The words you are searching are inside this book. To get more targeted content, please make full-text search by clicking here.
Discover the best professional documents and content resources in AnyFlip Document Base.
Search
Published by Marvin's Underground Latino USA, 2018-08-08 14:00:29

Biologia.molecular

Biologia.molecular

Fundamentos y aplicaciones
en las ciencias de la salud



Fundamentos y aplicaciones
en las ciencias de la salud

ERRNVPHGLFRV RUJ

Adriana María Salazar Montes

Instituto de Biología Molecular en Medicina, Centro Universitario de Ciencias de la Salud
Universidad de Guadalajara

Ana Soledad Sandoval Rodríguez

Instituto de Biología Molecular en Medicina, Centro Universitario de Ciencias de la Salud
Universidad de Guadalajara

Juan Socorro Armendáriz Borunda

Instituto de Biología Molecular en Medicina, Centro Universitario de Ciencias de la Salud
Universidad de Guadalajara

O.P.D. Hospital Civil de Guadalajara “Dr. Juan I. Menchaca”

.­9*$0 r #0(05Á r #6&/04 "*3&4 r $"3"$"4 r (6"5&."-" r ."%3*% r /6&7" :03,
4"/ +6"/ r 4"/5*"(0 r 4"0 1"6-0 r "6$,-"/% r -0/%3&4 r .*-¦/ r .0/53&"-
/6&7" %&-)* r 4"/ '3"/$*4$0 r 4*/("163 r 45 -06*4 r 4*%/&: r 5030/50

Director editorial: Javier de León Fraga
Editor sponsor: Emilio Salas Castillo
Editor de desarrollo: Héctor F. Guerrero Aguilar
Supervisor de producción: Juan José Manjarrez de la Vega

NOTA
La medicina es una ciencia en constante desarrollo. Conforme surjan nuevos conocimientos, se requerirán cambios de la
terapéutica. El(los) autor(es) y los editores se han esforzado para que los cuadros de dosificación medicamentosa sean preci-
sos y acordes con lo establecido en la fecha de publicación. Sin embargo, ante los posibles errores humanos y cambios en la
medicina, ni los editores ni cualquier otra persona que haya participado en la preparación de la obra garantizan que la infor-
mación contenida en ella sea precisa o completa, tampoco son responsables de errores u omisiones, ni de los resultados que
con dicha información se obtengan. Convendría recurrir a otras fuentes de datos, por ejemplo, y de manera particular, habrá
que consultar la hoja informativa que se adjunta con cada medicamento, para tener certeza de que la información de esta
obra es precisa y no se han introducido cambios en la dosis recomendada o en las contraindicaciones para su administración.
Esto es de particular importancia con respecto a fármacos nuevos o de uso no frecuente. También deberá consultarse a los
laboratorios para recabar información sobre los valores normales.

BIOLOGÍA MOLECULAR

Fundamentos y aplicaciones en las ciencias de la salud

Prohibida la reproducción total o parcial de esta obra,
por cualquier medio, sin autorización escrita del editor.

DERECHOS RESERVADOS © 2013, respecto a la primera edición en español por,
McGRAW-HILL INTERAMERICANA EDITORES, S.A. de C. V.

Prolongación Paseo de la Reforma 1015, Torre A, Piso 17, Col. Desarrollo Santa Fe,
Delegación Álvaro Obregón
C. P. 01376, México, D. F.
Miembro de la Cámara Nacional de la Industria Editorial Mexicana Reg. No. 736

ISBN: 978-607-15-0912-3

1234567890 2456789013

Impreso en México Printed in Mexico

Editores

Adriana María Salazar Montes Centro de Investigaciones Médicas Aplicadas. Es profesora
investigadora del Instituto de Biología Molecular en Medi-
Licenciada en Biología. Maestra en Ciencias en Biología cina y Terapia Génica, responsable del área de Terapia
Celular. Doctorado en Ciencias en Biología Molecular en Celular. Es profesora del Doctorado en Ciencias en Biología
Medicina. Universidad de Guadalajara. Posdoctorado en la Molecular en Medicina de la Universidad de Guadalajara.
Universidad de Tuffs, Boston, Estados Unidos. En la actualidad es editora asociada de la Revista Archivos
de Ciencias, órgano oficial del Centro Universitario de
Obtuvo Doctorado en la Universidad de Guadalajara en Ciencias de la Salud.
el área de Biología Molecular y realizó su estancia posdoc-
toral en la Universidad de Tuffs, en Boston, Estados Unidos. Juan Armendáriz Borunda
Es profesora investigadora y en este momento encargada
del Instituto de Biología Molecular en Medicina y Terapia Licenciado en Farmacología. Maestría y Doctorado en Bio-
Génica. Es profesora del Doctorado en Ciencias en Biología química en el Centro de Investigaciones y Estudios Avanza-
Molecular en Medicina y del Doctorado en Farmacología dos del Instituto Politécnico Nacional. Posdoctorado en la
de la Universidad de Guadalajara. En la actualidad es edito- Universidad de Tennessee, Memphis, Estados Unidos.
ra asociada de la Revista Archivos de Ciencias, órgano ofi-
cial del Centro Universitario de Ciencias de la Salud. Obtuvo Doctorado en Bioquímica en el Centro de
Investigaciones y Estudios Avanzados del Instituto Politéc-
Ana Soledad Sandoval Rodríguez nico Nacional, y Posdoctoral en la Universidad de Tennes-
see, Memphis, Estados Unidos. Es profesor investigador del
Quimicofarmacobióloga de formación con Doctorado en Instituto de Biología Molecular en Medicina y Terapia
Ciencias Biomédicas, con orientación en Inmunología. Génica y actualmente jefe del Departamento de Biología
Universidad de Guadalajara. Posdoctorado en el Centro de Molecular y Genómica. Es profesor del Doctorado en Cien-
Investigaciones Médicas Aplicadas de la Universidad de cias en Biología Molecular en Medicina, del Doctorado en
Navarra, en España. Genética y del Doctorado en Ciencias Biomédicas de la
Universidad de Guadalajara. En la actualidad es editor de la
Obtuvo Doctorado en la Universidad de Guadalajara en Revista Archivos de Ciencias, órgano oficial del Centro Uni-
el área de las Ciencias Biomédicas. Realizó su estancia pos- versitario de Ciencias de la Salud.
doctoral en la Universidad de Navarra, en España, en el

iii

Colaboradores

Blanca Estela Alcántar Díaz Adriana Díaz Rivera

Doctora en Ciencias en Biología Molecular en Medicina. Licenciatura en Biología. Doctorado en Ciencias en
Universidad Autónoma de Nayarit. Biología Molecular en Medicina. Centro Universitario
de Ciencias de la Salud, Universidad de Guadalajara.
Bertha Adriana Álvarez Rodríguez
Martha Escoto Delgadillo
Doctora en Genética. Departamento de Biología
Molecular y Genómica, Centro Universitario de Doctora en Ciencias en Biología Celular. Instituto de
Ciencias de la Salud, Universidad de Guadalajara. Patología Infecciosa y Experimental “Dr. Francisco Ruiz
Sánchez” de la Universidad de Guadalajara. Centro de
Juan Armendáriz Borunda Investigaciones Biomédicas de Occidente, Instituto
Mexicano del Seguro Social.
Doctor en Bioquímica. Instituto de Biología Molecular en
Medicina y Terapia Génica, Departamento de Biología Lucía Flores Contreras
Molecular y Genómica, Centro Universitario de
Ciencias de la Salud, Universidad de Guadalajara. Licenciatura en Biología. Doctorado en Genética. Centro
Universitario de Ciencias de la Salud, Universidad de
Blanca Estela Bastidas Ramírez Guadalajara.

Doctora en Ciencias en Biología Molecular en Medicina. Jorge Fernando Floresvillar Mosqueda
Instituto de Enfermedades Crónico Degenerativas,
Departamento de Biología Molecular y Genómica, Licenciatura en Microbiología. Doctorado en Ciencias
Centro Universitario de Ciencias de la Salud, Biomédicas. Orientación Inmunológica. Centro
Universidad de Guadalajara. Universitario de Ciencias de la Salud, Universidad de
Guadalajara.
Óscar Gabriel Béjar Mejía
Jesús Javier García Bañuelos
Licenciatura en Deportes. Especialidad en Natación.
Consejo Municipal del Deporte de Guadalajara. Doctor en Ciencias en Biología Molecular en Medicina.
Instituto de Biología Molecular y Terapia Génica,
Miriam Ruth Bueno Topete Departamento de Biología Molecular y Genómica,
Centro Universitario de Ciencias de la Salud,
Doctora en Ciencias en Biología Molecular en Medicina. Universidad de Guadalajara.
Instituto de Enfermedades Crónico Degenerativas,
Centro Universitario de Ciencias de la Salud, Belinda Claudia Gómez Meda
Universidad de Guadalajara.
Doctora en Genética. Instituto de Biología Molecular en
Paola B. Castro García Medicina y Terapia Génica, Departamento de Biología
Molecular y Genómica, Centro Universitario de
Doctora en Neurociencias. Posdoctoral en Division of Ciencias de la Salud, Universidad de Guadalajara.
Stem Cell Biology. Institute for Genetic Medicine,
Hokkaido University.

iv

Colaboradores v

Jaime González Cuevas Selene Guadalupe Huerta Olvera

Doctor en Ciencias en Biología Molecular en Medicina. Doctora en Toxicología. Departamento de Ciencias
Instituto de Biología Molecular en Medicina y Terapia Médicas y de la Vida, Centro Universitario de la
Génica, Departamento de Biología Molecular y Ciénega, Universidad de Guadalajara. OPD Hospital
Genómica, Centro Universitario de Ciencias de la Civil de Guadalajara “Dr. Juan I. Menchaca”.
Salud, Universidad de Guadalajara.
María Cristina Islas Carbajal
Angélica Sofía González Garibay
Doctora en Ciencias en Biología Molecular en
Licenciatura en Nutrición. Doctorado en Ciencias en Medicina. Instituto de Investigación Cardiovascular,
Biología Molecular en Medicina. Centro Universitario Departamento de Fisiología, Centro Universitario de
de Ciencias de la Salud, Universidad de Guadalajara. Ciencias de la Salud, Universidad de Guadalajara.

Daniela Gordillo Bastidas David Alejandro López de la Mora

Doctora en Ciencias en Biología Molecular en Medicina. Licenciatura en Quimicofarmacobiólogo. Doctorado en
Coordinación de la Carrera de Nutrición, Instituto Ciencias en Biología Molecular en Medicina. Centro
Tecnológico y de Estudios Superiores de Monterrey. Universitario de Ciencias de la Salud, Universidad de
Guadalajara.
Elizabeth Gordillo Bastidas
Alfonso López Vázquez
Doctora en Ciencias en Biología Molecular en Medicina.
Departamento de Biología Molecular y Genómica, Licenciatura en Médico Cirujano Partero. Doctorado en
Centro Universitario de Ciencias de la Salud, Ciencias en Biología Molecular en Medicina. Centro
Universidad de Guadalajara. Universitario de Ciencias de la Salud, Universidad de
Guadalajara.
César Guardado Mora
José Guadalupe Macías Barragán
Licenciatura en Quimicofarmacobiólogo. Instituto de
Biología Molecular en Medicina y Terapia Génica, Doctor en Ciencias Biomédicas. Orientación
Departamento de Biología Molecular y Genómica, Inmunológica. Departamento de Ciencias Naturales y
Centro Universitario de Ciencias de la Salud, Exactas, Centro Universitario de los Valles, Universidad
Universidad de Guadalajara. de Guadalajara.

Carmen Magdalena Gurrola Díaz Ana Laura Márquez Aguirre

Doctorado en Ciencias, Patología Molecular y Biología Doctorado en Ciencias Biomédicas con Orientación en
Molecular del Cáncer. Instituto de Enfermedades Inmunología. Centro de Investigación y Asistencia en
Crónico Degenerativas, Departamento de Biología Tecnología y Diseño del Estado de Jalisco.
Molecular y Genómica, Centro Universitario de
Ciencias de la Salud, Universidad de Guadalajara. Abril Bernardette Martínez Rizo

Zamira Helena Hernández Nazará Doctora en Ciencias Biomédicas. Orientación
Inmunológica. Universidad Autónoma de Nayarit.
Doctora en Ciencias en Biología Molecular en Medicina.
Instituto de Enfermedades Crónico Degenerativas, Carlos Mata Munguía
Departamento de Biología Molecular y Genómica,
Centro Universitario de Ciencias de la Salud, Doctor en Genética. Centro de Investigaciones Biomédicas
Universidad de Guadalajara. de Occidente, Instituto Mexicano del Seguro Social.

Luis Daniel Hernández Ortega Mayra Guadalupe Mena Enríquez

Licenciatura en Quimicofarmacobiólogo. Doctorado en Licenciatura en Biología. Doctorado en Genética. Centro
Ciencias en Biología Molecular en Medicina. Centro Universitario de Ciencias de la Salud, Universidad de
Universitario de Ciencias de la Salud, Universidad de Guadalajara.
Guadalajara.

vi Colaboradores

Alejandra Meza Ríos María Guadalupe Sánchez Parada

Licenciatura en Quimicofarmacobiólogo. Doctorado en Licenciatura en Médico Cirujano Partero. Doctorado en
Ciencias en Biología Molecular en Medicina. Centro Genética. Centro Universitario de Ciencias de la Salud,
Universitario de Ciencias de la Salud, Universidad de Universidad de Guadalajara.
Guadalajara.
Ana Soledad Sandoval Rodríguez
Silvia Mora Lee
Doctora en Ciencias Biomédicas. Orientación
Doctora en Neurociencias. Laboratorio de Ciencias Inmunológica. Instituto de Biología Molecular en
Biomédicas y Biotecnología, Departamento de Ciencias Medicina y Terapia Génica, Departamento de Biología
Naturales y Exactas, Centro Universitario de los Valles, Molecular y Genómica, Centro Universitario de
Universidad de Guadalajara. Ciencias de la Salud, Universidad de Guadalajara.

José Navarro Partida Pablo Manuel Saucedo Galindo

Doctor en Ciencias en Biología Molecular en Medicina. Entrenador.
Instituto de Biología Molecular en Medicina y Terapia
Génica, Departamento de Biología Molecular y Eduardo Vázquez Valls
Genómica, Centro Universitario de Ciencias de la
Salud, Universidad de Guadalajara. Maestro en Ciencias en Biología Celular. Instituto de
Patología Infecciosa y Experimental “Dr. Francisco Ruiz
Viviana Carolina Núñez Valdez Sánchez” de la Universidad de Guadalajara. Centro de
Investigaciones Biomédicas de Occidente, Instituto
Licenciatura en Biología. Doctorado en Ciencias en Mexicano del Seguro Social.
Biología Molecular en Medicina. Centro Universitario
de Ciencias de la Salud, Universidad de Guadalajara. José María Vera Cruz

Ana Rosa Rincón Sánchez Doctor en Ciencias en Biología Molecular en Medicina.
Instituto de Biología Molecular en Medicina y Terapia
Doctora en Farmacología. Instituto de Investigación Génica, Departamento de Biología Molecular y
Cardiovascular, Departamento de Fisiología, Centro Genómica, Centro Universitario de Ciencias de la
Universitario de Ciencias de la Salud, Universidad de Salud, Universidad de Guadalajara.
Guadalajara.
Ana Lourdes Zamora Pérez
Samantha Rivero-Borrel Sandoval
Doctora en Genética. Instituto de Investigación en
Licenciatura en Médico Cirujano Partero. Centro Odontología, Departamento de Clínicas Odontológicas
Universitario de Ciencias de la Salud, Universidad de Integrales, Centro Universitario de Ciencias de la Salud,
Guadalajara. Universidad de Guadalajara.

Adriana María Salazar Montes Guillermo Moisés Zúñiga González

Doctora en Ciencias en Biología Molecular en Medicina. Doctor en Genética. Laboratorio de Mutagénesis, División
Instituto de Biología Molecular en Medicina y Terapia de Medicina Molecular, Centro de Investigación
Génica, Departamento de Biología Molecular y Biomédica de Occidente, Instituto Mexicano del Seguro
Genómica, Centro Universitario de Ciencias de la Social.
Salud, Universidad de Guadalajara.

Laura Verónica Sánchez Orozco

Doctora en Ciencias en Biología Molecular en Medicina.
Instituto de Enfermedades Crónico Degenerativas,
Centro Universitario de Ciencias de la Salud,
Universidad de Guadalajara.

