proof has
been left everywhere! That’s right. The evidence shows that this is likely 20+ years in the making.
According to the WITS website, as far back as 2017, the Covid19 test kits were being produced en
masse and being shipped worldwide 3 years in advance of the date they officially named it Covid19.

How can that be if this was a
natural event? Since this loose
end was discovered by
researchers and exposed to the
truth community, the website has
been altered, but the internet
archive still shows what was
originally there!

Any shrewd detective knows that
a suspect is probably guilty
whenever he tries to cover-up the
evidence of a crime after the fact.

All criminals make mistakes and
leave evidence of their crimes,
and there is a lot to see in this
case.

Finally, and even more disturbing, if that is even possible, is that this PLANdemic is meant to go on
for FIVE years - until March 31, 2025! Documents from the World Bank’s own website clearly show
the project’s expected end date for the international bankers who are heavily investing in this project.
That will be very painful half decade if not stopped.

Okay, so the science is there and there
are many articles on our website about
the RT-PCR test.

The inappropriate and FDA-unapproved
Rt-PCR test that has only been given
“emergency use authorization” is the
key to the entire hoax because it sets the
stage and justification for ALL of the
mitigation measures that are being
justified due to inflated case numbers.

Please go to www.rtpcrtests.cv19news.ca, read the articles, and share your newfound knowledge
with everyone.

Copyright ©2021 P a g e | 131 CovidReport.CV19News.ca

THE BIG RESET

To gain the support of the masses, one of the key movers is to crash the global
economy, impoverish most people, bankrupt small businesses, and confiscate
all private property, so people will accept bailout money with onerous
conditions, forced vaccination being one of them. This is what Prime Minister
Justin Trudeau advocated and demanded of his liberal caucus in October 2020,
which the public has now learned about via a leaked insider whistleblower email
that was sent to certain key people, and has since been exposed to the world.

You can view the entire article and video at this link:
https://cv19news.wixsite.com/main/post/government-of-canada-
liberal-insider-blows-the-whistle-on-the-covid19-and-covid21-agenda

Copyright ©2021 P a g e | 132 CovidReport.CV19News.ca

Interesting Social Media Posts

I believe the name of the doctor has been changed to protect him from the inevitable whistleblower
attacks he will likely face by posting this with his real name. However, the evidence presented totally
jives with the overall research I have conducted since March 2010 and, is in my opinion, a genuine
article reposted by this Facebook user.

December 28, 2020 posted by Brussel Sprouts
For all people who does still believe covid 19 is real:

Interesting

“I have a PhD in virology and immunology. I'm a clinical lab scientist and have tested 1500
"supposed" positive Covid 19 samples collected here in S. California. When my lab team and I did the
testing through Koch's postulates and observation under a SEM (scanning electron microscope), we
found NO Covid in any of the 1500 samples. What we found was that all of the 1500 samples were
mostly Influenza A and some were influenza B, but not a single case of Covid, and we did not use the
B.S. PCR test. We then sent the remainder of the samples to Stanford, Cornell, and a few of the
University of California labs and they found the same results as we did, NO COVID. They found
influenza A and B. All of us then spoke to the CDC and asked for viable samples of COVID, which
CDC said they could not provide as they did not have any samples.

We have now come to the firm conclusion through all our research and lab work, that the COVID 19
was imaginary and fictitious. The flu was called Covid and most of the 225,000 dead were dead
through co-morbidities such as heart disease, cancer, diabetes, emphysema etc. and they then got
the flu which further weakened their immune system and they died. I have yet to find a single viable
sample of Covid 19 to work with.

We at the 7 universities that did the lab tests on these 1500 samples are now suing the CDC for
Covid 19 fraud. The CDC has yet to send us a single viable, isolated, and purified sample of Covid
19. If they can't or won't send us a viable sample, I say there is no Covid 19, it is fictitious. The four
research papers that do describe the genomic extracts of the Covid 19 virus never were successful in
isolating and purifying the samples. All the four papers written on Covid 19 only describe small bits of
RNA which were only 37 to 40 base pairs long which is NOT A VIRUS. A viral genome is typically
30,000 to 40,000 base pairs. With as bad as Covid is supposed to be all over the place, how come
no one in any lab worldwide has ever isolated and purified this virus in its entirety? That's because
they've never really found the virus, all they've ever found was small pieces of RNA which were never
identified as the virus anyway.

So, what we're dealing with is just another flu strain like every year, COVID 19 does not exist and is
fictitious. I believe China and the globalists orchestrated this COVID hoax (the flu disguised as a
novel virus) to bring in global tyranny and a worldwide police totalitarian surveillance state, and this
plot included massive election fraud.”
-Rob Oswald

Edited rumor has it that this was not said by Rob Oswald but by Derek Nauss (which is most likely an
alias to protect his identity). I will still believe this over the government’s narrative any day.

