Prosiding II International Symposium “Innovations in Life Sciences” (ILS 2020)

Biochemical composition of black currant berries (Ribes Nigrum L.) for development of new cultivars in Bashkortostan Radmil Nigmatzyanov1* , Vladimir Sorokopudov2 , and Nadezhda Nazaryuk3 1Kushnarenkovsky breeding center of fruit and berry crops and grape of the Bashkir Research Institute of Agriculture, UFIC RAS, Republic of Bashkortostan, Ufa, Russia 2Russian State Agrarian University - K.A. Timiryazev MAA, Moscow, Russia 3FSBSI FANTSA Department "Scientific Research Institute of Horticulture of Siberia named after M.A. Lisavenko», Barnaul, Russia Abstract. The paper presents the results of researches of the biochemical composition of black currant berries (Ribes nigrum L.), cultivated in the Republic of Bashkortostan. The objects of the research were cultivars breeding of the Bashkir Research Institute of Agriculture: Valovaya (control), Karaidel, Chishma, Kushnarenkovskaya, Belskaya and Estafeta. Observations have been carried out for 12 years (2006-2017). Differences in the accumulation of components of the biochemical composition are shown in dependence of the varietal peculiarities of the crop. Cultivars that can be used in breeding as sources of individual economically valuable sources are selected. 1 Introduction Blackcurrant (Ribes nigrum L.) is the leading berry crop in the Republic of Bashkortostan [1]. This is due to the high yield, therapeutic and dietary properties of berries and their suitability for all types of technical processing [1,2]. Cultivars of black currant (R. nigrum L.) from the Bashkir RIA – Valovaya, Chishma, Karaidel and Kushnarenkovskaya - are complex three-genome hybrids, originating from European and Siberian subspecies, as well as from the species Dikusha. Having a high adaptive potential, these cultivars were selected as promising donors for breeding of black currant. One of the priority tasks of modern breeding is the cultivation of highly productive cultivars [3,4]. The identification of nutrients valuable in terms of the content of nutrients in berries of cultivated varieties is a necessary study for breeding of black currant. Researches of the biochemical composition of black currant berries (R. nigrum L.) in various cultivars were carried out in many regions of Russia and abroad [5-11]. It was noted that the level of nutrients in the berries of black currant (R. nigrum L.) is a key feature in the breeding of this crop. 2 Experimental The researches were carried out at the Kushnarenkovsky breeding center for fruit and berry crops and grape in 2006-2017, in accordance with the program and method of the variety study of fruit, berry and walnut crops [5]. Biochemical analysis of black currant berries was carried * Corresponding author: [email protected] out in the analytical laboratory of the Bashkir Research Institute of Agriculture, according to the methods [2]. The objects of the research were black currant cultivars from the Bashkir RIA: Valovaya, Chishma, Karaidel, Kushnarenkovskaya, Belskaya, Estafeta [1,2]. The control was a cultivar of early ripening – Valovaya. 3 Results and discussion The biochemical composition of the berries determines the taste and dietary properties of black currant. The results of long-term studies of the biochemical composition of black currant berries (R. nigrum L.) in the Republic of Bashkortostan are presented in Table 1. The biochemical composition of the berries of black currant (R. nigrum L.) is an important indicator, defining the value of the cultivar [12-14]. Among the traditional berry crops, black currant occupies the leading place in the accumulation of soluble dry substances [15-16]. In the berries of black currant of Bashkir breeding, the content of soluble solids (SDS) was 18.7 ± 0.6%. The SDS content in berries varied from 17.3 ± 0.4% (Belskaya) to 19.8 ± 0.7% (Chishma). The cultivars Karaidel – 19.3 ± 1.4% and Chishma – 19.8 ± 0.7% had the higher SDS content, compared with the control cultivar Valovaya – 18.9 ± 1.0%. The maximum accumulation of SDS was observed in cultivars: Kushnarenkovskaya – 19.5%, Belskaya – 21.6%, Estafeta – 21.7%, Chishma – 22.2%, Valovaya – 23.6%, Karaidel – 31.9%. The minimum SDS accumulation was observed in the cultivars: Valovaya – 13.4%, Kushnarenkovskaya – © The Authors, published by EDP Sciences. This is an open access article distributed under the terms of the Creative Commons Attribution License 4.0 (http://creativecommons.org/licenses/by/4.0/). BIO Web of Conferences 30, 04004 (2021) https://doi.org/10.1051/bioconf/20213004004 ILS 2020