Contenido

Prólogo Capítulo 5

Parte I 1 Transcripción 44

Conceptos básicos Zamira Helena Hernández Nazará
de biología molecular
Capítulo 6
Capítulo 1 3
Traducción 52
Historia de la biología molecular 66
José María Vera Cruz
José María Vera Cruz Bertha Adriana Álvarez Rodríguez
Adriana María Salazar Montes Belinda Claudia Gómez Meda
César Guardado Mora
Juan Armendáriz Borunda Capítulo 7

Capítulo 2 Regulación de la expresión génica

Ciclo celular 15 Adriana María Salazar Montes
Ana Soledad Sandoval Rodríguez
Blanca Estela Alcántar Díaz Juan Armendáriz Borunda
Luis Daniel Hernández Ortega
Adriana María Salazar Montes Capítulo 8

Capítulo 3 25 Mutaciones 75

Estructura de ácidos nucleicos María Guadalupe Sánchez Parada
Belinda Claudia Gómez Meda
José Navarro Partida
Mayra Mena Enríquez Capítulo 9

Capítulo 4 Mecanismos de reparación
del ADN 82
Replicación 36
Mayra Guadalupe Mena Enríquez
Jorge Fernando Floresvillar Mosqueda Lucía Flores Contreras
José Guadalupe Macías Barragán Ana Soledad Sandoval Rodríguez
Juan Armendáriz Borunda

vii

viii Contenido

Parte II Capítulo 16

Metodología del ADN Reacción en cadena
recombinante 91 de la polimerasa 145

Capítulo 10 93 Ana Soledad Sandoval Rodríguez
Alejandra Meza Ríos
Manejo de muestras Jorge Fernando Floresvillar Mosqueda
para estudios moleculares
Capítulo 17
Jesús Javier García Bañuelos
Blanca Estela Bastidas Ramírez Secuenciación del ADN
Elizabeth Gordillo Bastidas y microarreglos 160
Daniela Gordillo Bastidas
Belinda Claudia Gómez Meda
Capítulo 11 Guillermo Moisés Zúñiga González
José María Vera Cruz
Métodos de extraccción de ácidos Bertha Adriana Álvarez Rodríguez
nucleicos 99
Capítulo 18
Ana Soledad Sandoval Rodríguez
Abril Bernardette Martínez Rizo Polimorfismos de ADN
David Alejandro López de la Mora y huella genética 171

Capítulo 12 Belinda Claudia Gómez Meda
Ana Lourdes Zamora Pérez
Electroforesis 110 María Guadalupe Sánchez Parada

David Alejandro López de la Mora Parte III
Ana Soledad Sandoval Rodríguez
Bases moleculares
Capítulo 13 de las enfermedades 181

Enzimas de restricción 120 Capítulo 19

Jaime González Cuevas Bases moleculares
Miriam Ruth Bueno Topete de las patologías humanas
Ana Soledad Sandoval Rodríguez
José Macías Barragán
Selene Guadalupe Huerta Olvera 183

Capítulo 14 Capítulo 20 191

Vectores de clonación Enfermedades monogénicas
y expresión 127
Silvia Mora Lee
Ana Soledad Sandoval Rodríguez Paola B. Castro García
Mayra Mena Enríquez
Ana Laura Márquez Aguirre

Capítulo 15 139 Capítulo 21

Técnicas de hibridación Bases moleculares del cáncer 197

Miriam Ruth Bueno Topete Carmen Magdalena Gurrola Díaz
Jaime González Cuevas

Contenido ix

Capítulo 22 Adriana María Salazar Montes
Adriana Díaz Rivera

Bases moleculares 204 Capítulo 28
de la diabetes mellitus
Animales transgénicos
Ana Rosa Rincón Sánchez y clonación 268
María Cristina Islas Carvajal
Jesús Javier García Bañuelos
Capítulo 23 Blanca Estela Bastidas Ramírez
Juan Armendáriz Borunda
Bases moleculares
de la obesidad 218 Capítulo 29

Blanca Estela Bastidas Ramírez Nutrigenómica 277
Angélica Sof ía González Garibay y nutrigenética
Alfonso López Vázquez
Viviana Carolina Núñez Valdez

Capítulo 24 Blanca Estela Bastidas Ramírez
Jesús Javier García Bañuelos
Bases moleculares Elizabeth Gordillo Bastidas
de la hepatitis B 227 Daniela Gordillo Bastidas

Laura Verónica Sánchez Orozco Capítulo 30
Miriam Ruth Bueno Topete
Juan Armendáriz Borunda Biología molecular
del deporte 287
Capítulo 25
Óscar Gabriel Béjar Mejía
Bases moleculares Ana Soledad Sandoval Rodríguez
de la hepatitis C 235C Pablo Manuel Saucedo Galindo
Samantha Rivero-Borrel Sandoval
Laura Verónica Sánchez Orozco
David A. Fernández Galindo Capítulo 31
Miriam Ruth Bueno Topete
Juan Armendáriz Borunda Dopaje génico 298

Capítulo 26 Ana Soledad Sandoval Rodríguez
Óscar Gabriel Béjar Mejía
Bases moleculares del virus de la Adriana María Salazar Montes
inmunodeficiencia humana 241 Jesús Javier García Bañuelos

Martha Escoto Delgadillo Capítulo 32
Carlos Mata Munguía
Eduardo Vázquez Valls Proyecto del Genoma Humano:
aportaciones a la medicina 305
Parte IV
Adriana María Salazar Montes
Tópicos selectos 255 Luis Daniel Hernández Ortega
Juan Armendáriz Borunda
Capítulo 27
Índice alfabético
Terapia génica 257

Ana Soledad Sandoval Rodríguez
Juan Armendáriz Borunda

Agradecimientos

Escribir un libro de texto es tarea muy complicada, pero conocimientos en las diferentes ramas y aplicaciones de la
si este trabajo se concluye de manera exitosa es en buena Biología Molecular.
medida gracias a las personas que influyen en su realiza-
ción. Queremos manifestar nuestro agradecimiento a quie- A los alumnos de los cursos de Biología Molecular de
nes, de forma directa o indirecta, contribuyeron al resultado pregrado y posgrado, quienes con sus preguntas, dudas y
que el lector tiene en sus manos. comentarios enriquecieron los temas que abarca este libro.
Mucho de lo que aprendimos respecto de la manera de
En primer lugar, a los miembros del comité editorial, redactar dichos temas con mayor claridad fue impartiendo
con cuyos comentarios y nuestras discusiones sobre los estos cursos. Gracias a todos ellos.
temas y capítulos estuvieron siempre solícitos a enriquecer
el contenido con sus puntos de vista, a cualquier hora del A la editorial McGraw-Hill, que tuvo gran paciencia
día. con este proyecto y perseveró en su edición, corrección y
elaboración. Por su enorme entusiasmo y dedicación, nues-
A todos y cada uno de los colaboradores de los capí- tro sincero agradecimiento.
tulos que conforman esta obra, por el tiempo dedicado y
el empeño dispuesto para que este libro de texto sea com- Los autores
prensible al alumno de pregrado, donde comparten sus

x

Prólogo

El enorme avance de la biología molecular en los últimos que ocurren dentro de nuestras células, de las principales
sesenta años ha venido a revolucionar la manera de visuali- técnicas empleadas en un laboratorio de biología molecular
zar la medicina y la biología en general. En el área de la bio- para su estudio y aplicadas al diagnóstico, y de qué manera,
logía molecular, todos los días se publican datos nuevos que con ayuda de la biotecnología y la ingeniería genética, estos
nos permiten una mejor comprensión y un entendimiento procesos pueden ser modificados con la finalidad de mejo-
más amplio de los procesos biológicos. Aunque la estruc- rar o revertir el curso de un proceso fisiológico anormal,
tura y función de los genes en el genoma humano parece con intención de regresar al organismo a la homeostasis.
simple, al adentrarnos un poco más en su estudio nos asom-
bramos de cuán complejos son. Los estudios logrados en el El texto está dividido en cuatro partes: la primera se
campo de la biología molecular aplicados a la medicina y a enfoca a estudiar los aspectos básicos de la biología mo-
la ingeniería genética han generado enormes avances como lecular, la estructura y función de las principales moléculas
consecuencia del entendimiento de las bases moleculares que participan en el flujo de la información genética como
de los fenómenos biológicos que suceden en el organismo, lo son el ADN, el ARN y las proteínas, así como los meca-
lo que en el campo de la medicina ha permitido ofrecer a los nismos que controlan su síntesis. También se expone con
pacientes diagnósticos y tratamientos más certeros, logran- detalle aquellos mecanismos involucrados en el control de
do así establecer una conexión estrecha antes inexistente la expresión de los genes de manera positiva y negativa. La
entre las ciencias básicas y las disciplinas clínicas. Podemos segunda parte presenta las principales técnicas de biología
finalmente entender la importancia que ha cobrado la bio- molecular e ingeniería genética aplicadas a la medicina,
logía molecular en el desarrollo de la vida moderna, por con el fin de ofrecer a los pacientes diagnósticos más certe-
lo cual múltiples universidades la han incluido dentro de ros y oportunos. La tercera sección muestra un panorama
sus planes de estudios como una materia obligatoria. Esta amplio de las bases moleculares implicadas en el desarrollo
medida pretende que los estudiantes de las ciencias de la de diversas patologías humanas, y por último, la cuarta par-
salud, tanto de licenciatura como de maestría y doctora- te brinda una revisión actual de temas especializados y de
do, conjunten los conocimientos pasados con los actuales interés general, como terapia génica, organismos transgéni-
y sean capaces de entender los mecanismos moleculares cos, dopaje génico, nutrigenómica y proyecto del genoma
que suceden dentro de las células de todos los organismos humano. Sin lugar a dudas, el presente libro representa una
vivos, y cómo un agente genético, un microorganismo o un herramienta muy útil para el estudio de la biología molecu-
factor ambiental puede modificarlos, ocasionando así una lar en el área de las ciencias de la salud, y estamos seguros
patología. de que su lectura desarrollará en los estudiantes el gusto por
esta fascinante rama de la ciencia.
Este libro ofrece al lector adentrarse en el campo de la
biología molecular al presentarle un panorama general y a Rui Pérez Tamayo
la vez profundo de cada uno de los temas planteados, con
un abordaje sencillo y didáctico de los eventos moleculares

xi



Parte I
Conceptos básicos
de biología molecular

Contenido

Capítulo 1 Historia de la biología molecular
Capítulo 2 Ciclo celular
Capítulo 3 Ácidos nucleicos
Capítulo 4 Replicación
Capítulo 5 Transcripción
Capítulo 6 Traducción
Capítulo 7 Regulación de la expresión génica
Capítulo 8 Mutaciones
Capítulo 9 Mecanismos de reparación del ADN



Capítulo 1

Historia de la biología molecular

José María Vera Cruz / Adriana María Salazar Montes
César Guardado Mora / Juan Armendáriz Borunda

Introducción Friedrich Miescher

La historia de la biología molecular implica muchas historias Entre 1868 y 1869, el químico suizo Friedrich Miescher
y todas ellas se encuentran entrelazadas. Sería muy compli- (figura 1-3), siendo posdoctorado en el laboratorio de
cado tratar de describirlas de manera individual y más si se Hoppe-Seyler (el acuñador del término biochimie), aisló
presta atención a todos los acontecimientos que han tenido los núcleos a partir de células presentes en pus de vendajes
impacto en esta ciencia. Por ello, en este capítulo sólo se van quirúrgicos, y comprobó que los núcleos contenían una
a considerar algunos de los sucesos que han dejado huella de sustancia química homogénea y no proteica a la que deno-
manera significativa en el desarrollo del área de la biología minó nucleína (el término ácido nucleico fue acuñado
que hoy se conoce como biología molecular. posteriormente, en 1889, por Richard Altman). Según sus
palabras, la nucleína es una “sustancia rica en fósforo loca-
Charles Darwin lizada exclusivamente en el núcleo celular”; así, preparó el
camino para la identificación de la molécula portadora de la
Esta historia comienza a principios del siglo xix, cuando información hereditaria, el ADN. Ese hecho excepcional
Charles Darwin (figura 1-1) propuso la teoría del origen de hizo que Hoppe-Seyler decidiera demorar hasta 1871 la
las especies, en la que se plantea la preservación de las publicación de estos resultados, a la espera de la confirma-
características más favorables de un organismo como con- ción definitiva. Al principio esta investigación no pareció
secuencia de un cambio en la secuencia del ADN, lo que en relevante, hasta que Albrecht Kossel llevó a cabo sus pri-
la actualidad se conoce como mutación. meras investigaciones sobre la estructura química de la
nucleína. En 1888, Kossel demostró que la nucleína de Mies-
Gregor Mendel cher contenía proteínas y moléculas básicas ricas en nitróge-
no, lo que llevó a la identificación de lo que hoy se conoce
Posteriormente, en 1865, Johann Gregor Mendel, un monje como bases nitrogenadas. También demostró la presencia
agustino (figura 1-2), publica sus experimentos con plantas de un glúcido de cinco átomos de carbono. Por este trabajo
híbridas, y llama a los resultados de su investigación “Leyes se le otorgó el Premio Nobel de Fisiología en 1910. Su voca-
de la herencia”, por lo que se le considera el padre de la ción investigadora le introdujo en el área de la fisiología
genética. celular, donde destacó la importancia de las enzimas e intu-
yó el papel de los ácidos nucleicos en la herencia.
Estos experimentos causaron un gran impacto en la
comunidad científica, y le permitieron deducir que las Thomas Hunt Morgan
características del organismo están determinadas por un
par de factores, aportados por cada progenitor. Estas “uni- En 1909, Thomas Hunt Morgan (figura 1-4), en la Universi-
dades hereditarias” (genes) no se mezclan sino que se dad de Columbia, realizó unos experimentos hoy conside-
transmiten con toda la información, y uno de los factores rados clásicos sobre los rasgos genéticos ligados al sexo, lo
resulta dominante sobre el otro (recesivo), lo que da origen que le hizo acreedor del Premio Nobel en 1933. Sus contri-
a la formulación de las leyes fundamentales de la herencia. buciones científicas más importantes se centraron en el
Sin embargo, nunca se preguntó por la naturaleza química campo de la genética, y demostró que los cromosomas son
de los genes ni por su localización dentro de las células.

3

4 PARTE I • Conceptos básicos de biología molecular

Figura 1-1. Charles Darwin.

portadores de los genes, lo que dio lugar a lo que se conoce Figura 1-3. Friedrich Miescher.
como la teoría cromosómica de Sutton y Boveri. Gracias a
su trabajo, la Drosophila melanogaster se convirtió en uno Hunt y sus estudiantes analizaron las características de
de los principales modelos en genética. miles de moscas y estudiaron su herencia. Empleando la
recombinación de los cromosomas, Morgan y Alfred Stur-
En 1910 descubrió una mosca mutante de ojos blancos tevant prepararon un mapa con la localización de los genes
entre individuos de estirpe silvestre de ojos rojos. La proge- en el cromosoma. Los resultados de sus investigaciones les
nie del cruzamiento de un macho de ojos blancos con una permitieron escribir el libro El mecanismo de la herencia
hembra de ojos rojos presentó ojos rojos, lo que indicaba mendeliana.
que el caracter “ojos blancos” era recesivo. Morgan denomi-
nó white al gen correspondiente, e inició así la tradición de Morgan también descubrió que algunas enfermedades,
nombrar a los genes según el fenotipo causado por sus ale- como la alcaptonuria, tienen su origen en una enzima
los. Al cruzar estas moscas entre sí, se percató de que sólo los defectuosa, fenómeno descrito por el f ísico inglés Archi-
machos mostraban el caracter “ojos blancos”. De sus expe- bald Garrod, que observó que las personas con ciertas
rimentos, concluyó que: anormalidades genéticas (errores innatos del metabolismo)
carecían de ciertas enzimas. Con esta observación se rela-
1. Algunos caracteres se heredan ligados al sexo. cionó a las proteínas (enzimas) con los cambios genéticos.
2. El gen responsable del caracter “ojos blancos” está en el En 1913, Calvin Bridges demostró que los genes están en los
cromosomas; asimismo, Alfred Henry Sturtevant (como
cromosoma X.
3. Existe la posibilidad de que otros genes también residan

en cromosomas específicos.

Figura 1-2. Gregor Mendel. Figura 1-4. Thomas Hunt Morgan.

CAPÍTULO 1 • Historia de la biología molecular 5

ADN como material genético

Figura 1-5. Frederick Griffith. Frederick Griffith

Bridges, alumno de Morgan), demostró que algunos genes Oficial médico y genetista británico. En 1928 realizó lo que se
tienden a heredarse juntos y dedujo que se localizan en el conoce como “experimento de Griffith”, en el que descubrió
mismo cromosoma. el “principio transformante”, que hoy se conoce como ADN.

En 1915 quedaron definitivamente establecidas las El experimento de Griffith (figura 1-6) tuvo lugar mien-
bases fundamentales de la herencia fenotípica y se publicó tras investigaba una vacuna para prevenir la neumonía
el libro El mecanismo de la herencia mendeliana, escrito durante la pandemia de gripe que se produjo tras la Primera
por Thomas H. Morgan, Alfred Sturtevant, Hermann Guerra Mundial. Para ello usó dos cepas de la bacteria
Muller y Calvin Bridges, en el que se establecían de forma Streptococcus pneumoniae: la cepa S (virulenta), que conte-
definitiva las bases fundamentales de la herencia genotípi- nía una cápsula de polisacáridos, y la R (no virulenta), que
ca, se iniciaba la teoría cromosómica de la herencia y se carecía de ella. Cuando se inyectaba a ratones la cepa S cau-
consolidaba la edad de oro de la genética clásica. saba neumonía y muerte en un día o dos, ya que la cápsula
permitía a la bacteria resistir los ataques del sistema inmu-
ne del hospedero. Cuando se inyectaba la cepa R no causaba
neumonía. Si la cepa S se calentaba para matarla y se inyec-
taba en ratones perdía su virulencia y los ratones no desa-
rrollaban neumonía. Sin embargo, si se inyectaban bacterias
muertas de la cepa S mezcladas con bacterias vivas de la
cepa R (S/R), los ratones infectados morían.