Here is one original source for the article:

https://prepareforchange.net/2021/01/09/im-a-clinical-lab-scientist-c19-is-fake-wake-up-america

Copyright ©2021 P a g e | 133 CovidReport.CV19News.ca

Excellent Letter to Premier Kenney by an Alberta Doctor.

This should be shared widely, with every premier in Canada.

Dennis L. Modry BSc, MD, MSc, FRCS, FACCP, FACS is the
Clinical Associate Professor, Cardiothoracic Surgery at the
University of Alberta.

He is also the Founder and Director of the Heart, Lung and
Heart-Lung Transplant Program and was the Director of the
Cardiovascular Intensive Care Unit (1984 – 2015).

Dear Premier Kenney:

Many Albertans – myself included – commended you on your previous commitment to a balanced
approach to protecting Albertans from COVID-19, while at the same time not completely abrogating
our freedoms and rights such as free speech, peaceful assembly, association, and our ability to earn
a living and care for our families.

(Tuesday) you imposed new lockdown measures which severely limit and, in some cases, shut down
entirely many social, family, friendship, spiritual, recreational and entertainment pursuits that
Albertans rely on for their well-being, just as you did in the spring. While you have commendably
spared small businesses from suffering the complete shut-down they experienced this past spring
(and your apology for this mistake is laudable and honourable), it seems that you have not learned
much from the lockdown harms which Albertans experienced earlier this year.

The evidence that you provided for this lockdown is both suspect and incomplete and does a
disservice to Albertans who deserve more from you. A major tenet of the Hippocratic Oath that
physicians like myself ascribe to is “First Do No Harm”, which is ignored by this imposed lockdown.

Is it too late to correct this lockdown error? No, not if you are willing to be better informed. We have
learned a great deal since the onset of this pandemic, much of which is the result of how different
regions and countries have attempted to control the spread of COVID-19 and treat those infected.
Now we know who is at greatest risk and have proven effective therapies for those who are seriously
ill, as reported by the National Institute of Health on Dec 3, 2020; and we are on the cusp of mass
immunization consequent to multiple vaccines soon to be available worldwide. The public should be
reassured, rather than locked down.

Within the last few weeks, new evidence informs a more nuanced approach to better protect
Albertans without unintended and unacceptable consequences, such as defined in the excellent
recommendations of the Great Barrington Declaration, further addressed below.

I acknowledge with reverence those Albertans who have passed on from COVID-19, just as I
acknowledge many others like Jerry Dunham who have died because lockdowns prevented their
access to healthcare for very serious non-COVID-19 illnesses and conditions. I acknowledge the
many with despair who have died from suicide and drug overdose. We now know that lockdowns are
more lethal than COVID-19 and must learn from what has transpired to ensure we do not continue to
make the same mistakes. Were you not informed of these facts, or did you simply ignore them?

Copyright ©2021 P a g e | 134 CovidReport.CV19News.ca

Please consider the following evidence and unintended consequences that should give you the
courage to retract the restrictions:

1. We are nowhere close to overwhelming our healthcare system. As of December 9, 2020
there were 654 COVID-19 patients in 8,500 beds, or 7.7 per cent of capacity. There were
only 112 patients in 272 ICU beds, or 41.2 per cent of operational capacity, however, you
have stated publicly that the ICU capacity can be increased to 1,081 beds. This implies that,
at present, only 10.4 per cent of potential ICU beds are filled.

2. Have you evaluated what percentage of patients hospitalized with COVID-19 are actually in
hospital because of COVID-19, as opposed to with COVID-19, wherein it is the underlying
disease that is the actual reason for the admission? The public deserves to know.

3. Have you evaluated the percentage of patients who died with, but not from COVID-19? This
information is extremely important to share with the public who deserve a fair and balanced
presentation of the facts to both prevent fear and panic, as well as garner buy-in of
government policy.

4. Are you aware that the PCR test for COVID-19 has a false positive rate of up to 50 per cent
according to the CDC (USA Center for Disease Control), and up to 90 per cent by other
sources?

5. Are you aware of how many people have died or become seriously compromised because
they could not access healthcare for non-COVID-19 disease, including treatments for heart
disease, cancer, and other life-threatening problems? Lockdowns are more lethal than Covid-
19, which cannot be over-emphasized. Do you not think that the public should know this?

6. Are you aware of how many people have committed suicide due to government-imposed
lockdowns and the shuttering of businesses, schools, colleges, and universities? Have you
tried to find out?

7. Do you believe that it is ethically and morally appropriate for government to pick winners and
losers by defining what is an essential versus a non-essential business, or activity such as,
but not limited to, social, recreational, fitness-related, or spiritual pursuits?

8. Are you fully aware of the magnitude of the economic devastation Alberta has sustained, and
that we are spiralling down rapidly to a have-not province, according to the Fraser Institute?

9. Are you aware of how many divorces have occurred consequent to lockdowns and loss of
income? What about the increase in domestic abuse, family violence and increase of
substance abuse?

10. Are you aware of the short- and long-term effects on the mental health of our most
vulnerable, including our children?

11. Have you been apprised of how much crime has increased due to people becoming
desperate just to stay alive?

12. Finally, in the interests of transparency, please provide the information highlighted above to
all Albertans on a daily or weekly basis on the AHS website, various social and other media
sources available, so that we the people of Alberta can work with you, rather than question
the validity of imposed interventions that are no longer required.

Your consideration to rescind the lockdown should also be based on fact. I implore you to read the
Great Barrington Declaration authored by professors in medicine from Oxford, Harvard, and
Stanford, who are experts in epidemiology, immunology, biostatistics, vaccine development,
mathematical modelling, and public health policy. The Declaration has been co-signed by 38,154
medical practitioners, as well as 12,717 medical and public health scientists world-wide. Please
also review the section in the Declaration on Frequently Asked Questions. You will be better
informed and better able to give proper consideration to a more humane, compassionate and
effective approach, rather than inflicting a multitude of harms on 4.4 million people.

Copyright ©2021 P a g e | 135 CovidReport.CV19News.ca

Please consider the following targeted recommendations:

1. All testing should stop immediately, particularly for those who are asymptomatic, except for:
a. People presenting to hospital with respiratory problems
b. Healthcare workers
c. Nursing home employees with ‘point-of-care’ testing

2. Nursing homes should have a comprehensive campaign for:
a. Staff education in infection control
b. Vitamin D daily for all inhabitants
c. Electronic audiovisual communications for loved ones wishing to stay in touch

3. There is also gathering evidence on the use of Ivermectin to prevent COVID-19, as evidenced
in this Senate Testimony on December 8, 2020. The evidence for effective prophylaxis with
Ivermectin is compelling.

4. Everywhere – hospitals included – should open immediately with conventional pre-Covid-19
precautions.

5. Mandatory mask-wearing should cease (except for health professionals) as there is no credible
scientific basis, as evidenced in the November 18, 2020 Danish randomized controlled trial
reported in the Annals of Internal Medicine. Further, no country has reported a change in the
trajectory of COVID-19 diagnosis consequent to widespread public testing of asymptomatic
citizens before and after the institution of a countrywide mask mandate.

6. Interventions such as total lockdowns, social distancing, and compulsory mask use are
causing more harm than good. The genie (virus) is out of the bottle and the spread cannot
realistically be controlled at all by the current interventions.

7. Contact tracing and snitching should cease immediately.
8. AHS must come clean with Albertans and provide robust information on the unintended

consequences of lockdown measures which were initially well-intentioned but have now
proven to be harmful to Albertans’ mental, physical, emotional, psychological, spiritual, and
economic well-being; as well as lethal from suicide, drug overdose and inability to access
healthcare for serious non-COVID illness and conditions.
9. Finally, as healthcare is in your purview, please ensure that decisions come from your
government/AHS, and not from municipalities who do not have access to the necessary
resources and expertise to justify restrictions of any kind.

In conclusion, we have learned much over the past several months. Perhaps most important is the
knowledge that lockdowns are more lethal than COVID-19, which should compel you and your
government to end them. Your advice and policies for the benefit of Albertans should be predicated
on one important tenet of the Hippocratic Oath, “First Do No Harm”, and a focused approach will
achieve just that, as explained in the Great Barrington Declaration.

As for each of us Albertans, we must simply adapt and learn to accommodate to COVID-19, as we all
did every previous year with seasonal influenza. We must all take personal responsibility for our
health and take actions that are in each of our best interest, including vaccination if one is so inclined,
which may well be of benefit if one is COVID-19 negative. Healthcare, like all freedoms, must and
should always remain an informed choice, not a government directive.

Dennis L. Modry, BSc, MD, MSc, FRCS, FACCP, FACS
Clinical Associate Professor, Cardiothoracic Surgery, University of Alberta
Founder and Director of the Heart, Lung and Heart-Lung Transplant Program
Director of the Cardiovascular Intensive Care Unit (1984 – 2015)

Copyright ©2021 P a g e | 136 CovidReport.CV19News.ca

Chapter 7: FAKE NEWS

Copyright ©2021 P a g e | 137 CovidReport.CV19News.ca

For those of us who have been paying attention to the mainstream media’s
long-established track record of faking the news headlines over the years,
the following will not be much of a surprise.

In India, the current mantra from the MSM is that Covid cases and deaths
are going through the roof. If you believe these fear-inducing headlines,
then you are likely panicking that the same fate awaits us all. But if you
have even a little bit of intelligence and skepticism, you will soon find social
media posts from these SAME news agencies showing recycled images of
prior news stories that are being revived to push the Covid catastrophe
narrative. For example, observe these posts from the MSM:

India gas leak story 11 months ago vs. Covid in April 2021. Same
women, same dress, same puddle, different attending helper.