Al aislar la bacteria en la sangre de estos ratones se des-
cubrió que la cepa R, anteriormente avirulenta, presentaba
cápsula y se transformaba en S. Así, Griffith hipotetizó que
existía un principio transformante presente en las bacterias
muertas de la cepa S que hacía que las bacterias de la cepa R
se transformaran en bacterias de tipo S.

William Thomas Astbury

En 1938, sir William Thomas Astbury (figura 1-7) y Floren-
ce Bell, de la Universidad de Leeds, en Inglaterra, al realizar

Bacterias Bacterias S1 S1 R S/R S
virulentas (S) avirulentas (R) no
encapsuladas
encapsuladas
1
2

Figura 1-6. Experimento del principio transformante.

6 PARTE I • Conceptos básicos de biología molecular

estudios de difracción por rayos X, propusieron que el ADN
era una fibra compuesta de bases nitrogenadas apiladas a
0.33 nm unas de otras, perpendiculares al eje de la molécu-
la. Astbury siguió trabajando en el estudio de la estructura
de proteínas fibrosas, como las queratinas, en lana. Su per-
severancia y dedicación lograron que en 1945 consiguiera la
primera cátedra de Estructura Biomolecular. Además, fue
el primer científico en autodenominarse biólogo molecular,
aprovechando que en 1938, Warren Weaver había acuñado el
término biología molecular. El nombramiento de Astbury
marcó el nacimiento de la biología molecular como un área
de conocimiento independiente.

George Wells Beadle Figura 1-8. George Wells Beadle y Edward Lawrie Tatum.

y Edward Lawrie Tatum Premio Nobel de Fisiología en 1963 por sus descubrimien-
tos acerca del mecanismo de replicación de los virus y su
En 1941, George Wells Beadle y Edward Lawrie Tatum estructura genética.
(figura 1-8), en la Universidad de Stanford, California,
encontraron sólidas evidencias de una correlación entre los Oswald Theodore Avery, Colin MacLeod
genes y las enzimas en el hongo Neurospora crassa, median- y Maclyn McCarty
te el estudio de rutas metabólicas implicadas en la síntesis
de los aminoácidos. Sus experimentos consistían en expo- En 1944, Avery, MacLeod y McCarty (figura 1-9) demostra-
ner a Neurospora crassa a rayos X que causaban mutaciones ron que las cepas inocuas de neumococo estudiadas por
que originaban cambios en las enzimas implicadas en rutas Griffith se transformaban en patógenas al adquirir la mo-
metabólicas. Sus resultados, publicados en 1941, proponían lécula de ADN y no proteínas, como se creyó en un principio,
un vínculo directo entre los genes y las enzimas, conocido y demostraron así que el principio transformante era ADN.
como la hipótesis “Un gen, una enzima”. Posteriormente, MacLeod, empleando refinadas técnicas desarrolladas por él
en 1943, el médico italiano Salvador E. Luria, conocido por mismo, aisló el principio transformante de muestras de neu-
el medio de cultivo para E. coli LB (Luria broth), y Max Del- mococos biológicamente activo. Este compuesto se trató
brück demostraron que las mutaciones en E. coli ocurrían con proteasas (enzimas que degradan proteínas), lipasas
de forma espontánea, sin necesidad de exposición a agentes (enzimas que degradan lípidos) y glucosidasas (enzimas que
mutagénicos, y que éstas se transmitían siguiendo las leyes de degradan carbohidratos), con la finalidad de conocer su
la herencia. Estos autores postularon que las mutaciones naturaleza química. El tratamiento con estas enzimas no
son las causantes de la resistencia de las bacterias a fárma- logró inactivar su acción. El análisis permitió suponer que el
cos. A Luria, Delbrück y Alfred Day Hershey se les otorgó el factor transformante podría estar compuesto por ácidos
nucleicos, ya que su peso molecular era alto y se precipitaba
en presencia de alcohol. El tratamiento con ribonucleasa
(enzima que degrada el ARN), tampoco producía su inacti-
vación. Sólo cuando el principio se trataba con desoxirribo-

Figura 1-7. William Thomas Astbury. Figura 1-9. Oswald Theodore Avery, Colin MacLeod y Maclyn
McCarty.

CAPÍTULO 1 • Historia de la biología molecular 7

nucleasa (enzima que degrada el ADN) se perdía su acción. NH H O NH
De esta manera se demostró que la naturaleza química del CH CH CH2
principio transformante era ADN y era el causante de pro- A CH2
ducir los cambios permanentes heredables. HC

Erwin Chargaff CH2

En 1950, Erwin Chargaff (figura 1-10) descubre las leyes NH
que rigen la complementariedad de bases de los ácidos
nucleicos. Mediante cromatograf ía en papel, Chargaff NH N NH
demostró que el ADN aislado de diferentes organismos CH
contiene la misma proporción de Adeninas y de Timinas,
así como de citosinas y de guaninas. Asimismo, demostró C
que el porcentaje de bases purinas era igual al de bases piri-
midinas (véase el capítulo 3). Con estos descubrimientos se CH NH
fundamentó el principio de complementariedad de las
bases de los ácidos nucleicos (figura 1-11). Citosina NH
H
Esta regla tuvo sentido sólo hasta que James Dewey O Guanina
Watson y Francis Harry Compton Crick propusieron su
modelo de la estructura del ADN. En ese mismo año, lord B CH3
Alexander Robertus demostró que los nucleótidos se
unían al ADN a través de enlaces fosfodiéster, por lo que CH HC O H NH NH
propuso una estructura lineal para la cadena de ADN. CH2 CH CH CH2

Alfred Hershey y Martha Chase NH
NH N CH NH
En 1952, Alfred Hershey y Martha Chase (también conoci-
da como Martha C. Epstein; figura 1-12), utilizando bacte- CO
riófagos (virus que infectan bacterias) marcados con
isótopos radiactivos 35S o 32P (el azufre como elemento quí- CH2 NH
mico propio de las proteínas y el fósforo del ADN), demos-
traron que cuando un virus infecta a una bacteria Timina
solamente penetra el ADN viral. La cápside viral no se
introduce a la bacteria y, por lo tanto, no participa en la Adenina
formación de nuevas partículas virales, y concluyeron que
el ADN, y no las proteínas, contiene la información genéti- Figura 1-11. Reglas de Chargaff.
ca para la síntesis de nuevos viriones.
Rosalind Franklin

Entre 1950 y 1953, la mayor parte de la comunidad científi-
ca comenzaba a admitir que el material genético es el ADN.
La quimicof ísica Rosalind Elsie Franklin, mediante estudios
de difracción de rayos X, descubrió que el ADN presentaba
los grupos fosfato hacia el exterior y podía hallarse de dos
formas helicoidales distintas: las que hoy conocemos como
ADN-A y ADN-B (véase el capítulo 3).

Figura 1-10. Erwin Chargaff. Figura 1-12. Martha Chase y Alfred Hershey.

8 PARTE I • Conceptos básicos de biología molecular

Pares de bases

Adenina Timina

Guanina Citosina

Figura 1-13. Rosalind Franklin. Esqueleto de
azúcar-fosfatos

James Dewey Watson Figura 1-15. Modelo de la doble hélice del ADN.

y Francis Harry Compton Crick Era moderna de la biología molecular

En 1953, el bioquímico estadounidense Watson y el biof ísi- El hallazgo de la estructura del ADN es uno de los descubri-
co inglés Crick (figura 1-14) elaboraron el famoso modelo mientos esenciales en las ciencias de la vida y marcó el inicio
de la doble hélice de ADN, que explicaba de manera clara de la biología molecular moderna. En 1955, Crick, siguien-
que el ADN podía duplicarse y transmitirse de una célula a do el modelo de la doble hélice, propuso la existencia de la
otra. Su maqueta representaba al ADN formado por dos tautomería y la replicación semiconservadora del ADN, y
cadenas antiparalelas: una que corre en dirección 5´-3´, y la propuso que para la síntesis de proteínas debe existir una
otra que lo hace en la dirección opuesta 3´-5´ (véase el capí- molécula mediadora entre las proteínas y el ADN, función
tulo 3). Estas cadenas tienen una estructura de α-hélice y se que hoy se sabe realiza el ARN. En ese mismo año, propuso
hallan unidas por dos y tres puentes de hidrógeno entre las el dogma central de la biología molecular: “El ADN dirige su
bases A-T y G-C, respectivamente. En cambio, hacia la par- propia replicación y su trascripción para formar ARN
te externa de la cadena se localizan las desoxirribosas, uni- complementario a su secuencia; el ARN es traducido en
das por enlaces fosfodiéster, formando una especie de aminoácidos para formar una proteína” (figura 1-16). En
barandal o pasamanos de una escalera que deja expuestos a 1957 propuso que el código genético debe leerse en triple-
los grupos fosfato (figura 1-15). tes.

Figura 1-14. James Dewey Watson y Francis Harry Compton Crick. Mathew Stanley Meselson

y Franklin Stahl

En 1958, Mathew Stanley Meselson y Franklin Stahl (figura
1-17) confirmaron la replicación semiconservadora pro-
puesta por Crick. En su experimento utilizaron centrifuga-
ción con gradientes de soluciones de cloruro de cesio
(CsCl). Cultivaron bacterias en un medio que contenía el
isótopo 15N (pesado) para marcar las cadenas de ADN pro-
genitoras. Después cambiaron el medio por uno que conte-
nía 14N (ligero) y se permitió que las células se replicaran

CAPÍTULO 1 • Historia de la biología molecular 9

ADN

REPLICACIÓN TRANSCRIPCIÓN TRADUCCIÓN
ADN polimerasa ARN polimerasa ARNm, ARNt y ARNm

ADN

ARN PROTEÍNA

cADN

RETROTRANSCRIPCIÓN
Retrotranscriptasa

Figura 1-16. Flujo de la información genética.

una sola vez con la finalidad de que el ADN recién replicado describió sus genes específicos y, lo que es más importante,
incorporara este nitrógeno. Si la replicación del ADN con- las funciones que desempeñan. En 1971, Nathans elaboró el
templaba la separación de las dos cadenas, era posible pre- primer mapa de restricción del ADN que detallaba los genes
decir la densidad de las moléculas de ADN después de una de una molécula de ADN. Un año más tarde, en 1972, Janet
replicación. Si la replicación fuera semiconservadora, des- Mertz y Ron Davis demostraron que un fragmento de res-
pués de una replicación, todas las moléculas de ADN resul- tricción podía insertarse y ligarse a otro ADN cortado por
tantes tendrían que contener una cadena pesada y una la misma enzima.
ligera, y en consecuencia su densidad sería intermedia. Este
resultado fue observado por Meselson y Stahl. Después de Por las excepcionales contribuciones al nacimiento de
dos replicaciones en 14N la mitad de las moléculas de ADN las técnicas de la ingeniería genética, Arber, Smith y
eran ligeras y la otra mitad, híbridas, es decir, con densidad Nathans recibieron el Premio Nobel de Fisiología y Medici-
intermedia, justo como lo predice la replicación semicon- na en 1978.
servadora. De esta manera se demostró que la replicación
del ADN es semiconservadora y el nuevo ADN preserva Howard Martin Temin
una de las cadenas originales y se sintetiza una de novo y David Baltimore
(figura 1-18).
En 1970, Howard Martin Temin, de la Universidad de Wis-
Hamilton Smith, Daniel Nathans, consin-Madison, y David Baltimore, del Instituto de Tecno-
logía de Massachusetts (MIT), de manera independiente
Werner Arber descubrieron una nueva enzima denominada transcriptasa
inversa o retrotranscriptasa, con función de ADN polime-
En 1968, Steward Lynn y Werner Arber (figura 1-19) descu- rasa dependiente de ARN. Temin y Baltimore (figura 1-20)
brieron los sistemas de restricción de las bacterias. demostraron que el genoma de ARN de los retrovirus era
copiado a una molécula de ADN de doble cadena por la
Hamilton Smith, a principios de la década de 1960, en la acción de la transcriptasa inversa, durante la infección de
Universidad de Ginebra, Suiza, descubrió que las bacterias
infectadas por virus liberaban unas enzimas (enzimas de Figura 1-17. Mathew Stanley Meselson y Franklin Stahl.
restricción), que los inactivan al cortar sus secuencias
de ADN. Simultáneamente a este ataque molecular, la bac-
teria libera otra enzima que modifica químicamente las
bases de su propio ADN evitando que la enzima de restric-
ción lo corte, produciendo su autodestrucción. Este proceso
en dos pasos se denomina “sistema controlado de restric-
ción-modificación” del hospedero. En 1970, se aísla la pri-
mera enzima de restricción Hind II, a partir de Haemophilus
influenzae (véase el capítulo 13).

El enorme potencial del empleo de las enzimas de res-
tricción quedó demostrado por un colega de Smith, Daniel
Nathans, de la Universidad Johns-Hopkins, que logró cor-
tar el ADN del virus SV40 (que induce la formación de
tumores cancerosos en los simios) a 11 fragmentos. Nathans

10 PARTE I • Conceptos básicos de biología molecular

Figura 1-18. Replicación semiconservadora del ADN.

estos virus. Temin y Baltimore, junto con Dulbecco, fueron dNTP (ATP, CTP, GTP, TTP), uno de los cuales (TTP) era
galardonados con el Premio Nobel de Fisiología en 1975. radiactivo. El producto resultante fue una molécula insolu-
ble en ácido, que mostraba las propiedades del ADN. Este
El principal cuestionamiento acerca de los virus de producto era degradado por una DNasa pero no se afectó
ARN era si el genoma de estos virus pasaba de padres a por la RNasa ni por hidrólisis alcalina (a la cual es sensible
hijos como ARN o se integraba al ADN de la célula huésped el ARN). Sin embargo, si los viriones se trataban con RNasa
en alguna etapa de su ciclo viral. Las pruebas de infección y antes de la reacción, la molécula molde se degradaba. Se
de transformación indicaban que estos virus requerían de la observó, también, que la enzima que sintetizaba el ADN se
síntesis de ADN. Temin sugirió que la replicación de los sedimentaba junto con las partículas virales maduras, lo
virus de ARN ocurría mediante una molécula intermediaria que sugiere que era parte del virus y no de la célula huésped.
de ADN (un provirus) que servía como molde para la sínte- Estos resultados reforzaron la idea de que el ARN viral se
sis de ARN viral. Sin embargo, este molde necesita de una copiaba a una molécula de ADN de doble cadena, que a su
ADN polimerasa dependiente de ARN que nunca se había vez servía como molde para la síntesis del ARN viral nece-
encontrado en ningún tipo de células. Por su parte, Balti- sario para la infección y la transformación. Estos experi-
more examinó los viriones (partículas virales maduras) de mentos no sólo sugirieron que la transformación celular
virus de ARN. Incubó el virus en condiciones en que se por los virus de ARN ocurría a través de un intermediario
indujera la actividad del ADN polimerasa y los cuatro

Figura 1-19. Hamilton Smith, Daniel Nathans, Werner Arber. Figura 1-20. Howard Martin Temin y David Baltimore.

CAPÍTULO 1 • Historia de la biología molecular 11

Figura 1-21. Kary Mullis. una secuencia específica de ADN mediante nucleótidos tri-
fosfatados y un ADN polimerasa. La idea de multiplicar una
de ADN sino que también contradijeron el antiguo concep- hebra de ADN millones de veces le surgió en 1983 pero no
to del dogma de la biología molecular propuesto por Fran- convenció a sus colegas de la compañía, por lo que tuvo que
cis Crick, que postulaba que la información de una célula desarrollarla solo. La versión de la técnica propuesta inicial-
fluía del ADN al ARN y a la proteína. mente por Mullis, aunque efectiva, era poco eficiente, hasta
que se le ocurrió emplear ADN polimerasas termoestables,
Kary Mullis extraídas de microorganismos termof ílicos, como la Taq
polimerasa procedente de Thermus aquaticus (véase el capí-
Kary Banks Mullis (figura 1-21) desarrolló una técnica inno- tulo 16, sobre PCR) (figura 1-22).
vadora que revolucionó la investigación en biología molecu-
lar: la reacción en cadena de la polimerasa (polymerase chain Por esta invención, de gran valor en biotecnología y
reaction, PCR). En 1985, mientras trabajaba en la compañía como herramienta de investigación científica y forense, en
Cetus, desarrolló la PCR, que permite la amplificación de 1993 recibió el Premio Japón y el Premio Nobel de Quími-
ca, compartido con el canadiense Michael Smith. Cetus, la
compañía en que trabajaba Mullis, le dio una recompensa
de 10 000 dólares por la invención de la PCR y luego vendió
la patente por 300 millones de dólares a Roche Molecular
Systems. La PCR tiene múltiples aplicaciones, como la
identificación de individuos a partir de muestras de sangre
o saliva (utilizada en ciencia forense) y la secuenciación de
genes de todo tipo de organismos. La secuenciación genéti-
ca era, hasta entonces, un proceso muy complicado, aplica-
ble sólo cuando se podían obtener de manera natural
muchas copias del mismo ADN. La PCR convirtió en una
rutina la secuenciación génica y permitió la lectura comple-
ta del genoma humano, así como de muchos organismos
que se toman como modelos de problemas biológicos en la
investigación. La técnica ha permitido también investigar
la filogenia (historia evolutiva), mediante la comparación de
las secuencias genéticas de distintas especies.