Copyright ©2021 P a g e | 138 CovidReport.CV19News.ca

India medical apathy story 3 years ago vs. Covid in April 2021. Same
women, same dress, same tank, different narrative.

Copyright ©2021 P a g e | 139 CovidReport.CV19News.ca

In Brazil, shot from a distance, apparent body bags outside a clinic
are later revealed to be bags of refuse as workers kick the bags into a
pile while the media spins the story into an overwhelming pandemic!
The actual video shows a woman kicking the bags with her foot which

fly through the air since they are merely filled with garbage. If this
event is real, then why does the media continually lie about it?

Copyright ©2021 P a g e | 140 CovidReport.CV19News.ca

Chapter 8: VACCINES

Copyright ©2021 P a g e | 141 CovidReport.CV19News.ca

THE COVID19 MRNA VACCINE: OR IS IT ONE?

Definition of Terms
Let’s start by defining several basic terms:

Immunity: Protection from an infectious disease. If you are immune to a disease, you can be exposed to it
without becoming infected.

Vaccine: A product that stimulates a person’s immune system to produce immunity to a specific disease,
protecting the person from that disease. Vaccines are usually administered through needle injections but
can also be administered by mouth or sprayed into the nose.

Vaccination: The act of introducing a vaccine into the body to produce immunity to a specific disease.

Immunization: A process by which a person becomes protected against a disease through vaccination. This
term is often used interchangeably with vaccination or inoculation.

References

Dr. David Martin: Butterfly of the Week, 11 Jan 2021 - Hidden in Plain Sight - Legal Definitions per Covid19 Vaccines
https://www.youtube.com/watch?v=p_hwJkhNo9w OR https://www.bitchute.com/video/UeNSBHAI2Jx1
Link to sources:
https://www.davidmartin.world/wp-content/uploads/2021/01/BotW_slides_01112021.pdf
Link to transcript:
http://www.davidmartin.world/wp-content/uploads/2021/01/BotW_transcript_01112021.pdf

It is unlawful under the FTC Act, 15 U.S.C. §41 et seq., to advertise that a product or service can prevent, treat, or
cure human disease unless you possess competent and reliable scientific evidence, including, when appropriate,
well-controlled human clinical studies, substantiating that the claims are true at the time they are made.

“The primary endpoint is the prevention of symptomatic COVID-19 disease. Key secondary endpoints include
prevention of severe COVID-19 disease and prevention of infection by SARS-CoV-2.

”https://investors.modernatx.com/news-releases/news-release-details/modernas-covid-19-vaccine-candidate-
meets-its-primary-
efficacy#:~:text=About%20the%20Phase%203%20COVE%20Study&text=The%20primary%20endpoint%20is%20the,
by%20SARS%2DCoV%2D2.

“As of this writing, no correlate of protection for SARS-CoV-2 has been established.”
https://www.nejm.org/doi/full/10.1056/NEJMoa2028436 “No existing vaccines have been shown to be effective
against infection with any betacoronavirus, the family that includes SARS-CoV-2, which causes Covid-19.” Polack FP,
Thomas SJ, Kitchin N, et al. Safety and efficacy of the BNT162b2 mRNA Covid-19 vaccine. N EnglJ Med2020;383:2603-
2615.

Copyright ©2021 P a g e | 142 CovidReport.CV19News.ca

In this groundbreaking
bombshell video expose
here, Dr. David Martin
explains that the purported
“mRNA vaccines” currently
be marketed by Phizer and
MODeRNA, and distributed
for use under an Emergency
Use Authorization (EUA)
classification, ARE NOT in
fact FDA-approved, ARE NOT
technically vaccines, DO NOT
prevent infections, and DO
NOT stop transmission.

https://www.youtube.com/watch?v=p_hwJkhNo9w OR https://www.bitchute.com/video/UeNSBHAI2Jx1

These companies call their products Gene Therapy Technologies, not vaccines. These facts are admitted to
in these company’s own SEC filings and clinical trial studies which were set up deliberately to NOT be able
to measure or study whether infection or transmission can be prevented which the case law, statutes, and
non-deceptive trade practices mandate that they must in order to be called vaccines and be given full legal
protection. Under the 1986 Vaccine Injury Act, manufacturers were given blanket immunity from lawsuits in
the event of injury or death related to their vaccines.

However, even under an EUA, that legal shield immunity disappears if unfair trade practices were engaged
in OR if the product is NOT a vaccine. Since both companies admit that their product offers neither
immunity from a virus nor do they prevent the transmission of one, they are legally and technically NOT a
vaccine. Yet the deceptive marketing practices that are being deployed have everyone believing that these
are vaccines which is a violation of the Fair Trade Act against deceptive marketing practices. All doctors,
medical personnel, retailers, manufacturers, politicians, media reporters and broadcasters who call these
products a vaccine, are also committing fraud through deception and are potentially liable for injury or
death caused by their promotion, recommendation, endorsement, or administration of these “vaccines”.

The amazing fact is that once the state of emergency is lifted, then ALL RT-PCR testing, masking,
lockdowns, and other mitigation measures must stop immediately. Since the products are not FDA-
approved, the manufacturers would instantly lose their liability protection once the SOE is lifted. This is why
Dr. Martin suggests that the state of emergency is likely being maintained: to provide the ongoing illusion
of legal protection under Operation Warp Speed. Once the truth comes out more widely, tens or hundreds
of thousands of lawsuits will likely emerge as a result of this fraud, and lawyers will have a field day for
medical injury cases arising from deaths and injuries caused by the “vaccines”.

See www.CV19News.ca under the RT-PCR Tests section, the Vaccines section, and the Guests section to
find plenty more research materials on this topic.

In particular, be sure to read this article about Dr. Carrie Madej and her whistleblower story about what is
really inside these so-called “vaccines”. This one article reveals the science behind these multibillion-dollar
products and the terrifying future that lies ahead for many who take this RNA-modifying injection.

See: https://cv19news.wixsite.com/main/post/the-moderna-microneedle-luciferase-hyrdogel-transfection-
nanoparticle-covid19-vaccine.

Copyright ©2021 P a g e | 143 CovidReport.CV19News.ca

MRNA COVID-19 VACCINES ARE REALLY ‘GENE THERAPY’
AND NOT VACCINES: ETHICIST

https://www.lifesitenews.com/news/mrna-covid-19-vaccines-are-
really-gene-therapy-and-not-vaccines-ethicist

The media and big pharma are part of a
'propaganda war' creating public confusion
with misleading claims, former University of
Virginia professor David Martin explained.

Podcast and Transcript.

https://www.westonaprice.org/podcast/its-gene-therapy-not-a-
vaccine

In direct contrast with mainstream media coverage and the claims of pharmaceutical companies, business
ethicist and former professor at the University of Virginia’s school of medicine Dr. David Martin, Ph.D said in an
interview that “mRNA is not a vaccination. It’s a gene therapy that was originally developed for cancer
treatment.” On top of that, Martin described the role the media have played in propagating falsehoods around
PCR testing for COVID-19.

Martin said that as part of a “propaganda war” a widespread conflation of terms has been promulgated by
media and research institutions, including Johns Hopkins University. According to Martin, the World Health
Organization (WHO) correctly distinguished SARS-CoV-2 as a virus and COVID-19 as a set of clinical
symptoms, but that confusion has arisen from a false “causal link” made by the media, reporting that SARS-
CoV-2 causes COVID-19.

Given that “the majority of people who test positive using the RT-PCR method for testing, for fragments of
what is associated with SARS-CoV-2 are not ill at all,” Martin asserted that “the illusion that the virus causes
a disease fell apart.” He also noted that, in the event of “5,000 new cases” being announced, for example,
there “may be several thousand positive PCR tests, but most of the people who have a positive test will never
have a single symptom. Most of the people who have symptoms do not have positive tests.”

To bolster his claim, Martin, who is a Batten Fellow at the University of Virginia’s Darden Graduate School of
Business Administration, cited the WHO, which said in February 2020 that “there should not be a conflation
between the two of these things.” One is a virus in their definition, and one is a set of clinical symptoms.”

Further clarifying, Martin said “COVID-19 is not a disease. It is a series of clinical symptoms. It is a giant
umbrella of things associated with what used to be associated with influenza and with other febrile
diseases,” including muscle pain, body ache, and fever.

After establishing reliability problems of PCR testing and the conflation of SARS-CoV-2 with COVID-19, Martin
explained why he thinks mRNA vaccines are falsely called vaccines, and that they work more like gene therapy.

According to Martin, a vaccination is typically understood as being a treatment “with an attenuated or alive
virus,” or a fragment thereof, which “is meant to keep you from getting an infection and it is meant to keep
you from transmitting the infection.”

Copyright ©2021 P a g e | 144 CovidReport.CV19News.ca

“The problem is that in the case of Moderna and Pfizer, this is not a vaccine. This is gene therapy,” he
continued. The Moderna and Pfizer creations send “a strand of synthetic RNA into the human being and is
invoking within the human being the creation of the S1 spike protein, which is a pathogen.”

“This is not only not keeping you from getting sick, it’s making your body produce the thing that makes you
sick,” Martin added.

The interviewer admitted that this description – that the injection makes one's body produce an effect that
makes one sick – sounds somewhat similar to the effect of vaccines.

But Martin countered that it is “not at all” like a vaccine, since “a vaccine is supposed to trigger immunity. It’s
not supposed to trigger you to make a toxin.”