PRIMER CICLO

94ºC 60ºC 72ºC

SEGUNDO CICLO

94ºC 60ºC 72ºC

CICLO 35 = 235 MOLÉCULAS
Figura 1-22. Reacción en cadena de la polimerasa (PCR).

12 PARTE I • Conceptos básicos de biología molecular

Primer tratamiento de terapia génica también por las tecnologías de vanguardia que podían surgir,
así como porque el conocimiento obtenido podría asegurar
con éxito en niños (1989) la superioridad tecnológica y comercial del país que lo desa-
rrollara. Se nombró responsable del proyecto a James D.
En la década de 1980 se propició el advenimiento de la tera- Watson (uno de los dos investigadores que propusieron el
pia génica, el uso de genes para el tratamiento de enferme- modelo de la doble hélice del ADN en 1953). En 1990 se inau-
dades. Esta estrategia terapéutica se consolidó en 1989, guró definitivamente el PGH y se calcularon 15 años de tra-
cuando se llevó a cabo el primer protocolo clínico. bajo. En una primera etapa, la elaboración de mapas genéticos
exigió el desarrollo de nuevas técnicas de secuenciación para
El síndrome de inmunodeficiencia combinada grave por poder abordar todo el genoma. Para su desarrollo se destinó
déficit de la enzima adenosín deaminasa (ADA) fue la pri- un presupuesto de 3000 millones de dólares y se calculó que
mera enfermedad tratada con terapia génica. Las razones iba a terminar en 2005.
de su elección para este tratamiento son las siguientes:
En 2001 se elaboró y publicó el primer borrador del geno-
1. La deficiencia de ADA es la enfermedad congénita de ma. En abril de 2003 se publicó la secuencia completa del
inmunodeficiencia más estudiada, ya que la secuencia genoma humano, dos años antes de lo previsto. Las conclusio-
del ARNm y del gen que codifica para ADA se identifi- nes obtenidas al finalizar este proyecto fueron las siguientes:
caron tempranamente (1983).
• El genoma humano está constituido por 3000 millones
2. La función de la enzima está perfectamente dilucidada. de pares de bases.
3. La producción de tan sólo el 10% de los niveles normales
• Existen 25000 genes codificantes.
de la enzima ADA es suficiente para establecer una fun- • La homología en la secuencia de ADN entre individuos
ción inmune en el paciente. Por el otro lado, la sobrepro-
ducción de ADA superior a 50 veces los valores normales es del 99.99%.
sólo ocasiona una ligera anemia hemolítica. • La especie más cercana filogenéticamente al ser huma-
4. Se ha demostrado que las células genéticamente corre-
gidas tienen una ventaja selectiva en cuanto al creci- no es el chimpancé, con 99.9% de homología en su
miento frente a las células no modificadas. secuencia de ADN.

En este estudio se incluyó a dos pacientes, uno de cuatro Clonación del primer mamífero (1997)
años y otro de nueve. Antes de incluirse en el ensayo se
había demostrado que estos niños tenían una respuesta La oveja Dolly, que vivió del 5 de junio de 1996 al 2 de enero
incompleta al tratamiento con reemplazamiento enzimáti- de 2003, fue el primer mamífero clonado a partir de una célu-
co y no había ningún donante de médula ósea compatible. la adulta. Sus creadores fueron Ian Wilmut y Keith Campbell,
científicos del Instituto Roslin de Edimburgo (Escocia). Dolly
Se les realizó una extracción de sangre y se aislaron por fue una oveja resultado de una transferencia nuclear desde
aféresis los linfocitos T periféricos, que se estimularon con una célula donante diferenciada (de glándula mamaria) a un
interleucina-2 (IL-2) y anticuerpos anti-CD3 durante 72 h y óvulo no fecundado y anucleado. Cinco meses después nacía
se transdujeron con un vector retroviral que contenía el gen Dolly, la única cría resultante de 277 fusiones de óvulos anu-
ADA. Se cultivaron durante 9 a 12 días y posteriormente se cleados con núcleos de células mamarias.
reincorporaron al paciente (véase capítulo de terapia génica).
Los pacientes recibieron 10 a 12 infusiones durante dos años. Dolly vivió siempre en el Instituto Roslin, donde fue
Como resultado, la función inmunológica de ambos llegó a estudiada conforme envejecía. Demostró ser fértil y tuvo
niveles mucho más altos que durante el periodo de trata- crías en tres ocasiones. A los cinco años de edad, Dolly
miento con sustitución enzimática, y se mantuvieron estables desarrolló enfermedades crónico-degenerativas propias de
dos años después del último tratamiento. Ambos pacientes individuos seniles, como artritis (figura 1-23).
tuvieron una respuesta variable a los antígenos, mantuvieron
un crecimiento normal de linfocitos T y tuvieron el mismo A pesar de que la expectativa de vida de la raza Finn
tipo de infecciones que los demás niños de su edad. Los efec- Dorset, a la que pertenecía Dolly, es de 11 a 12 años, tuvo
tos adversos asociados a esta terapia fueron mínimos. que ser sacrificada debido a una enfermedad progresiva pul-
monar a los ocho años de edad. La necropsia demostró que
Proyecto del Genoma Humano (1990) tenía cáncer de pulmón, causado por un retrovirus. Los téc-
nicos de Roslin no han podido certificar si hubo conexión
El Proyecto del Genoma Humano (PGH) fue un proyecto entre su muerte prematura y el hecho de ser un clon, pues
internacional de investigación científica con el objetivo fun- otras ovejas del mismo rebaño sufrieron la misma enferme-
damental de determinar la secuencia de pares de bases que dad y murieron a causa de ella. Sin embargo, algunos autores
componen el ADN e identificar los aproximadamente 30 000 han especulado que había un factor agravante en la muerte
genes del genoma humano, desde un punto de vista físico y de Dolly: al nacer tenía una edad genética de seis años, la
funcional. El debate público que suscitó la idea captó la aten- misma edad de la oveja de la cual fue clonada. Esta asevera-
ción de los responsables políticos de muchos países, no sólo ción se sustenta en el hallazgo de que los telómeros de su
porque el PGH suponía un gran reto técnico-científico, sino ADN eran cortos, característica presente en células viejas.

CAPÍTULO 1 • Historia de la biología molecular 13

Núcleo Fusión
donante (2n) mediada por
shock eléctrico
Oveja donante del tejido
mamario Finn Dorset Formación del
embrión

Ovocito (n) de Remoción del
otra célula núcleo del
ovocito
Oveja donante del óvulo adulta
Scottish (cara negra)

Dolly con fenotipo Embrión con
caracteres de la
de la oveja oveja donante
de donde se obtuvo
la célula mamaria

Implantación en
madre sustituta oveja
Scottish (cara negra)

Figura 1-23. Clonación de la oveja Dolly.

Ejercicios de integración
1. Complete la información que corresponde en los recuadros vacíos.

Nombre Aporte (experimento) Características Año
Gregor Mendel Leyes fundamentales de la herencia. 1865

Temin y Baltimore Se demuestra cómo los virus con ARN como genoma
Principio transformante. sintetizan ADN y se replican.

Erwin Chargaff Explica cómo una cepa avirulenta puede transformar-
se en una virulenta.

1950

Watson y Crick Elaboran el modelo de la doble hélice de ADN.

Desarrolla la técnica de la reacción en cadena de la Permite la amplificación de una secuencia específica
polimerasa (PCR). de ADN mediante nucleótidos trifosfatados y un
ADN polimerasa termoestable.

Con el uso de 14N y 15N comprueban que el ADN se 1958
replica de manera semiconservadora.

14 PARTE I • Conceptos básicos de biología molecular

2. De acuerdo con los experimentos del principio transformante de Griffith, complete la información que corresponde en los
recuadros vacíos.

Cepa Experimento Resultado
Cepa S El ratón muere.

Inyectada al ratón. El ratón vive.

Cepa S Tratada con calor e inyectada al ratón.

Cepa S Tratada con calor, incubada con cepa R e inyectada al
ratón.

Bibliografía

Griffith F. The significance of pneumococcal types. J Hyg, Mullis K.B. Reacción en cadena de la polimerasa. Investigación y
1928;27:113-159. Ciencia. 1990;165:30-37.

Karp G. Biología celular y molecular, conceptos y experimentos, 4ª ed. Venter J.C., Adams M.D., Myer E.W,. et al. The sequence of the
México, DF: McGraw-Hill, 2006. human genome. Science, 2001;291:1304-1351.

Luque J., Herráez A. Texto ilustrado de Biología Molecular e Ingenie- Watson J.D. Biología Molecular del gen, 5ª ed. Madrid: Médica Pana-
ría Genética, 1ª ed. Madrid: Elsevier, 2001. mericana, 2006:7-46.

Meselson M, Stahl F.W. The replication of DNA in Escherichia coli. Watson J.D, Crick F.H.C. A structure for deoxyribose nucleics acids.
Proc Natl Acad Sci, 1958;44:671-682. Nature, 1953;171:737-738.

Capítulo 2

Ciclo celular

Blanca Estela Alcántar Díaz / Luis Daniel Hernández Ortega
Adriana María Salazar Montes

Introducción sin modificarse el número de cromosomas, mientras que la
fase M suele durar aproximadamente 1 h en las células de
En 1858, Rudolf Virchow estableció lo que puede conside- mamíferos (figura 2-1). La interfase puede tener una dura-
rarse el segundo principio de la teoría celular: “Toda célula ción de días, semanas o incluso más tiempo, según el linaje
procede de otra célula preexistente por división de ésta” celular y las condiciones ambientales o fisiológicas impe-
(omnis cellula e cellula). Por esto, se considera que la célula rantes (figura 2-2).
es la unidad de origen de todos los seres vivos.
De acuerdo con su potencial proliferativo, las células
Para que esta acción pueda llevarse a cabo es necesario pueden categorizarse en:
que la célula pase por un proceso denominado división
celular. En los organismos unicelulares, como las bacterias Células lábiles, que en condiciones normales tienen
y las levaduras, cada división celular produce un organismo una alta actividad mitótica. Se encuentran en tejidos que se
nuevo completo, mientras que para dar origen a un organis- renuevan constantemente (por ejemplo, el revestimiento
mo pluricelular como el ser humano, a partir de un cigoto epitelial de las cavidades y la superficie corporal, los precur-
(originado por la unión de dos gametos sexuales), se necesi- sores hematopoyéticos en la médula ósea y las espermato-
tará una gran cantidad de divisiones celulares. Sin embargo, gonias, que dan origen a los espermatozoides).
éstas no se detienen una vez que el organismo está comple-
to, sino que continúan durante toda la vida del individuo y Células estables, que en condiciones normales no se
son necesarias para reponer las células muertas o senescen- dividen, pero cuya división puede inducirse mediante el
tes, así como en situaciones de traumatismo o lesión. estímulo apropiado. Estas células renuevan de manera lenta
los tejidos menos expuestos, pero pueden aumentar la velo-
El ciclo celular cidad de renovación en caso de pérdida tisular, como suce-
de con el hígado, los túbulos renales proximales y las células
El ciclo celular representa el mecanismo fundamental sub- endoteliales de vasos sanguíneos.
yacente a la reproducción de todos los seres vivos, y se divi-
de en etapas, a través de las cuales la célula pasa de una Células permanentes, que carecen de la capacidad de
división celular a la siguiente. Estos acontecimientos se rea- división. Son células totalmente diferenciadas, muy espe-
lizan mediante una secuencia ordenada de procesos en los cializadas, incapaces de entrar nuevamente al ciclo celular;
que la célula duplica su contenido y luego se divide en dos. un ejemplo representativo son los eritrocitos, que se origi-
nan de su precursor y pasan por un proceso de maduración
El ciclo celular se divide en dos fases principales: la fase en el cual pierden su núcleo y con ello su capacidad de divi-
M, o fase mitótica, y la interfase, o periodo preparatorio. sión.
La fase M, a su vez, se subdivide en mitosis, en la cual los
cromosomas duplicados se dividen en dos núcleos, y cito- Una visión global del ciclo celular permite observar
cinesis, donde toda la célula se divide en dos células hijas. cómo la célula transcurre de manera ordenada y sin discon-
Por otra parte, la interfase se subdivide en: fase G1, fase S y tinuidad por dos grandes etapas bien diferenciadas: la fase
fase G2. Durante la interfase varía el grado de condensa- M (mitosis en células somáticas y meiosis en células germi-
ción del material genético así como el contenido de ADN, nales) y la interfase (común en ambas).

Durante esta etapa, la célula se prepara para la siguiente
división y duplica su material genético, es decir el ADN, y
todo su contenido (proteínas, ARN, organelos, membra-

15

16 PARTE I • Conceptos básicos de biología molecular

I

nterfaseG1: la célulaS: replicación delHepatocito
crece y realiza ADN y duplicación ±1 año
1 hora de cromosomas.
sus actividades Epitelio del páncreas
±50 días
especializadas.

CitoTceAilnonMfeaaefssatiaessfease Fase M G2: la célula
crece y condensa

gradualmente su

cromatina.

PrPorfoasmeetafase

Figura 2-1. Fases del ciclo celular. El ciclo celular se divide en Espermatogonias
±25 días
dos fases: interfase y M. La fase M, a su vez, incluye mitosis

y cariocinesis, mientras que la interfase incluye las fases G1,
S y G2; la fase M tiene una duración aproximada de una hora
en las células de mamíferos, mientras que la interfase puede

tener una duración de días, semanas o incluso más tiempo.

nas), de manera que duplica su tamaño antes de dividirse en Epitelio intestinal
dos células hijas. De 2 a 5 días

La mayor parte de la vida celular, ya sea en la interfase o Células embrionarias
en quiescencia (reposo), la molécula de ADN no está pre- ±60 minutos
sente en la forma extendida de doble hélice ni tampoco en
la forma compacta de cromosomas, sino en un estado par-
cialmente condensado conocido como cromatina.

El ciclo celular transcurre entre dos divisiones celulares
sucesivas; se divide en cuatro fases, con una duración des-
igual, que se exponen a continuación.

Fase de descompactación (G1) Figura 2-2. Duración del ciclo celular. El ciclo celular tiene
diferente duración. En la figura puede observarse la duración
Tras la mitosis, la célula entra en la fase G1 (G, de gap, del ciclo celular en diferentes estirpes celulares; en hepatoci-
“intervalo”), durante la cual se dedica a sus actividades tos la duración es de aproximadamente un año, aunque con
especializadas. La principal diferencia entre las células de un estímulo (pérdida o daño tisular) el tiempo se acorta. Las
división rápida y las de división lenta es la duración de la células embrionarias tienen etapas G1 y G2 muy cortas, por lo
fase G1, que proporciona tiempo adicional de crecimiento. que se dice que pasan de S a M, y viceversa, sin pasar por G1
y G2, lo que acelera la velocidad de división.
De las tres etapas de la interfase, la G1 es la más variable.
Con notables excepciones, las células que han detenido su dida (correspondiente a la doble hélice), necesaria para la
división de manera transitoria o permanente, en el cuerpo o separación de las dos hebras en la siguiente fase. En este
en el medio de cultivo, se encuentran en una etapa previa al periodo la célula determina si las condiciones ambientales e
inicio de la síntesis de ADN. internas son adecuadas para la división celular.

Durante la fase G1, las células mantienen un número
constante de cromosomas diploides (2n) y su contenido en
el ADN no está duplicado, por lo que se afirma que equiva-
le a 2c (dos copias). La cromatina se descondensa de forma
gradual hasta adoptar una conformación totalmente exten-

CAPÍTULO 2 • Ciclo celular 17

En el caso de que las condiciones sean favorables, la mitosis, que originalmente se definió como el periodo en el
célula atraviesa el punto de inicio (start) que compromete que los cromosomas se condensan visiblemente. La citoci-
de forma irreversible el comienzo del ciclo celular. Si las nesis se produce en la sexta etapa, que se superpone con el
condiciones ambientales vuelven a ser favorables, la célula final de la mitosis. En conjunto, estas etapas constituyen
puede repetir el ciclo varias veces más. una secuencia dinámica en la que varios ciclos indepen-
dientes se desarrollan de forma coordinada para producir
Fase de duplicación o síntesis (S) dos células hijas genéticamente idénticas y en las que parti-
cipan los cromosomas: el citoesqueleto y los centrosomas.
En la fase S, o de síntesis, se produce la replicación del ADN
de los cromosomas individuales. Cada hebra de este ADN sir- Cuando la célula está por ingresar en la fase M, los cro-
ve de molde para la síntesis o producción de la hebra nueva, mosomas replicados se condensan y se visualizan como
que permanece asociada por apareamiento de bases. Las dos estructuras filiformes; un conjunto de complejos proteicos
moléculas de ADN resultantes permanecen unidas por el denominados condensinas ayudan a producir esta conden-
centrómero, con lo que dan lugar a cromosomas con cuatro sación. Las cohesinas y las condensinas están relacionadas
hebras de ADN. Cada doble hebra constituye una cromáti- de forma estructural y trabajan en conjunto para ayudar a
da; de esta forma el número de cromosomas es constante- configurar los cromosomas replicados para la mitosis. Las
mente diploide en el núcleo (2n), pero el contenido de ADN cohesinas se unen a dos moléculas paralelas de ADN (cro-
se duplica de dos copias (2c) hasta cuatro (4c). mátidas hermanas idénticas) y las mantienen juntas, en tan-
to que las condensinas se unen a una molécula individual de
Las dos copias de cada cromosoma replicado permane- ADN para ayudar a condensarla.
cen íntimamente unidas entre sí como cromátidas herma-
nas idénticas. Éstas se mantienen juntas debido a complejos Antes de que comience la fase M tienen que completarse
proteicos denominados cohesinas, que se ensamblan a lo dos eventos básicos: el ADN tiene que replicarse totalmente
largo de cada una de ellas a medida que el ADN se va repli- y en las células animales debe duplicarse el centrosoma. El
cando. La cohesión de las cromátidas es fundamental para centrosoma es el principal centro organizador de los micro-
la segregación adecuada de los cromosomas, misma que túbulos, que en las células animales debe duplicarse para
desaparece en la fase tardía de la mitosis, para permitir la poder contribuir a la formación de los dos polos del huso
separación de las cromátidas hermanas. Al terminar la re- mitótico, que luego separarán los cromosomas duplicados y
plicación, la célula entra en la fase G2. los distribuirán en las dos células hijas, que deberán tener
su propio centrosoma.
Fase de preparación para la división
de la cromatina (G2) En las células animales el centrosoma también contiene
un par de centríolos, cada uno constituido por una estruc-
En la fase G2 la célula verifica si se ha completado la fase S tura cilíndrica de microtúbulos cortos.
de forma correcta y decide entre permitir el paso a mitosis,
o en caso contrario, esperar a que se realicen las reparacio- Durante la interfase de cada ciclo de una célula animal,
nes necesarias. el centrosoma se duplica, y ambas copias permanecen jun-
tas como un complejo único a un lado del núcleo. Cuando
En la fase G2 se inicia la condensación gradual de la cro- se inicia la mitosis, los dos centrosomas se separan y cada
matina (proceso inverso a la fase G1 o de descondensación), uno origina una estructura radial de microtúbulos denomi-
que se completa en las primeras etapas de la mitosis, lo que nada áster. Los dos ásteres se desplazan en direcciones
da lugar a cromosomas visibles al microscopio, con un opuestas del núcleo para formar los dos polos del huso
aspecto típico de dos cromátidas y cuatro brazos. Aunque mitótico; cuando se rompe la envoltura nuclear el huso cap-
puede considerarse que cada molécula de ADN es un cro- tura los cromosomas y finalmente los separa en una fase
mosoma en cualquier momento del ciclo, el término cro- más tardía de la mitosis. Cuando la mitosis termina y la
mosoma corresponde estrictamente a esta forma de máxima envoltura nuclear se reconstituye alrededor de los cromo-
condensación. En cambio, los términos cromosoma meta- somas separados, cada célula hija recibe un centrosoma
fásico y cromosoma interfásico se utilizan para referirse a las junto con sus cromosomas. El proceso de duplicación y
formas de la cromatina condensada y descondensada, res- separación del centrosoma se conoce como ciclo del cen-
pectivamente. trosoma.

Fase de compactación o división (M) Mitosis

La fase M es, en sí, un proceso continuo, que para su estu- El eje central de la mitosis consiste en separar y distribuir de
dio se divide en seis etapas. Las primeras cinco (profase, manera equitativa los cromosomas, ya replicados en la fase
prometafase, metafase, anafase y telofase) constituyen la S que le precede, con la finalidad de que cada célula hija
reciba una copia idéntica del genoma. Ésta es una etapa del
ciclo celular en la que la célula cesa la mayor parte de sus
actividades metabólicas y presenta una falta relativa de res-
puesta a estímulos externos, debido a que dedica toda su

18 PARTE I • Conceptos básicos de biología molecular

energía a la separación cromosómica. La mitosis, a su vez, Profase
se subdivide en cinco fases, llamadas profase, prometafase, 1. El material genético se condensa.
metafase, anafase y telofase, acompañadas de un proceso 2. El citoesqueleto se desensambla y
denominado citocinesis, en el cual la célula en división se
separa en dos. el uso mitótico se ensambla.
3. La envoltura nuclear se dispersa
Profase
Prometafase
Durante la profase los cromosomas replicados se conden- 1. Los microtúbulos cromosómicos
san y se preparan para separarse, y el huso mitótico comien-
za a formarse afuera del núcleo. La envoltura nuclear se se unen a los cinetocoros.
rompe, el citoesqueleto se desensambla, el complejo de 2. Los cromosomas se alinean al
Golgi y el retículo endoplásmico se fragmentan, y la envol-
tura nuclear se dispersa, lo que marca el inicio de la prome- ecuador del hueso.
tafase.
Metafase
Prometafase 1. Los cromosomas se encuentran

En esta fase se forma el huso mitótico definitivo que permi- alineados al ecuador en la placa
te a los microtúbulos del huso entrar en contacto con los de la metafase, unidos por
cromosomas, mismos que se mueven a una posición en el microtúbulos cromosómicos por
centro de la célula. ambos polos.

Metafase Anafase
1. Los centrómeros se dividen.
En la metafase los cromosomas se encuentran alineados en 2. Las cromatides hermanas se separan.
el ecuador del huso, con una cromátide de cada cromosoma 3. Los cromosomas migran a polos
conectada a un polo opuesto. El plano de alineación de los
cromosomas se conoce como placa de la metafase. El huso opuestos del huso.
mitótico de la célula en metafase se encuentra altamente
organizado para separar los cromosomas duplicados. Los Telofase
microtúbulos del huso en esta fase tienen la misma pola- 1. Los cromosomas se aglomeran en
ridad pero funcionalmente se dividen en tres grupos:
1) microtúbulos astrales, que irradian hacia fuera a partir polos opuestos.
del centrosoma en la región situada por fuera del cuerpo del 2. Los cromosomas se dispersan.
huso, y es probable que ayuden en la colocación del aparato 3. La envoltura nuclear se ensambla.
del huso dentro de las células y determinen el plano de la 4. Las células hijas se forman por citocinesis.
citocinesis; 2) microtúbulos cromosómicos, que se extien-
den desde el centrosoma hacia una estructura proteica Figura 2-3. Fases de la mitosis. La mitosis está conformada por
localizada en el centrómero del cromosoma, que permite el varias etapas: profase, prometafase, metafase, anafase y telofa-
anclaje de los microtúbulos del huso a los cromosomas y se se. En este esquema pueden observarse las características de
denomina cinetocoro; este proceso es necesario para el des- cada una de ellas en relación con los cambios experimentados
plazamiento de los cromosomas hacia los polos durante la por el material genético y la célula en general.
anafase, y 3) microtúbulos polares (o interpolares), que se
extienden desde el centrosoma hasta pasar los cromosomas cromosomas de la placa metafásica se separan de manera
y forman una canastilla estructural que mantiene la integri- sincronizada, y las cromátides (ahora conocidas como cro-
dad del huso. mosomas, pues ya no se encuentran fijas a su duplicado)
inician su migración hacia los polos. El movimiento de cada
Las dos cromátides hermanas de cada cromosoma cromosoma hacia un polo se acompaña del acortamiento
replicado se comprimen una contra otra a lo largo de las de los microtúbulos fijos al cinetocoro.
superficies internas y aparentemente se mantienen juntas
por unas proteínas de “pegamento” no cromosómicas Telofase
denominadas cohesinas.
Durante la telofase los cromosomas se acercan a sus respec-
Anafase tivos polos y tienden a reunirse en una sola masa marcando
el inicio de esta etapa final de la mitosis. La envoltura nuclear
Ésta se inicia cuando se separan en forma sincrónica y súbi- se reconstituye conforme las vesículas membranosas se
ta las cromátides hermanas, y se acompaña de la liberación unen a la superficie de los cromosomas y luego se fusionan
de la proteína “pegamento” dentro del citoplasma; todos los lateralmente para formar una cubierta de doble membrana
cada vez más grande. La envoltura nuclear reconstituida se
acomoda alrededor de cada uno de los dos conjuntos de
cromosomas separados para formar dos núcleos (figura
2-3).

Citocinesis o citodiéresis

La división del citoplasma se inicia al final de la anafase y
continúa durante la telofase.

La citocinesis, o citodiéresis, es la separación f ísica del CAPÍTULO 2 • Ciclo celular 19
citoplasma en dos células hijas durante la división celular y
se produce después de la cariocinesis, al final de la telofase. Filamentos
El mecanismo de las células animales y el de las vegetales es de actina
distinto. En las células animales tiene lugar por estrangula- Filamentos
ción de la célula en el ecuador del huso, y se lleva a cabo de miosina
mediante la participación de proteínas ligadas a la membra-
na (actina y miosina), que forman un anillo contráctil. Formación del anillo
contráctil
El primer indicio de citocinesis en animales se observa
durante la anafase tardía como una depresión en la superfi-
cie de la célula dentro de una banda estrecha alrededor de
ésta. Conforme avanza el tiempo, la indentación se profun-
diza y se convierte en un surco que rodea por completo a la
célula. El plano del surco se sitúa en el mismo plano que
ocupaban previamente los cromosomas de la placa de la
metafase; en otras palabras, el plano del surco es perpen-
dicular al eje del huso mitótico, lo que garantiza que los dos
conjuntos de cromosomas se separen finalmente en dos cé-
lulas. El surco continúa profundizándose hasta que las
superficies opuestas hacen contacto en el centro de la célula
y ésta se separa en dos. Este proceso se lleva a cabo por el
impulso de contracciones progresivas causadas por un ani-
llo periférico contráctil.

Las células vegetales tienen un proceso diferente de
división que consiste en la acumulación de vesículas proce-
dentes del aparato de Golgi, que contienen elementos de la
pared celular, en la zona media de la célula. Las vesículas se
fusionan y entran en contacto con las paredes laterales de la
célula. De esta forma se origina el tabique o fragmoplasto,
que hará posible la división celular (figura 2-4).

Fase G0 o de quiescencia Surco de división

Algunas células permanecen en reposo tras la fase M, que
puede ser una etapa transitoria, durar largo tiempo o no
dividirse definitivamente, a menos que se estimulen para
ello. En el cuerpo o en un medio de cultivo se encuentran
“detenidas”, y cuando se produce un estímulo adecuado, o si
las condiciones ambientales son las idóneas, pueden pro-
seguir a la fase G1 del ciclo y continuar hasta la mitosis.

Control del ciclo celular Como resultado se originan
dos células hijas
En el control del ciclo celular participan complejos de pro-
teínas que actúan en cada una de las etapas y permiten, o Figura 2-4. Citocinesis. La formación del anillo contráctil se
no, el avance del ciclo. Estas proteínas se denominan cicli- produce durante la etapa de citocinesis. Dicho anillo es el en-
nas y cinasas dependientes de ciclinas (Cdk), que se unen cargado de estrangular el citoplasma de la célula hasta dividirla
formando complejos de dos subunidades: una posee activi- en dos. La composición del anillo contráctil es principalmente
dad cinasa y transfiere grupos fosfato del adenosín trifosfa- de filamentos de actina y miosina.
to (ATP) a residuos serina y treonina de proteínas diana o
blanco, implicadas en la progresión del ciclo celular, y la va, la cinasa se activa y la célula avanza dentro del ciclo
otra actúa como una subunidad reguladora llamada ciclina. celular. Debido a esto a las enzimas con actividad cinasa se
Cuando la concentración de ciclina es baja, la cinasa per- las denominó Cdk, y se descubrió que dirigen diversas acti-
manece inactiva, pero si la concentración de ciclina se ele- vidades durante el ciclo celular.

20 PARTE I • Conceptos básicos de biología molecular

Punto de control en G Punto de control en la metafase Puntos de revisión (check points)
2
· Todos los cromosomas están Los puntos de revisión son mecanismos que detienen la
· Todo el ADN está replicado alineados adecuadamente progresión del ciclo celular en caso de que cualquier ADN
· La célula es lo suficientemente grande cromosómico se dañe o si ciertos procesos no se llevaron a
· El medio ambiente es favorable Salida cabo de manera correcta, como la replicación del ADN en
de M la fase S o la alineación cromosómica durante la fase M.
Entrada
aM En estos puntos participan proteínas que, a manera de
sensores, reconocen el daño en el ADN y las anormalidades
Ciclina celulares. Si una de estas proteínas detecta un defecto, ini-
B/A + Cdk1 cia una respuesta que detiene de forma transitoria el pro-
greso del ciclo celular. Entonces la célula puede reparar el
M daño o corregir el defecto antes de ingresar a una nueva
G etapa. En caso de que el daño sea mayor y no sea posible
repararlo, el mecanismo de revisión transmite una señal
2 que conduce a la muerte de la célula dañada. Los principa-
les puntos de control se encuentran ubicados en G1 antes de
S G1 Ciclina la síntesis de ADN, en G2 antes de la mitosis y en la mitosis
D’s + Cdk4 durante la metafase (figura 2-5).
o Cdk6
Dos de las principales proteínas que funcionan como
Ciclina sensores en estos puntos de control son ATM (ataxia-
A + Cdk2 Ciclina Entrada telangiectasia mutada) y ATR (proteína relacionada con
ataxia-telangiectasia y Rad3), que son parte de complejos
E + Cdk2 a S multiproteicos capaces de unirse al ADN dañado. ATM es el
· La célula es lo suficientemente principal mediador de la respuesta a las roturas de ambas
grande cadenas del ADN, un tipo de daño característico de las
· El medio ambiente favorable radiaciones ionizantes, mientras que ATR interviene en
respuesta al daño inducido por radiación ultravioleta (UV).
Punto de control en G1 Una vez unidas pueden fosforilar una variedad de proteínas
que participan en los puntos de revisión del ciclo celular.
Figura 2-5. Regulación del ciclo celular. En este esquema se
presenta la ubicación de los principales puntos de control que Otro tipo de proteínas con capacidad de regular el ciclo
regulan el ciclo celular. El paso de una etapa a otra está regu- celular son las conocidas como proteínas supresoras de
lado por complejos ciclina-cinasa. La actividad de Cdk en G1 tumores. Entre las más importantes se encuentran Rb (pro-
temprana es muy baja, pero se incrementa conforme avanza la teína del retinoblastoma) y p53. Rb se encarga de detener la
fase. También se observa actividad de Cdk4 y Cdk6 acopladas célula en la fase G1, contiene pocos aminoácidos fosforila-
a las ciclinas D (D1, D2 y D3). El principal sustrato de estas dos, e impide la entrada a la fase S al unirse al factor de
Cdk es la proteína reguladora Rb; su fosforilación conlleva la transcripción E2F, evitando que éste se asocie a secuencias
transcripción de varios genes como los que codifican para potenciadoras en sus genes blanco. A medida que avanza el
las ciclinas E y A, Cdk1 y varias proteínas que participan en ciclo celular, Rb se hiperfosforila de manera progresiva, lo
la replicación. El paso de la fase G1 a S, es impulsada por la que provoca que Rb se desprenda de E2F, y le permite
actividad de la Cdk2 con ciclina E y ciclina A. La transición de comenzar la síntesis de ADN. Por otra parte, p53 desempe-
G2 a M comienza con la activación de la ciclina A y Cdk1, ade- ña su función reguladora en la fase G1. Las lesiones del ADN
más de los complejos ciclina B1-Cdk1, los cuales se cree que nuclear dan lugar a la fosforilación, la estabilización y
fosforilan sustratos como proteínas citoesqueléticas, histonas y la activación de p53. Al ser activada, esta proteína estimula la
proteínas de la envoltura nuclear. transcripción de la proteína p21 que detiene la progresión
del ciclo celular para permitir la reparación del daño. Si éste
Estudios en levaduras permitieron observar que el ciclo es irreparable, p53 desencadena la apoptosis (figura 2-6).
celular en una célula eucariota se regula en distintas etapas.
El primer punto de transición, denominado START, ocurre Meiosis
antes del final de G1. Una vez que la célula ha pasado este
punto, está destinada en forma irrevocable a replicar su La meiosis es el proceso durante el cual el número de cro-
ADN y a completar el ciclo celular. El paso por START mosomas se reduce de modo que se forman células que sólo
requiere la activación de Cdk por una o más ciclinas G1, contienen un miembro de cada par de cromosomas homó-
cuyos niveles se elevan al final de G1. logos. Así, la meiosis garantiza la producción de una fase
haploide en el ciclo de vida, y la fertilización asegura una
El paso de G2 a la mitosis requiere de la activación de
Cdk por un grupo diferente de ciclinas, las ciclinas mitóti-
cas. A este complejo se lo denomina factor promotor de la
mitosis (MPF), y se encarga de fosforilar los sustratos nece-
sarios para que la célula inicie la mitosis. La salida de la
mitosis y el ingreso a G1 depende de un descenso rápido en
la actividad de Cdk, consecuencia de una caída en la con-
centración de ciclinas mitóticas.