“It’s not somewhat different. It’s not the same at all,” Martin explained. “It’s a means by which your body is
conscripted to make the toxin that then allegedly your body somehow gets used to dealing with, but unlike
a vaccine, which is to trigger the immune response, this is to trigger the creation of the toxin.”

Targeting the pharmaceutical companies behind the supposed vaccinations, Martin alleged that they have
manipulated clinical trial methodology to push their “vaccines” through development and production.

“They (pharmaceutical companies) said they could not test for the existence or absence of the virus and they
could not test for the transmissivity because they said it would be impractical. The companies themselves
have admitted to every single thing I’m saying, but they are using the public manipulation of the word vaccine
to co-opt the public into believing they’re getting a thing which they are not getting.”

Instead, Martin warns that an mRNA injection “is not going to stop you from getting coronavirus. It’s not going
to stop you from getting sick. In fact, on the contrary, it will make you sick far more often than the virus itself.”

Martin presented data confirming his claim, noting that after receiving their second shot of the jab, “80
percent of people had one or more clinical presentations of COVID-19,” whereas “80 percent of people who
have an infection according to RT-PCR have no symptoms at all.”

Explaining what the figures mean,
he said that people “will get
COVID-19 symptoms from getting
the gene therapy passed off as a
vaccine. You will get COVID
symptoms from that 80 percent of
the time. If you’re exposed to
SARS-CoV-2 according to RT-PCR
(positive PCR test), 80 percent of
the time you will have no
symptoms at all.”

Looking more closely at the claims emanating from the clinical trials, Martin questioned the integrity of
companies developing mRNA “gene therapy technology.”

Copyright ©2021 P a g e | 145 CovidReport.CV19News.ca

“A human being is going to be potentially exposed to
unclassified, both short-term and long-term, risks of altering
their RNA and DNA from exposure to this gene therapy,”
Martin warned. Of the 40,000 participants in Moderna’s
clinical trial, Martin noted that only a “few hundred people
had a few days less severe symptoms with the gene therapy
when compared to the other control group.”

Even this, he said, is unreliable information, as the
pharmaceutical firms “separate out adverse events from actual
COVID symptoms.” This allowed the companies to reclassify “a lot of what would have been considered to be
COVID symptoms by calling them adverse events,” giving rise to “this ridiculous 90 percent plus effectiveness.”

“As a result of that, we have both a methodology problem, which by the way, has been criticized by a number
of clinical scientists. The bigger problem is that they’re still not measuring viral susceptibility and viral
transmission. Those are the two legs of the stool that is (sic) required for anyone to say that they are
vaccinating a population for public health reasons.”

Martin advised that “this (gene therapy) is not a prophylactic, this is not helping us, we are being told to take a
treatment for a disease we don’t have and most likely will not have.” To demonstrate the absurdity of the
situation, Martin likened it to a government health order stating that “everybody needs to take
chemotherapy for the cancer they might get ... that’s exactly what is happening.”

“And we are being told that using careful marketing manipulation and propaganda, calling these things
vaccines for public health,” Martin warned, saying that “mRNA is a gene therapy … that was originally
developed for cancer treatment. This is not a vaccination.”

Turning his attention back to PCR testing, Martin lamented that “the PCR test has never been approved as a
diagnostic. It is not diagnostic. There’s nothing about taking a PCR test that does anything other than
reinforce a propaganda narrative. It doesn’t tell you anything.”

Martin also pointed out that hospitals are not testing patients for influenza in his view because governments
“don’t want to admit the fact that the majority of people who are in hospital, who are sick and who are dying,
are experiencing exactly the same thing that’s happened every year, which is influenza-like, flu-like and
pneumonia-like illness.”

Martin concluded that the “only reason we are using PCR tests is that governors and the Department of
Health and Human Services are maintaining a state of emergency. The second that that state of emergency is
lifted in any state or in the country, the PCR test won’t be allowed to be used.”

He explained that the state of emergency allows manufacturers to leapfrog certain regulations “because the
emergency use authorization falls with the state of emergency.”

“The gene therapy that Moderna and Pfizer are doing – both of those would be suspended immediately if
the state of emergency got lifted.”

Eager to demonstrate that the entire COVID-19 vaccination program is a farce, Martin explained that “if you lift
the state of emergency, the whole house of cards falls.”

Copyright ©2021 P a g e | 146 CovidReport.CV19News.ca

VACCINES – THE REAL END GAME OF THE PLANDEMIC

It should be abundantly clear to you by now,
assuming you have reviewed the entire
report to this point, that mandatory
vaccinations are the end game of this
tyrannical medical fraud being perpetrated
on the human race. Even if you don’t
recognize that truth yet, or even believe that
it could be true, the point is moot. The real
questions to ask are: What is in the vaccine?
Are they really safe and effective? And
should I take a shot?

In short, DO NOT TAKE THESE VACCINES! Here is a list of some highly-credentialled experts, both pro-vaccine
and anti-vaccine, who explain why not. To see more content from them and others, be sure to visit the guest
index at www.guests.cv19news.ca, search for your guest, and enjoy the many articles, videos, and podcasts
from them. We are always adding to the content of each guest so do check back often.

Dr. Mike Yeadon Allergy & Respiratory Therapeutic Area expert with 23 years in the
pharmaceutical industry; was VP and Chief Scientific Officer (Allergy
http://dryeadon.cv19news.ca & Respiratory Research) with Pfizer. He trained as a biochemist and
pharmacologist, obtaining his PhD from the University of Surrey (UK)
Dr. Geert Vanden Bossche in 1988. Dr. Yeadon has published over 40 original research articles.
PhD, DVM, 30-year veteran vaccine developer with big pharma: GSK
http://drvandenbossche.cv19news.ca Biologicals (Glaxo Smith Klein), Novartis Vaccines and Diagnostics,
Solvay Biologicals, Bill & Melinda Gates Foundation (BMGF), Global
Dr. Carrie Madej Alliance for Vaccines and Immunization (GAVI), Univac, German
Centre for Infection Research (DZIF), VERACO.
http://drmadej.cv19news.ca Internal medicine specialist; over 20 years of experience in
bioscience, osteopathic medicine, vaccine researcher
Dr. Sherry Tenpenny 20+ years of experience researching vaccines with over 40,000 hours
into research and has conducted over 400 interviews about Covid19
http://drtenpenny.cv19news.ca just in the year 2020. No one is better qualified on this topic.
Corporate Advisor, Entrepreneur, Financier, Storyteller, Professor,
Dr. David Martin Inventor, and medical researcher. He uncovers corporate crime!

http://drmartin.cv19news.ca PhD, biochemist and molecular biologist who worked in top
government labs on the Ebola, HIV, and coronaviruses like SARS.
Dr. Judy Mikovits MD, JD, FABEM, Founder of America’s Frontline Doctors (AFLDS) “the
doctor who went viral,” is a board-certified emergency physician and
http://drmikovits.cv19news.ca author of the best-selling book “I Do Not Consent: My Fight Against
Medical Cancel Culture.” She is also a lawyer.
Dr. Simone Gold MD, Physician, Radio Host, and Best-Selling Author, president of the
American Academy of Biologically Identical Hormone Therapy
http://drgold.cv19news.ca (AABIHT) and a member of the Pan American Allergy Society (PAAS)
and the Association of American Physicians and Surgeons (AAPS).
Dr. Steven Hotze

http://drhotze.cv19news.ca

Copyright ©2021 P a g e | 147 CovidReport.CV19News.ca

Dr. Sucharit Bhakdi Post-doctoral researcher at the Max Planck Institute of
Immunobiology and Epigenetics, The Protein Laboratory in
http://drbhakdi.cv19news.ca Copenhagen, Associate Professor Institute of Medical Microbiology at
Giessen University, chair of Medical Microbiology at the University of
Dr. Lee Merritt Mainz. Published 300+ articles in the fields of immunology,
bacteriology, virology, and parasitology, for which he has received
http://drmerritt.cv19news.ca numerous awards and the Order of Merit of Rhineland-Palatinate.
Graduated University of Rochester School of Medicine and Dentistry,
Dr. Vernon Coleman life membership Alpha Omega Alpha Honor Medical Society,
Orthopedic Surgery Residency - US Navy, served 9 years as a Navy
http://drcoleman.cv19news.ca physician and surgeon; private practice of Orthopedic and Spinal
Surgery since 1995, Board of the Arizona Medical Association, past
Dr. Andrew Wakefield president of the Association of American Physicians & Surgeons,
Fellowship Certified American Academy of Anti-Aging Medicine.
http://drwakefield.cv19news.ca British general practitioner, principal and former Professor of Holistic
Medical Sciences, and author of over 100 published books
Professor Delores Cahill MD since 1981; Academic gastroenterologist; CDC whistleblower
confident and writer/producer of the acclaimed film VaXXed!
http://dolorescahill.cv19news.ca Professor, Molecular Biologist/Immunologist, Professor, University
College Dublin (2005-2021), Group Leader, Max-Planck-Institute,
Berlin, Germany (1995-2003), Supervisor of completed PhD &
Masters’ degree students in Germany and Ireland. Holds several
granted and licensed international patents (EU, USA, Japan, Australia)
(1995-present) and peer reviewed publications, and reports.