CAPÍTULO 2 • Ciclo celular 21

Radiación B
ionizante

ATM

Chk2

a Chk2 C
PP
P p53 DP 1/2
p53 Rb
E2F

b

Radiación cP P21 gen Ciclina D PPP I
UV Cdk 4/6 Rb P

A p53

ARNm p21

ATR p21 d DP 1/2

Inactiva Inactiva Activa E2F
Chk1 Cdk Cdk II
1
Activa p21 e
Cdc25 Chk1

P E2FDP 1/2
2 Cdc25
Paro del ciclo Progresión del
Inactiva celular ciclo celular
3 CdK

5

Proteína Citoplasma
adaptadora
4
P

Cdc25

Figura 2-6. Control del ciclo celular. En este esquema se muestran tres de las principales vías que controlan la progresión del ci-
clo celular. En la vía A se muestra cómo ATR se activa tras un daño específico; éste, a su vez, fosforila y activa la cinasa del punto
de revisión Chk1 1), que fosforila y desactiva la fosfatasa Cdc25 2), la cual, en condiciones normales, se desplaza entre el núcleo
y el citoplasma 3), pero una vez fosforilada se une a una proteína adaptadora en el citoplasma 4) y no puede importarse de nuevo
al núcleo, lo que deja a Cdk en su estado inactivo 5). En la vía B se observa cómo ATM, tras activarse por un daño específico, se
activa y fosforila y activa la cinasa del punto de revisión Chk2 a) que fosforila p53 b), el cual activa la transcripción de P21 c), y
la proteína p21 producida inhibe de forma directa la Cdk e) en ambas vías, resultando en el paro del ciclo celular. En la vía C se
muestra la proteína Rb que, en condiciones normales se encuentra parcialmente fosforilada y unida al factor transcripcional E2F
(I); ésta se hiperfosforila por el complejo D-Cdk 4/6, lo que provoca que se desprenda de E2F permitiéndole a la célula entrar a la
fase S.

22 PARTE I • Conceptos básicos de biología molecular

fase diploide. Sin meiosis, la reproducción sexual sería im- Interfase
posible. A diferencia de la mitosis, en la meiosis la duplica- La célula duplica su material
ción de los cromosomas va seguida por dos divisiones en genético
secuencia que distribuyen los cromosomas entre cuatro
núcleos. Profase I
Entrecruzamiento cromosómico
Para asegurar que cada núcleo hijo, formado durante la
meiosis, posea un miembro de cada par de cromosomas Metafase I
homólogos, ocurre un elaborado proceso de formación de Alineamiento de los cromosomas
pares de cromosomas que no tienen contraparte en la mito- en el plano ecuatorial
sis. A medida que se alinean los pares de cromosomas se
desarrolla un proceso de recombinación genética entre las Anafase I
cromátidas hermanas con intercambio de fragmentos de Desplazamiento de los
ADN entre un cromosoma paterno y su correspondiente cromosomas hacia polos
cromosoma materno, dando como resultado la producción opuestos
de cromosomas en donde ninguno de ellos es idéntico a otro.
Telofase I
Fases de la meiosis Se forma la membrana nuclear y
comienza la citocinesis
La meiosis es un tipo especial de división celular que origi-
na gametos o células germinales masculinas y femeninas Profase I
(espermatozoides y óvulos, respectivamente), cada una de Se rompe la membrana nuclear
las cuales contiene la mitad de la dotación cromosómica y se forma el nuevo huso
normal. A esta dotación media de cromosomas de cada
gameto se la conoce como número haploide (n). Por lo tan- Metafase II
to, esta división, también conocida como gametogénesis, Alineación de los cromosomas
termina produciendo cuatro células hijas (gametos), que en el plano ecuatorial
más tarde se fusionarán para formar cigotos, que ya tienen Anafase II
el número diploide de cromosomas (2n). Se separan las cromátidas de
cada cromosoma
La meiosis se divide en dos fases separadas:
Telofase II
Meiosis I (o división reductora) Se forma la membrana nuclear y
comienza la citocinesis
En ella tienen lugar algunos sucesos importantes:
Como resultado se obtienen 4
• A diferencia de la mitosis, no ocurre separación de cro- células haploides
mátidas, sino que cada cromosoma duplicado de cada
par homólogo emigra a cada polo del huso. Figura 2-7. Etapas de la meiosis. Esquema general de las fases
involucradas en la meiosis.
• Durante esta primera división meiótica hay un intercam-
bio de alelos (genes alternos que representan el código que se establece por medio del complejo sinaptonémi-
para una misma característica) entre las cromátidas de co, forma una tétrada.
los pares homólogos de los cromosomas duplicados. • Paquiteno: se completa la sinapsis en todos los cromo-
Este intercambio supondrá la formación de cromátidas somas. Tiene lugar un entrecruzamiento cromosómico
con diferente constitución genética en la célula madre. mediante quiasmas, y como consecuencia tiene lugar
una recombinación genética. Suelen darse dos o tres de
Profase I estos entrecruzamientos por cada par bivalente.
• Diploteno: comienza la separación de los cromosomas
Ésta es la fase más larga de la meiosis, y en ella los cromoso- homólogos, y pone aún más de manifiesto los quiasmas.
mas homólogos intercambian fragmentos de material gené- • Diacinesis: los cromosomas se condensan al máximo y
tico. Se divide en cinco subfases: desaparecen el núcleo y la membrana nuclear, por lo
que quedan libres en el citoplasma. Se puede apreciar
• Leptoteno: los cromosomas individuales, compuestos cómo cada bivalente está unido por cuatro cromátidas
por dos cromátidas unidas por el centrómero, empiezan (tétradas).
a condensarse y hacerse visibles, y forman largas tiras en
el núcleo. Metafase I
Durante esta fase los cromosomas homólogos se alinean en
• Cigoteno: los pares de cromosomas homólogos se el plano ecuatorial completamente al azar, lo que garantiza
aproximan entre sí, y tiene lugar la sinapsis o aparea- la reunión de los cromosomas maternos y paternos.
miento, que suele comenzar por los extremos y se
extiende a lo largo de los cromosomas. Esta sinapsis,

CAPÍTULO 2 • Ciclo celular 23

Anafase I Esta división no va precedida por una fase S; por lo
demás, resulta bastante similar a la mitosis:
Es la separación de cada bivalente, que se desplazan hacia
los polos opuestos de la célula. Cada cromosoma sigue Profase II
constituido aún por dos cromátidas. Es muy corta; se rompe la membrana nuclear y se forma el
nuevo huso.
Telofase I
Metafase II
Esta fase es parecida a la de la mitosis: los cromosomas lle- Los cromosomas, cada uno de ellos formado por dos cro-
gan hasta los polos opuestos, se vuelven a formar los mátidas, se alinean en el plano ecuatorial.
núcleos y comienza la citocinesis. Cada célula hija recibe 23
cromosomas (n), pero como cada cromosoma está com- Anafase II
puesto por dos cromátidas, el contenido de ADN todavía es Se separan las cromátidas de cada cromosoma.
diploide. Cada una de las células hijas recién formadas entra
en la meiosis II. Telofase II
Se forma la membrana nuclear alrededor de los cuatro
Meiosis II (o división ecuatorial) núcleos haploides y comienza la citocinesis.

Tan sólo tiene lugar la separación por el centrómero de El resultado final son cuatro células hijas que, a diferen-
cada cromosoma para liberar las cromátidas que emigran a cia de lo que ocurre en la mitosis, contienen el número
cada polo opuesto del huso. haploide de cromosomas y son distintas desde el punto de
vista de su dotación genética. Esto significa que cada gameto
En el hombre, cada uno de los cuatro gametos resultan- contiene su propio complemento genético único (figura 2-7).
tes sufre una transformación hasta espermatozoide madu-
ro. En la mujer, el citoplasma se distribuye de manera
desigual entre los cuatro gametos resultantes: uno de ellos
lo gana casi todo (óvulo), mientras que los otros tres (cuer-
pos residuales) degeneran.

Ejercicios de integración 2. Señale la ubicación de los puntos de control dentro del
ciclo celular y qué características revisan cada uno de
1. Complete la imagen colocando el nombre de las etapas ellos.
que componen la fase M y su duración promedio. Asimis-
mo, describa las características principales de las fases
G1, S y G2 y el nombre con el que se conoce a estas tres
etapas en conjunto.

G1: S: M
G2: G

Fase M 2

S
G

1

24 PARTE I • Conceptos básicos de biología molecular

3. Escriba en los cuadros inferiores si el estado de la proteína de arriba es activo o inactivo.

P PP PPP
p53
p53 P Cinasa Ciclina Ciclina Cinasa
Rb p21
Rb Cinasa

Preguntas de repaso 4. Mencione la ubicación de los tres principales puntos de
control dentro del ciclo celular y qué es lo que se verifica
1. En cuanto a las células hijas originadas, ¿cuál es la dife- en cada uno de ellos.
rencia principal entre mitosis y meiosis?
5. Para permitir la progresión del ciclo celular, ¿es necesario
2. Mencione las fases que componen la mitosis en orden de que las Cdk se encuentren en su forma activa o inactiva?
ejecución. ¿Qué proteínas activan e inactivan a las Cdk?

3. Cuando se habla de células con un número haploide y
diploide de cromosomas, ¿a qué se hace referencia?

Bibliografía Luque J, Herráez A. Biología molecular e ingeniería genética. Ma-
drid: Harcourt Editora, 2006:97-106.
Alberts B, Bray D, Hopkin K, Johnson A, Lewis J, Raff M, et al. In-
troducción a la biología celular, 2ª ed. Madrid: Editorial Médica Murray RK, Mayes PA, Granner DK, Rodwell VK. Bioquímica de
Panamericana, 2006:611-671. Harper, 15ª ed. México, DF: El Manual Moderno, 2001.

Gregory CS, Stephen CW. Patología estructural. Fundamentos Rubín E, Gorstein F, Rubín R, Schwarting R, Strayer D. Patología
clínicos patológicos en medicina, 4ª ed. Barcelona: McGraw-Hill estructural. Fundamentos clinicopatológicos en Medicina, 4ª ed.
Interamericana, 2000. Madrid: McGraw-Hill Interamericana Aravaca, 2006:99-101.

Karp G. Biología celular y molecular. México, DF: McGraw-Hill
Interamericana, 2006:621-669.

Lodish H, Berk A, Zipursky SL, Matsudaira P, Baltimore D, Darnell
J. Molecular cell biology, 4ª ed. Nueva York: Freeman, 2000.

Capítulo 3

Ácidos nucleicos

José Navarro Partida / Mayra Mena Enríquez

Introducción 3. Grupo fosfato, causante de las cargas negativas de los
ácidos nucleicos y que le brinda características ácidas
Las células son las unidades funcionales de cualquier (figura 3-1).
organismo vivo. Las instrucciones necesarias para dirigir
sus actividades están contenidas en los cromosomas, que Las bases nitrogenadas son moléculas formadas de
en el caso de las eucariotas se localizan en el núcleo celular átomos de carbono y nitrógeno que crean anillos heterocí-
y son conocidas en su conjunto como información gené- clicos. Se conocen dos tipos de bases nitrogenadas: las puri-
tica. nas y las pirimidinas. Las purinas se componen de dos
anillos condensados, mientras que las pirimidinas están
Ácidos nucleicos formadas por un solo anillo. Los átomos de carbono y nitró-
geno de los anillos se identifican mediante números natura-
Los ácidos nucleicos constituyen el material genético de los les: del 1 al 6 para las pirimidinas y del 1 al 9 para las purinas
organismos y son necesarios para el almacenamiento y la (figura 3-2). Las purinas se sintetizan de novo en el hígado
expresión de la información genética. Existen dos tipos de como mononucleótidos unidos con una molécula de ribosa
ácidos nucleicos química y estructuralmente distintos: el 5-fosfato; las pirimidinas lo hacen como bases libres y des-
ácido desoxirribonucleico (ADN) y el ácido ribonucleico pués se unen a la ribosa 5-fosfato. Es importante mencionar
(ARN); ambos se encuentran en todas las células procario- que el recambio de ácidos nucleicos da lugar a la liberación
tas, eucariotas y virus. El ADN funciona como el almacén de bases libres, tanto de purinas como pirimidinas; estas
de la información genética y se localiza en los cromo- bases se reciclan y se unen a una pentosa y un grupo fosfato
somas del núcleo, las mitocondrias y los cloroplastos de para generar de nuevo el nucleótido.
las células eucariotas. En las células procariotas el ADN se
encuentra en su único cromosoma y, de manera extracro- Las purinas características de los ácidos nucleicos son
mosómica, en forma de plásmidos. El ARN interviene en la adenina (A) y guanina (G), ambas presentes en los nucleóti-
transferencia de la información contenida en el ADN hacia dos del ADN y del ARN. Las pirimidinas características de
los compartimientos celulares. Se encuentra en el núcleo, el los ácidos nucleicos son la citosina (C), la timina (T) y el
citoplasma, la matriz mitocondrial y el estroma de cloro- uracilo (U). La C está presente en los nucleótidos que com-
plastos de células eucariotas y en el citosol de células proca- ponen tanto al ADN como al ARN, mientras que la T sólo
riotas. forma los nucleótidos que componen al ADN y el U, única-
mente los nucleótidos que componen al ARN.
Composición de los ácidos nucleicos
La pentosa que compone el nucleótido es la D-ribosa
La unidad básica de los ácidos nucleicos es el nucleótido, para el ARN y la D-desoxirribosa en el caso del ADN. Los
una molécula orgánica compuesta por tres componentes: nucleótidos que contienen ribosa se denominan ribonu-
cleótidos, mientras que los que contienen desoxirribosa,
1. Base nitrogenada, una purina o pirimidina. desoxirribonucleótidos. Los carbonos de la pentosa se iden-
2. Pentosa, una ribosa o desoxirribosa según el ácido tifican en los nucleótidos mediante números del 1 al 5, con
una comilla, y se denominan primos. La diferencia entre la
nucleico. ribosa y la desoxirribosa es que la primera posee un grupo
OH en el carbono dos, mientras que la segunda carece de

25

26 PARTE I • Conceptos básicos de biología molecular

NH2 OHCH 2 O OH OHCH 2 O OH
4 5´ 5´

5 3N 4´ 1´ 4´ 1´
2
O 6 HH HH HH HH
OP O O 3´ 2´ 3´ 2´
1
O CH2 O N
5
OH OH OH H
41 Ribosa Desoxirribosa

HH HH Figura 3-3. Estructura hemiacetal de la ribosa y desoxirribosa.
3 2

OH H segundo y el tercer fosfatos se conectan con el nucleótido
mediante un enlace fosfoanhídrido que requiere un gasto
Grupo fosfato + Pentosa + Base nitrogenada de energía para su formación. Químicamente, los nucleóti-
dos pueden definirse como ésteres monofosfato, difosfato o
Figura 3-1. Estructura de los nucleótidos. trifosfato de nucleósidos. Los nucleótidos son moléculas
ácidas, ya que el grupo fosfato se ioniza en medio acuoso.
dicho grupo funcional y sólo cuenta con un hidrógeno (Para la nomenclatura completa de las moléculas nucleotí-
(figura 3-3). dicas véase el cuadro 3-1.)

Nucleósidos Cadenas de ácidos nucleicos

La unión de una base nitrogenada y la pentosa produce un o polinucleótidos
nucleósido, mediante un enlace covalente denominado
N-glucosídico que se forma entre el C-1’ de la pentosa y el Los nucleótidos se unen mediante enlaces fosfodiéster para
N-1 de las pirimidinas o bien el N-9 de las purinas (figura dar lugar a cadenas de ácidos nucleicos o polinucleótidos.
3-4). Si la base nitrogenada se une a una ribosa da lugar a los El enlace fosfodiéster tiene lugar entre el C-5’-fosfato de un
ribonucleósidos, y si, por el contrario, lo hace a una desoxi- nucleótido y el C-3’-hidroxilo del siguiente nucleótido. La
rribosa genera los desoxirribonucleósidos. unión sucesiva de nucleótidos mediante enlace 3,5-fosfo-
diéster genera un polinucleótido polarizado; es decir, con
Nucleótidos extremos diferentes. Por un lado de la cadena se encuentra
un extremo 5’-fosfato y, por el otro, un extremo 3’-hidroxilo
La unión de un grupo fosfato a un nucleósido da lugar a una (figura 3-5). Si la cadena es de ribonucleótidos, se genera un
molécula de nucleósido monofosfato o nucleótido, como polirribonucleótido o cadena de ARN, mientras que si la
por ejemplo la adenosina monofosfato (AMP). Si se agrega cadena se forma con desoxirribonucleótidos se origina un
un segundo o un tercer fosfato al nucleósido monofosfato polidesoxirribonucleótido o cadena de ADN.
se obtiene un nucleósido difosfato (como el ADP) o bien
trifosfato (como el ATP). Los nucleósidos, en su forma de Los nucleótidos que constituyen las cadenas de ADN
monofosfato, son los componentes de los ácidos nucleicos; contienen las bases A, G, T y C; mientras que los nucleóti-
aunque cuando se encuentran libres lo están en su forma dos que forman las cadenas de ARN están constituidos por
trifosfatada. El primer fosfato se une al nucleósido median- las bases nitrogenadas A, G, C y U. Por consenso universal,
te un enlace éster con el OH del carbono 5’ de la pentosa. El la secuencia de nucleótidos en una cadena de polinucleóti-
dos se escribe en dirección 5’ → 3’, y el orden exacto de
nucleótidos o secuencia de la cadena se considera la estruc-

HO N O OH
6 CH3
NH2 N 8 7 8 NH2 N 34
7 N1 5 HN 3 4 5 2
6 5 9 2 9 54
N1 N 4 N 6 3N 26 1 65
4 H NH2 3 H 1
2 3 12
N N NO ON OH N
H
Adenina Guanina Citosina Uracilo
Timina

Figura 3-2. Bases nitrogenadas.

CAPÍTULO 3 • Ácidos nucleicos 27

NH2 NH2 N 8 componen los nucleótidos, y si se modifica alguna de estas
4 7 9 bases o su orden se alterará la información.
6 5
3N N1 N Estructura secundaria del ADN
2 4
5 2 3 En células eucariotas el ADN se encuentra como una cade-
O N na doble de polidesoxirribonucleótidos (double strand
6 DNA, dsADN). Las dos cadenas del ADN giran alrededor
1 CH2 O de un eje de simetría imaginario y forman una estructura
CH2 O N 5´ helicoidal, de aquí su nombre de “doble hélice del ADN”
5´ descrita por Watson y Crick en 1953. En la hélice del ADN,
4´ 1´ 4´ 1´ la columna hidrof ílica de desoxirribosa-fosfato de cada
H H HH H H HH cadena está en el exterior de la molécula, mientras que las
3´ 2´ bases nitrogenadas hidrófobas se orientan hacia el interior.
3´ 2´ La relación espacial que se genera por el giro entre las dos
cadenas de la hélice crea un surco mayor (ancho) y uno
OH H OH H menor (estrecho) (figura 3-7). La doble cadena del ADN
Pentosa + Base nitrogenada Pentosa + Base nitrogenada tiene tres características principales:

Figura 3-4. Estructura de los nucleósidos. • Es antiparalela.
• Es complementaria.
tura primaria de los ácidos nucleicos. El enlace fosfodiéster • Forma un giro helicoidal dextrógiro o levógiro.
entre nucleótidos puede escindirse por las nucleasas: DNa-
sas para el ADN y RNasas para el ARN. La asociación entre las dos cadenas es antiparalela; es
decir, el extremo 5´ de una se asocia con el extremo 3’ de la
Estructura del ADN otra. Las dos cadenas son complementarias; esto es, las
bases nitrogenadas de una de las cadenas del ADN se unen
Estructura primaria del ADN mediante puentes de hidrógeno a las bases nitrogenadas de

Corresponde a la secuencia de nucleótidos del polinucleóti-
do linearizado (figura 3-6). La información genética está
contenida en el orden exacto de las bases nitrogenadas que

Cuadro 3-1. Nomenclatura de nucleótidos.

Base Nucleósido Nucleótido 2 grupos fosfato 3 grupos fosfato
Adenina Base + ribosa Base + ribosa Adenosina trifosfato (ATP)
Guanina 1 grupo fosfato Guanosina trifosfato (GTP)
Citosina Citidina trifosfato (CTP)
Uracilo Adenosina Ácido adenílico Adenosina difosfato (ADP) Uridina trifosfato (UTP)

Base Adenosina monofosfato (AMP) 3 grupos fosfato
Adenina Desoxiadenosina trifosfato (ATP)
Guanosina Ácido guanílico Guanosina difosfato (GDP)
Guanina Desoxiguanosina trifosfato (GTP)
Guanosina monofosfato (GMP)
Citosina Desoxicitidina trifosfato (CTP)
Uracilo Citidina Ácido citidílico Citidina bifosfato (CDP) Desoxiuridina trifosfato (UTP)

Citidina monofosfato (CMP)

Uridina Ácido uridílico Uridina difosfato (CDP)

Uridina monofosfato (UMP)

Desoxinucleósido Nucleótido 2 grupos fosfato
Base + desoxirribosa Base + desoxirribosa

1 grupo fosfato

Desoxiadenosina Ácido desoxiadenílico Desoxiadenosina difosfato (ADP)

Desoxiadenosina monofosfato
(AMP)

Desoxiguanosina Ácido desoxiguanílico Desoxiguanosina difosfato (GDP)

Desoxiguanosina monofosfato
(GMP)

Desoxicitidina Ácido desoxicitidílico Desoxicitidina difosfato (CDP)

Desoxicitidina monofosfato (CMP)

Desoxiuridina Ácido desoxiuridílico Desoxiuridina difosfato (UDP)

Desoxiuridina monofosfato (UMP)

28 PARTE I • Conceptos básicos de biología molecular

Extremo 5´ A
O C
T
O PO
G
O T

CH2 O C
5 1

4

HH HH
3 2

OH

O PO

O

CH2 O A
5 1

4

HH HH
3 2

OH

O PO C
A
O

CH2 O T
5 1

4

HH HH
3 2

OH T
G
O PO Figura 3-6. Estructura primaria del ADN.

O

CH2 O G
5 1

4

HH HH
3 2

Extremo 3´ OH H

Figura 3-5. Formación de un polinucleótido o cadena de ADN. Variantes de la doble cadena de ADN

la otra cadena, de manera que A siempre se une a T, y G a Se han descrito tres formas estructurales principales del
C. Por lo tanto, la secuencia de nucleótidos de una cadena ADN: la forma B, descrita por Watson y Crick, la forma A y
define y complementa la secuencia de nucleótidos en la la forma Z. La forma B es la que adopta el ADN en condicio-
otra. Así, una cadena de la doble hélice del ADN siempre es nes fisiológicas, por lo que es la estructura predominante en
el complemento de la otra. Los pares de bases se mantienen el ADN cromosómico. La forma A se produce in vitro con la
unidos mediante dos enlaces de hidrógeno entre A y T, y deshidratación moderada de la forma B. Es probable que la
tres enlaces de hidrógeno entre G y C (figura 3-8). El apa- conformación de los híbridos ADN-ARN y del ARN de doble
reamiento específico de bases entre las cadenas de ADN cadena se asemeje a la forma A. La forma Z del ADN es
sustenta las llamadas reglas de Chargaff: en cualquier característica de regiones donde se encuentra una secuencia
muestra de ADN de cadena doble, la cantidad de A es igual de purinas y pirimidinas alternadas (por ejemplo, zonas de
a la cantidad de T, la cantidad de G es igual a la de C, y la repetición de GC). La función biológica del ADN-Z es poco
cantidad de purinas es igual a la de pirimidinas. comprendida, pero puede estar relacionada con la regulación
de la expresión génica. Las características detalladas de cada
una de las variantes se describen en el cuadro 3-2.

CAPÍTULO 3 • Ácidos nucleicos 29

Esqueleto de 5´ 3´ Extremo 5´
fosfato- O
T=A O

pentosa O PO O PO

O O

C=G CH2 O C G CH2 O
A=T
G=C 5´ 4´ 1´ 5´ 4´ 1´

HH HH HH HH
3´ 2´ 3´ 2´

Surco OH OH
menor

O PO O PO

T=A O O
C=G
CH2 O A T CH2 O
T=A
C=G 5´ 4´ 1´ 5´ 4´ 1´

Surco A=T HH HH HH HH
mayor 3´ 2´ 3´ 2´

OH OH

O PO O PO

Par de bases O O

CH2 O T A CH2 O

5´ 4´ 1´ 5´ 4´ 1´

HH HH H H HH
3´ 2´ 3´ 2´

G=C OH OH
3´ 5´
O PO O PO
Figura 3-7. Doble hélice del ADN.
O O
CH2 O
G C CH2 O

5´ 4´ 1´

HH HH H H H H
3´ 2´

ADN circular Extremo 3´ OH H OH H Extremo 5´

El ADN mitocondrial y el de células procariotas se encuen- Figura 3-8. Estructura del ADN.
tra en forma de molécula circular, sin extremos, donde no
hay interrupción de los enlaces fosfodiéster. Es posible de las enzimas topoisomerasas, que mediante el corte tran-
encontrar al ADN circular como una estructura relajada sitorio de una o ambas hebras introducen un aumento o
(figura 3-9A) o como una estructura superenrollada y más una disminución (superenrollamiento positivo o negativo,
compacta, donde la hélice del ADN (ya enrollada) gira sobre respectivamente) en el número de vueltas de hélice. El
sí misma (superenrollada) y genera una superhélice (figura ADN circular superenrollado permite la compactación del
3-9B). El superenrollamiento se produce debido a la acción

Cuadro 3-2. Características de los tipos de ADN según su estructura.

Características ADN A (deshidratada) Tipo estructural del ADN ADN Z
(Rich-Dickerson)
Sentido de giro de la hélice Dextrógiro ADN B Levógiro
Diámetro de la hélice 2.55 nm (25.5 A) (Watson-Crick) 1.84 nm (1.84 A)
Distancia entre pares de bases 0.23 nm (2.3 A) Dextrógiro 0.38 nm (3.8 A)
Pares de bases por vuelta 11 2.37 nm (23.7 A) 12
Inclinación del plano de los 0.34 nm (3.4 A)
pares de bases 19° (gran inclinación) 10.4 9° (ligera inclinación)
Surco mayor 1.2° (casi perpendicular al eje
Surco menor Estrecho, profundo de la hélice) Plano, sin profundidad
Amplio, no profundo Ancho, profundidad media Estrecho, profundo
Estrecho, profundidad media

Tipos de estructura secundaria de ADN. La molécula de ADN toma una estructura diferente según el microambiente en el que se encuentre, con ello el número de
bases por giro, la inclinación y el giro de la molécula varía; estas características influyen en su disponibilidad como fuente de información genética

30 PARTE I • Conceptos básicos de biología molecular

A) B) de las histonas puede unirse de manera reversible a grupos
acetilo, metilo o fosfato, lo que se conoce como modifica-
ciones epigenéticas; la adición de estos grupos modifica la
unión de las histonas al ADN y, por tanto, regula la disponi-
bilidad de la información génica.

Figura 3-9. Moléculas de ADN circular. Solenoide

ADN para que ocupe menor espacio en la células; también Los nucleosomas se compactan para formar un polinucleo-
permite que posiciones lejanas en la secuencia se aproxi- soma de seis unidades mediante interacciones entre las H1
men, y además regula la accesibilidad a la información de cada nucleosoma, lo que genera una estructura más
genética y la expresión génica, al mantenerse inaccesible compacta. Esta estructura recibe el nombre de solenoide y
para los factores de transcripción. forma una hebra de 30 nm, conocida como cromatina, en
este nivel el ADN está compactado unas 100 veces. La cro-
Niveles de empaquetamiento del ADN matina puede encontrarse activa de forma transcripcional,
por lo que se descompacta y entonces recibe el nombre de
Debido a la longitud del ADN genómico en las células euca- eucromatina. La cromatina inactiva se encuentra en su for-
riotas (alrededor de 2 metros/célula) es necesaria su compac- ma compacta y se la conoce como heterocromatina.
tación, de manera que permita ocupar menos espacio y
quepa dentro del núcleo de la célula. El ADN se asocia con Asas cromatínicas
nucleoproteínas (histonas y no-histonas) para formar la cro-
matina y dar origen a los cromosomas; por ello, en el empa- La fibra de 30 nm se pliega y condensa aún más, formando
quetamiento del ADN se distinguen diferentes niveles de estructuras de asas amplias superenrolladas, las cuales se
organización, que se describen a continuación. anclan sobre proteínas de andamiaje y dan lugar una hebra
de 300 nm de grosor.
Nucleosoma
Cromosoma condensado
Las histonas son proteínas con carga positiva a pH fisiológi-
co, debido a su alto contenido en aminoácidos básicos, Las asas cromatínicas se compactan y forman un cromoso-
como la lisina y la arginina. Esta propiedad les permite aso- ma condensado de 700 nm de espesor visible durante la
ciarse a la molécula de ADN de carga negativa (conferida interfase.
por los grupos fosfato). Existen cinco tipos de histonas: H1,
H2A, H2B, H3 y H4. Dos moléculas de histona H2A, H2B, Cromosomas mitóticos
H3 y H4 se asocian para formar un octámero de histonas.
Un segmento de ADN de doble cadena de aproximadamen- Las cromátides hermanas visibles en la mitosis representan
te 146 pb se enrolla dando 1.6 vueltas al octámero para for- la última etapa de la organización del ADN y llegan a medir
mar una estructura llamada nucleosoma. Los diferentes 1 400 nm de grosor.
fragmentos de ADN presentes en el núcleo se asocian a
diversos octámeros y forman una cadena de nucleosomas Los niveles de empaquetamiento del ADN se presentan
conocida como “cuentas de rosario” o “cuentas de collar” esquematizados en la figura 3-10B.
por su semejanza con estas estructuras al observarse en el
microscopio electrónico. Entre cada nucleosoma queda un Desnaturalización y renaturalización del ADN
segmento de ADN de aproximadamente 55 pb denominado
ADN enlace o linker (figura 3-10A). La función del nucleo- La desnaturalización es la pérdida de la estructura helicoi-
soma es condensar el ADN en una fibra de 11 nm de ancho dal (estructura secundaria) característica de la molécula de
que se asemeja al mencionado collar de perlas, donde cada ADN. El proceso de desnaturalización ocurre por la rotura
nucleosoma sería una perla y el ADN de enlace, el cordón de los puentes de hidrógeno entre las bases nitrogenadas, lo
con el cual están unidas estas perlas. El ADN linker se aso- que ocasiona la separación de las dos cadenas antiparalelas
cia, entonces, con otra histona denominada H1 y ayuda al sin que se altere la estructura primaria, ya que los enlaces
empaquetamiento del ADN, lo que facilita la formación de fosfodiéster no resultan afectados.
otra estructura, llamada solenoide, que se describirá con
detalle en la siguiente sección. El extremo aminoterminal La desnaturalización puede ocurrir por exposición de
los ácidos nucleicos a agentes químicos o f ísicos, cambios
de pH y enzimas.

Los agentes desnaturalizantes, como la urea, la forma-
mida y el formaldehído, son altamente polares, con grupos
amino y carbonilo que compiten con los grupos amino y
carbonilo de las bases nitrogenadas en la formación de

CAPÍTULO 3 • Ácidos nucleicos 31

Doble hélice de ADN

Hebra de 10 nm

Nucleosoma Histona H1

Solenoide
Fibra de 30 nm

H2B H1

H2A
H3

H4

ADN

ADN enlace

Octámero de Nucleosoma
histonas

Asas cromatínicas Cromosoma
300 nm en metafase

Cromosoma
condensado

(700 nm)

Figura 3-10. Niveles de empaquetamiento del ADN.

puentes de hidrógeno y dan lugar a la separación de las absorbancia a 260 nm, ya que el ADN de cadena sencilla
hebras. También un pH extremadamente alcalino o ácido tiene una absorbancia relativa mayor que el ADN de cadena
puede desnaturalizar el ADN; sin embargo, este tratamien- doble en la misma longitud de onda.
to puede dar lugar a la rotura de enlaces fosfodiéster, y por
lo tanto, a la pérdida de la estructura primaria. La tempera- Las topoisomerasas, las girasas y las helicasas son enzi-
tura es el agente desnaturalizante más representativo: el mas que pueden desenrollar (desnaturalizar) el ADN. Las
calentamiento gradual del ADN hasta llegar a 100°C debili- topoisomerasas cortan una o ambas hebras del ADN, lo que
ta las fuerzas estabilizadoras de la doble hélice, de forma provoca la relajación del superenrollamiento. Las girasas
que las dos hebras se desenrollan hasta su separación total. actúan desenrollando el ADN circular presente en las bac-
La temperatura de fusión (Tm) se define como la tempera- terias, y las helicasas se unen al ADN cerca de la horquilla
tura a la que se ha desnaturalizado el 50% de las moléculas de replicación, rompen los puentes de hidrógeno y catali-
de ADN de la muestra que se está calentando. La Tm repre- zan la separación de las hebras mediante la energía liberada
senta el punto en que la energía aplicada es suficiente para por hidrólisis de ATP.
romper la mitad de los puentes de hidrógeno que mantie-
nen unidas las dos cadenas de la molécula de ADN. Una El ADN desnaturalizado puede renaturalizarse si se
muestra de ADN con alto contenido de G y C tiene una retira gradualmente el agente desnaturalizante. Por ejem-
mayor Tm en comparación con una con alto contenido de A plo, si una solución de ADN desnaturalizada por calenta-
y T. Esto se debe a que G y C están unidas con tres puentes miento se enfría lentamente, las dos cadenas se vuelven a
de hidrógeno, a diferencia de A y T, que lo están por dos asociar por complementariedad de sus bases.
puentes de hidrógeno, por lo que para disociarlas se requie-
re una temperatura mayor. La pérdida de la estructura heli- ARN
coidal del ADN puede vigilarse con la medición de su
Es el ácido nucleico más abundante en la célula eucariota,
donde suele ser 10 veces más abundante que el ADN.