THE EXPERTS SPEAK OUT

So, what do these experts have to say about these
so-called “vaccines”? As Dr. David Martin explains in
the previous section, these drug products are
experimental “gene therapy technologies” as
admitted to by the drug companies themselves in
their own SEC securities filings and marketing
material. They are not FDA approved but merely
authorized for emergency use while under a state of
emergency. This status allows health authorities to
push these experimental products with full legal immunity if you get injured from the injection. This
unwarranted experiment on the entire human race is designed to last for 2 years before the FDA can authorize
the products at the end of the “clinical trials” with you as the guinea pig.

Covid19 vaccines DO NOT prevent infection or stop transmission!

See https://www.lifesitenews.com/news/mrna-covid-19-vaccines-are-really-gene-therapy-and-not-vaccines-ethicist for the
written explanation and our Bitchute post https://www.bitchute.com/video/UeNSBHAI2Jx1 for the video explanation
by Dr. David Martin.

Copyright ©2021 P a g e | 148 CovidReport.CV19News.ca

MRNA VACCINES – WHAT YOU NEED TO KNOW

On May 13, 2021, Dr. Richard Fleming stated to The High Wire’s Del Bigtree in the episode called IS
COVID-19 A BIO-WEAPON? that these Covid19 so-called “vaccines” are essentially gain-of-function
Bioweapons that produce BILLIONS of spike proteins within the body that the immune system must
then mount an immune response against. The problem is that the wild virus infection is very mild for
most people and, given the low viral load exposure needed to stimulate sufficient neutralizing
antibodies, no vaccine is even needed. The major risk, however, is that Antibody Dependent
Enhancement will prime the person’s immune system to severely overreact to the spike proteins
upon a future exposure, which could lead to sepsis shock and even death. He states further that these
vaccines DO NOT provide ANY protection against contracting Covid19 and DO NOT stop
transmission. Their sole clinical end point purpose is to merely reduce at least one symptom within 14
days of injection. Of course, bed rest, Neo Citron, and chicken noodle soup would do the same thing.
The clinical trials were designed to show a reduction in one or more symptoms and that is how the
efficacy numbers were determined for negligible rates of mitigation. No infection antigenicity was
ever measured or contemplated in the “vaccine” trials!

Image from 37:35 of https://thehighwire.com/videos/is-covid-19-a-bio-weapon

The origins of Covid19 are becoming increasingly clear, and Dr. Richard Fleming, cardiologist and researcher, walks
Del Bigtree of The Highwire through a shocking paper trail surrounding the SARS-CoV2 virus and its link to Tony Fauci
and the US-funded gain-of-function research that helped fund the Wuhan Institute of Virology, the very biolab where the

entire event began in December 2019. This shocking exposé reveals even more truth behind this plandemic.

Watch the video on our Bitchute at https://www.bitchute.com/video/mzh8gSqBKWMn

Copyright ©2021 P a g e | 149 CovidReport.CV19News.ca

MUST WATCH VIDEO: CV19News - Dr. Sherri Tenpenny - Medical
Doctor Exposes Mass Eugenics Extermination Called 'Covid-19

https://www.bitchute.com/video/YRTeZRitvjT1

Dr. Tenpenny is an integrative medicine physician in Cleveland, OH who has studied vaccine
problems for over 20 years, she has read thousands of mainstream medical scientific papers and has
put in over 40,000 hours of study on these issues. She is THE worldwide expert on vaccines.

COVID-19 is an acronym for Certificate of Vaccine Identification Artificial Intelligence. Certificate
of Vaccine Identification 19 (A is letter 1 and I is letter 9; thus 19 => AI).

The survival rate with the virus without the vaccine is 99.91%.

Summary Transcript from the video

“It takes at least 6 weeks from the time you get your injection for the spike antibody to start to
develop. The immunologist I spoke to said warned that these vaccines will create autoimmune
diseases. For somewhere between 3 months and 20 years, we are going to see this process go on in
perpetuity, because it can take anywhere from 2 years to 19 years to get full blown auto-immune
disease. I think we will see massive injuries and a lot more deaths starting somewhere between 4 and
18 months from now. This vaccine will permanently alter your immune system.”

Here are some points that she makes about this messenger RNA (mRNA) technology:

o This new type of shot does not meet any of the CDC’s own criteria for a vaccine.
o it does not prevent infection nor stop transmission by the manufacturers’ own admissions.
o it does not keep you from getting sick and does not change the death rate.
o it merely reduces at least one symptom within 14 days with 94% reported efficacy.

o it is NOT like getting another flu shot.
o you will still have to wear a mask and social distance after taking the shot.
o the mRNA instructs your ribosome to produce the coronavirus spike protein with the hope that

your immune system will mount an antibody response to it.
o the messenger RNA codes for the spike protein to induce the body to develop an antibody against

that spike protein. When you get the spike antibody in your system, it will permanently and
irreversibly change your immune system. Next time you come in contact with a virus, the
antibody should block you from getting sick. However, not only does it not stop you from getting

Copyright ©2021 P a g e | 150 CovidReport.CV19News.ca