32 PARTE I • Conceptos básicos de biología molecular

Extremo 5´ Estructura secundaria del ARN
A) O
La estructura secundaria está dada por el apareamiento de
O PO secuencias complementarias en la misma cadena de ARN
(asociación intracatenaria parcial) o por asociaciones inter-
O C catenarias, en el caso de los ARN de doble cadena de ciertos
virus. La complementariedad ocasional de bases en el ARN
CH2 O da origen a las estructuras de pasador (hairpin), forma-
5´ ciones típicas, en las cuales parte de la cadena de ARN es
complementaria y origina puentes de hidrógeno entre ésta
4´ 1´ y la parte no complementaria da origen a un loop o asa de
HH HH bases que no se unen como se aprecia en la figura 3-11B.

3´ 2´ Estructura terciaria del ARN

OH A La estructura terciaria del ARN no siempre se forma, sólo
surge cuando las condiciones celulares propician la interac-
O PO ción entre bases nitrogenadas de diferentes regiones de una
misma molécula de ARN. Los ARN de transferencia (ARNt)
O forman una estructura terciaria característica: en disolu-
CH2 O ción están plegados en forma de “L” compacta estabilizada
5´ por apareamientos de bases convencionales y por interac-
ciones entre las bases de más de dos nucleótidos, como los
4´ 1´ tripletes de bases (véase el capítulo 6). Las bases nitrogena-
HH HH das pueden interactuar a través de los átomos de hidrógeno
para unirse al esqueleto fosfodiéster de la cadena de ARN, o
3´ 2´ bien a través del OH del carbono 2’ de la ribosa, que actúa
como un importante dador y aceptor de hidrógenos.
OH
Tipos de ARN
O PO
Aunque químicamente son iguales, los ARN según la fun-
O ción que desempeñen en la célula se agrupan en:

CH2 O U ARN heterogéneo nuclear

5´ 4´ 1´ Es un ARN también conocido como tránscrito primario, de
alto peso molecular. Es el producto inicial de la síntesis de la
HH HH ARN polimerasa en el proceso de transcripción. En el
3´ 2´ núcleo de las células eucariotas actúa como precursor de
los demás tipos de ARN que se encuentran en el citoplas-
OH ma. La fragmentación del ARNhn para formar otros tipos
de ARN supone la maduración o el procesamiento del ARN
O PO (véase el capítulo 5). En las células procariotas, el tránscrito
primario actúa directamente como molde para la síntesis
O de proteínas, sin necesidad de maduración o modificacio-
nes postranscripcionales.
CH2 O G
ARN mensajero (ARNm)
5´ 1´
4´ El ARNm sirve de molde para la síntesis de proteínas en el
proceso de traducción, ya que contiene la información
HH HH génica para la formación de uno o varios polipéptidos (véa-
3´ 2´ se el capítulo 6). El ARNm se localiza en el citoplasma, su
longitud es variable según la proteína para la que codifique
Extremo 3´ OH H y contiene, además, las señales necesarias para el inicio y la
terminación de la traducción. En eucariotes el ARNm pre-
B) senta características especiales: en su extremo 5’ muestra

C C
U
U C U G C C AG A
U

A A G A C G G UG UA
A
A

Figura 3-11. Estructura primaria y secundaria del ARN.

En cuanto a su estructura tres características diferen-
cian al ARN del ADN:

1. El ARN suele ser monocatenario (una sola cadena).
2. Contiene uracilo en lugar de timina.
3. La pentosa que constituye a sus nucleótidos es la ribosa,

en lugar de la 2-desoxirribosa del ADN (la presencia
del grupo hidroxilo en el C2´ de la ribosa provoca que el
ARN sea una molécula químicamente inestable).

Estructura primaria del ARN

Al igual que en el ADN la estructura primaria del ARN está
determinada por secuencia lineal de sus ribonucleótidos,
que se escriben siempre en dirección 5’-3’ (figura 3-11A).

CAPÍTULO 3 • Ácidos nucleicos 33

A) CAP 5 CGACCAUGAACGGAUACUGACAAGUUAUUGAGUGGAGGAUU AAAAAAAAAAAAAA-3´

ARNm Poli A

CH2

NH2 N

6 5 78 7-metilguanosina
N1 9
4N

23

N
5C´H2 O
O 4´ 1´
O PO H H
H 3´ 2´ H B)
O
Secuencia del ARNm del Factor de crecimiento tipo insulina de humano (IGF1)
O PO O OH
O 1 ttttgtagat aaatgtgagg attttctcta aatccctctt ctgtttgcta aatctcactg
61 tcactgctaa attcagagca gatagagcct gcgcaatgga ataaagtcct caaaattgaa
O PO 121 atgtgacatt gctctcaaca tctcccatct ctctggattt ctttttgctt cattattcct
181 gctaaccaat tcattttcag actttgtact tcagaagcaa tgggaaaaat cagcagtctt
O 241 ccaacccaat tatttaagtg ctgcttttgt gatttcttga aggtgaagat gcacaccatg
301 tcctcctcgc atctcttcta cctggcgctg tgcctgctca ccttcaccag ctctgccacg
CH2 O C 361 gctggaccgg agacgctctg cggggctgag ctggtggatg ctcttcagtt cgtgtgtgga
421 gacaggggct tttatttcaa caagcccaca gggtatggct ccagcagtcg gagggcgcct
5´ 481 cagacaggca tcgtggatga gtgctgcttc cggagctgtg atctaaggag gctggagatg
2 4´ 1´ 541 tattgcgcac ccctcaagcc tgccaagtca gctcgctctctg tccgtgccca gcgccacacc
601 gacatgccca agacccagaa gtatcagccc ccatctacca acaagaacac gaagtctcag
H H HH 661agaaggaaag gttggccaaa gacacatcca ggaggggaac agaaggaggg gacagaagca
3´ 2´ 721 agtctgcaga tcagaggaaa gaagaaagag cagaggaggg agattggaag tagaaatgct
781 gaatgcagag gcaaaaaagg aaaatgaagg acaggaggat taaacagaca gaggcaagga
O OH 841 tgatgagaga ggagcagaca gcaagaatga aaagcagaaa atacaataga ggaaatgaag
901 aaaagtaggc ctgctggagc tagatgatga tgtgatggaa atagaagta
O PO

O

CH2 O A

2 4´ 1´
HH
H H 2´


O OH

Figura 3-12. Secuencia de un ARN mensajero.

una capucha (cap) y en su extremo 3’, una cadena de polia- un aminoácido que liberarán en el ribosoma durante el pro-
deninas (cola poliA) de longitud variable (figura 3-12). Estas ceso de traducción. Suelen presentar bases nitrogenadas
modificaciones tienen por objeto aumentar la vida media inusuales, como la inosina, la dihidrouridina, etc., e incluso
de esta molécula en el citoplasma y permitir su disponibili- la timina. Su estructura secundaria presenta un plegamien-
dad en el proceso de traducción proteica. La presencia de la to complejo donde se encuentran zonas con apareamiento
cola de poliA en el extremo 3´ facilita su purificación cuan- de secuencias complementarias y otras sin apareamiento de
do se emplea cromatograf ía en columna de afinidad, ya que secuencias complementarias, y en donde se pueden distin-
forma híbridos con residuos de poliuridinas (poli U) unidos guir regiones críticas, como la de unión al aminoácido y el
a una resina empaquetada en el interior de la columna.

ARN ribosomal (ARNr) ARNr
28s
El ARNr forma parte de los ribosomas, estructuras intrace-
lulares en que se realiza la síntesis de proteínas (figura 3-13). 5.8 S
Sus estructuras secundaria y terciaria presentan un plega-
miento complejo que le permite asociarse tanto a las proteí- 5S
nas de los ribosomas como a otros ARNr y participar en el
proceso de síntesis proteica. 18 S

ARN de transferencia (ARNt) Ribosoma
Figura 3-13. Esquema de un ribosoma donde se observa el ARN
Las moléculas de ARNt tienen entre 75 y 90 nucleótidos, y ribosomal.
su peso molecular es de unos 2.5 kDa. Se conocen unos 32
ARNt distintos y se encuentran en todas las células. Éstos
intervienen en la síntesis de proteínas, ya que van unidos a

34 PARTE I • Conceptos básicos de biología molecular

3´ Brazo aceptor unen al precursor del ARNm para eliminar los intrones se
A forma un complejo ARN-proteína de gran tamaño, visible
en el microscopio electrónico, y que recibe el nombre de
C espliciosoma (spliceosome).

5´ C Enzimas de ARN (ribozimas)

UA Estos ácidos ribonucleicos funcionan como catalizadores
biológicos. Poseen, al igual que las enzimas, un sitio activo,
GC uno de unión para el sustrato y uno de unión para un cofactor
que puede ser un ion metálico. Los ARNsn involucrados en
Brazo D G C Brazo T C maduración del ARNhn son un ejemplo clásico de ribozimas.

G U G C U siARN
D C G
G G G C A G G A A Moléculas de ARN de doble cadena de 20 a 25 nucleótidos
que a través de la vía de interferencia de ARN de células
U U suprimen la expresión de un gen específico. El siARN se une
a una secuencia complementaria del ARNm, la unión del
A G siARN con el ARNm produce la degradación enzimática
A del ARNm en células eucariotas de mamíferos y plantas. Las
C C C G U AC C C descubrió el grupo de David Baulcombe en Inglaterra, en
1999, y originalmente los describieron como parte del meca-
D A U nismo de regulación génica postranscripcional en plantas.

G G A C D miARN
C G
Se trata de moléculas de ARN de cadena sencilla de 21-23
U AG nucleótidos en longitud encargadas de regular la expresión
A génica. Los miARN se unen a una secuencia complementa-
ria del ARNm y bloquean la traducción. El miARN no es
UI totalmente complementario a la secuencia del ARNm; en
este caso, el ARNm no se degrada pero tampoco puede uti-
AAC lizarse para la síntesis de proteínas. Originalmente los des-
cribió el grupo de Victor Ambros en 1993 como small
Brazo ARNs. El término micro-ARN fue introducido en 2001 por
anticodón Ruvkun por la capacidad de los siARNs y miARNs para
silenciar genes.
ARNt
Figura 3-14. Estructura secundaria del ARN de transferencia.

brazo donde se ubica la secuencia del anticodón que reco-
noce los codones del ARNm (figura 3-14).

ARN pequeño nuclear (ARNsn)

Es el ARN presente en el núcleo eucariote y está implicado
en los procesos de maduración del ARNhn. En este proce-
so, el ARNsn se asocia a proteínas, formando las ribonu-
cleoproteínas pequeñas nucleares (RNPsn) que se encargan
de eliminar intrones (fragmentos de ARNhn que no apare-
cen en el ARNm) (véase el capítulo 5). Cuando las RNPsn se

Ejercicios de integración 5´ 3´
T=A
1. Escriba las características principales de la doble hélice
de ADN.

C=G
A=T
G=C

T=A
C=G

T=A
C=G

A=T

G=C
3´ 5´

CAPÍTULO 3 • Ácidos nucleicos 35

2. Mencione el tipo de enlace que une la pentosa con el 4. Dibuje la hebra complementaria de ADN con los puentes
grupo fosfato y el tipo de enlace que une la pentosa con de hidrógeno correspondientes para cada base.
la base nitrogenada.

Extremo 5´
O

NH2 O PO
4
5 O
3N
6 2 CH2 O C
5 1
O 1 O
N 4

CH2 HH HH
5 3 2

41

HH HH OH
3 2
O PO

OH O

OP O CH2 O A
5 1

4

O HH HH
3 2

OH

3. De acuerdo con la estructura, identifique las variantes de O PO
la doble molécula de ADN: A, B y Z.

O

CH2 O T
5 1

4

HH HH
3 2

OH

O PO

O

CH2 O G
5 1

4

HH HH
3 2

Extremo 3´ OH H

Bibliografía

Alberts B., Bray D., Hopkin K., Johnson A., Lewis J., Raff M., et Kutter C., Svoboda P. miRNA, SiRNA, piRNA. RNA Biology,
2008;5:181-188.
al. DNA y cromosomas. En: Alberts B., editor. Introducción a la
Biología Celular, 3ª ed. Madrid: Editorial Médica Panamericana, Lodish H., Berk A., Matsudaira P., Kaiser C., Krieger M., Scott M.,
2010:171-193. et al. Mecanismos genéticos moleculares básicos. En: Lodish H
Chandar N., Viselli S. Organización del genoma eucariótico y expre- (ed). Biología celular y molecular, 5ª ed. Buenos Aires: Editorial
sión génica. En: Harvey R., editor. Biología molecular y celular, 1ª Médica Panamericana, 2006:101-123.
ed. Barcelona: Lippincott Williams and Wilkins, 2011:58-126.
Harvey R., Ferrier D. Almacenamiento y expresión de la informa- Luque J., Herráez A. Texto ilustrado de Biología Molecular e Ingenie-
ción genética. En: Harvey R., (ed). Bioquímica, 5ª ed. Barcelona: ría Genética: conceptos, técnicas y aplicaciones en ciencias de la
Lippincott Williams and Wilkins, 2011:395-465. salud, 1ª ed. Madrid: Harcout, 2001:10-88.
Karp G. Biología celular y molecular: conceptos y experimentos, 6ª ed.
México: McGraw-Hill, 2011:379-497.

Capítulo 4

Replicación

Jorge Fernando Floresvillar Mosqueda / José Guadalupe Macías Barragán

Introducción Semiconservadora

Una de las características más notables del ADN es su capa- Se refiere a que en cada replicación una molécula de ADN
cidad de replicarse; dicho de otra manera, tiene la capaci- recién sintetizada conserva una de las cadenas originales y
dad de formar copias de sí mismo. La replicación se lleva a la otra es sintetizada de novo.
cabo en la fase de síntesis (S) del ciclo celular. Esta etapa es
un paso obligado para realizar la división celular. Por ello, Anteriormente existían tres teorías que trataban de
se determina que la información genética se transfiere de explicar el proceso de la replicación; se decía que podía
una célula a otra mediante el proceso de replicación del ser: semiconservadora, conservadora y dispersora o dis-
ADN. persante.
• Semiconservadora (modelo correcto). En cada una de
El objetivo de la replicación es el de conservar la infor-
mación genética. La representación estructural del ADN en las moléculas hijas se conserva una de las cadenas origi-
doble hélice permite comprender cómo dicha molécula nales.
puede dar lugar a otras idénticas, sin perder su confor- • Conservadora. Se sintetiza una molécula totalmente
mación. En principio, las dos hebras deberán separarse nueva, copia de la original, por lo que tras la duplicación
y, después, mediante la acción de una enzima, añadir des- quedan, por un lado, las dos hebras antiguas juntas y,
oxirribonucleótidos y, según la complementariedad de por otro, las dos hebras nuevas.
bases, construir ADN a partir de las dos hebras molde ini- • Dispersora o dispersante. Las cadenas hijas constan
ciales. de fragmentos de la cadena antigua y fragmentos de la
nueva.
Características generales
El experimento definitivo para dilucidar cuál de estas
La síntesis de las cadenas de ADN durante la replicación se tres hipótesis era la correcta lo realizaron Meselson y Stahl
lleva a cabo en dirección 5’ → 3’ tanto en eucariotes como en 1957, y confirmó la hipótesis semiconservadora. Este
en procariotes. Solamente el carbono de la posición 3’ de la experimento se basaba en dos premisas fundamentales: por
pentosa posee un radical hidroxilo (OH) libre, con el que una parte, el nitrógeno es uno de los principales elementos
puede formar un nuevo enlace fosfodiéster con otro des- del ADN, ya que forma parte de las bases nitrogenadas, y
oxirribonucleótido y formar así la hebra creciente de ADN; por la otra, existen dos isótopos de este átomo, 14N y 15N,
por esta razón, la cadena de ADN sólo puede crecer en que pueden distinguirse mediante técnicas de laboratorio.
dirección 3’. A este proceso se le llama polimerización, que Aunque el 14N es el isótopo más abundante en la naturaleza,
consiste en la unión de un dNTP (desoxirribonucleótido) el 15N también es viable y es más pesado, característica que
complementario a la hebra molde según la Ley de Char- permite diferenciarlos. Este experimento se realizó utili-
gaff (véase el capítulo 1). La replicación del ADN cuenta zando bacterias cuyo medio de cultivo contenía 15N, por lo
con tres características que la definen y permiten entender que todo su ADN también lo contenía. Después se les cam-
el proceso: semiconservadora, bidireccional y antipa- bió el medio de cultivo por uno que contenía 14N. Se permi-
ralela. tió que las bacterias se replicaran sólo una vez y se extrajo el
ADN que se analizó por centrifugación en gradiente de clo-
ruro de cesio, que permite separar las moléculas por tama-

36


Click to View FlipBook Version
Previous Book
BTCSCalendarOnline
Next Book
Biologia Ciencia y Naturaleza Audesirk_booksmedicos.org