14.0%, Karaidel – 14.1-14.4%, Chishma – 14.9%, Estafeta – 15.9%, Belskaya – 16, 4%. According to the results of biochemical analysis of black currant berries, the stability of SDS accumulation of black currant berries was noted. The coefficient of variation averaged 4.3%. The variability range is from 2.4% (Belskaya) to 7.3% (Karaidel). In the berries of black currant sugars are represented by glucose, fructose and sucrose. The total sugar content in the berries of black currant, in different years of researches, was at the level of 8.9 ± 0.4%. This index ranged from 8.3 ± 0.3% (Kushnarenkovskaya) to 9.6 ± 0.6% (Estafeta). The cultivars Chishma – 9.2 ± 0.4%, Karaidel – 9.2 ± 0.8% and Estafeta– 9.6 ± 0.6% had the higher total sugar content, compared with the control cultivar Valovaya – 8.9 ± 0.8%. In the cultivars of black currant, we studied, the maximum and minimum indices of sugar content in berries were noted: -maximum indices: Kushnarenkovskaya – 9.8%, Chishma – 11.4%, Belskaya 11.9%, Valovaya – 12.9%, Karaidel – 13.1%, Estafeta – 13.3%; -minimum indices: Valovaya – 3.9%, Karaidel – 5.9%, Kushnarenkovskaya – 6.5%, Estafeta – 6.7%, Chishma – 7.3, Belskaya – 7.9%. By the level of accumulation of sugars, cultivars of Bashkir breeding were distinguished by high homeostaticity. The average values [11] of the coefficient of variation, for all cultivars, amounted to 6.0% with a range of variability from 3.8% (Kushnarenkovskaya) to 8.7% (Valovaya). Sugars, in combination with organic acids, form the taste of berries. Black currant berries are highly acidic compared with other species of currants [6]. Black currant berries contain: citric, tartaric, succinic, salicylic, malic, phosphoric acids. The berries of Bashkir black currant breeding are characterized by a moderate content of titrated acid. The total titrated acid content in berries varied from 1.9 ± 0.3% (Valovaya) to 2.3 ± 0.3% (Belskaya). The average content of titrated acid in berries was at the level of 2.1 ± 0.2%. In the cultivars studied by us, in different years of observation, the minimum and maximum content of titrated acid in berries was noted: Karaidel 0.7-3.6%, Chishma 0.7-3.9%, Valovaya 0.8-3.9%, Belskaya 0.8- 4.1%, Kushnarenkovskaya 0.9-3.4%, Estafeta 0.9-3.7%. The coefficient of variation was, on average, 12.9%, which indicates the average stability of the character. For black currant cultivars, the coefficient of variation was: Kushnarenkovskaya – 9.3%, Chishma – 11.7%, Belskaya – 12.5%, Karaidel – 13.5%. Estafeta – 14.1%. Significant variability of the character was observed in the control cultivar Valovaya – 16.2%. One of the main indices that determine the value of cultivars in horticulture is the content of ascorbic acid (AA) in fruits and berries [10]. The AA content in the berries of black currant varies widely and is determined mainly by the genetic characteristics of the cultivar, the level of applied agricultural technology and environmental conditions [4]. According to long-term researches, it was found that the content of ascorbic acid (AA) in berries of black currant cultivars of Bashkir breeding, is 162.1 ± 6.5 mg / 100 g. The AA content in berries ranged from 138.0 ± 5.0 mg / 100g (Kushnarenkovskaya) to 191.7 ± 15.5 mg / 100g (Chishma). Cultivars Estafeta – 161.7 ± 7.0 mg / 100g, Karaidel – 161.7 ± 8.5 mg / 100g, Belskaya – 162.7 ± 6.5 mg / 100g and Chishma – 191.7 ± 15.5 mg / 100g were characterized by an increased AA content, compared with the control cultivar Valovaya – 157.0 ± 7.7 mg / 100g. In cultivars of Bashkir black currant breeding, in different years of observation, the minimum and maximum AA content in berries was noted: Belskaya - 98.2 - 190.1 mg / 100g, Chishma - 98.9 - 236.0 mg / 100g, Estafeta - 100 , 0 - 197.9 mg mg / 100 g, Valovaya- 107.1 - 197.0 mg / 100 g, Kushnarenkovskaya - 107.3 mg - 163.5 / 100 g, Karaidel - 119.0 - 193.3 mg / 100 g. The coefficient of variation of AA, in different years, was insignificant and averaged 4.0% with a variability range from 3.6% (Kushnarenkovskaya) to 8.1% (Chishma). Table 1. The biochemical composition of black currant berries on average for the period 2006-2017. Cultivar name Soluble dry substance, (SDS), % x±m min - max Total sugar x±m min - max Titrated acid, % x±m min - max Ascorbic acid mg/100gг x±m min - max Valovaya 18,9±1,0 13,4-23,6 8,9±0,8 3,9-12,9 1,9±0,3 0,8-3,9 157,0±7,7 107,1-197,0 Karaidel 19,3±1,4 14,1-31,9 9,2±0,8 5,9-13,1 2,1±0,3 0,7-3,6 161,7±8,5 119,0-193,3 Kushnarenkovskaya 18,3±0,6 14,0-19,5 8,3±0,3 6,5-9,8 2,0±0,2 0,9-3,4 138,0±5,0 107,3-163,5 Chishma 19,8±0,7 14,9-22,2 9,2±0,4 7,3-11,4 2,0±0,2 0,7-3,9 191,7±15,5 98,7-236,0 Belskaya 17,3±0,4 16,4-21,6 8,7±0,4 7,9-11,9 2,3±0,3 0,8-4,1 162,7±6,5 98,2-190,1 Estafeta 18,3±0,7 15,9-21,7 9,6±0,6 6,7-13,3 2,1±0,3 0,9-3,7 161,7±7,0 100,0-197,9 X ср. 18,7±0,6 8,9±0,4 2,1±0,2 162,1±6,5 Min-max 14,8-23,4 6,4-12,1 0,8-3,9 105,1-196,3 V,% 4,3 6,0 12,9 4,0 2 BIO Web of Conferences 30, 04004 (2021) https://doi.org/10.1051/bioconf/20213004004 ILS 2020

4 Conclusion As a result of long-term researches of black currant berries, differences in the accumulation of the main components of the biochemical composition were revealed. Cultivars of black currant (Ribes nigrum L.) of Bashkir breeding cultivated in the Republic of Bashkortostan contain on average: 18.7 ± 0.6% soluble solids, 8.9 ± 0.4% sugars, 2.1 ± 0, 2% titrated acids and 162.1 ±6.5 mg/100g ascorbic acid. The following cultivars, which can be used in breeding as a source of separate economically-valuable characters are selected: - high solids content: Valovaya – 18.9 ± 1.0%, Karaidel – 19.3 ± 1.4% and Chishma – 19.8 ± 0.7%; - high accumulation of sugars: Karaidel – 9.2 ± 0.8% and Estafeta - 9.6 ± 0.6%. - low content of titrated acid: Valovaya – 1.9 ± 0.3%, Kushnarenkovskaya – 2.0 ± 0.2%, Chishma – 2.0 ± 0.2%; - high content of ascorbic acid: Belskaya – 162.7 ± 6.5 mg / 100g and Chishma – 191.7 ± 15.5 mg/100g; - stability of the accumulation of components of the biochemical composition – Kushnarenkovskaya and Belskaya. The cultivars of Bashkir black currant breeding Valovaya, Chishma, Karaidel, Kushnarenkovskaya, Belskaya, Estafeta meet modern market requirements for the quality of berries, their nutritional value and medicinal properties. References 1. R.A. Nigmatzyanov, L.A. Golovina, Collection of scientific articles. - prakt. conferences. 77 (2019) 2. M.G. Abdeeva, R.A. Nigmatzyanov, Sat. articles scientific. conferences. 59 (2014) 3. S.D. Knyazev, A.N. Zarubin, A.U. Andrianov, Gardening and viticulture. 4, 26 (2012) 4. T.V. Zhidekhina, O.S. Rodyukova, S.A. Magomedova, Gardening and viticulture. 5, 15 (2007) 5. A.V. Zaritsky, Far Eastern agrarian Bulletin. 1, 25 (2018) 6. E.N. Dzhigadlo, E.A. Dolmatov, V.V. Zhdanov, S.D. Knyazev, N.G. Krasova, T.P.Ogoltsova, E.N. Sedov, G.A. Sedysheva, Program and method of variety study of fruit, berry and nut crops (1999) 7. R.R. Kildiyarova, E.A. Ivanova, F.K. Juraeva, Collection of scientific papers for the 75th anniversary of the Institute. 102 (2011) 8. T.G. Prichko, V.V. Yakovenko, M.G. Germanova, Fruit growing and viticulture in the South of Russia, 45, 105 (2017) 9. F.F. Sazonov, Collection of articles international. nauch-prakt. Conferences, 271 (2017) 10. V.S. Salykova, L.S. Sankin, Modern gardening. 1, 13 (2010) 11. O.A. Tikhonova, T.V. Shelenga, S.A. Streltsina, Selection and variety distribution of garden crops: Collection of articles of the international journal. nauch-prakt. conferences. 203 (2015) 12. S.M. Paunović, M.R. Nikolić, “XXI savetovanje o biotehnologiji” Zbornik radova. 21, 233 (2016) 13. M. Vagiri, Balsgård Swedish University of Agricultural Sciences. 2 (2012) 14. T.L.Woznicki, O.M. Heide, A.Sønsteby, A.B. Wold, S.F. Remberg, Acta Agriculturae Scandinavica, Section B - Soil & Plant Science. 65, 702 (2015) 15. D. Bonarska-Kujawa, S. Cyboran, R. Gybka, J. OszmiaNski, H. Kleszczynska, Hindawi Publishing Corporation BioMed Research International (2014) 16. A. Kikas, K. Kahu., L. Arus, H. Kaldmäe, R. Rätsep, A.V. Libek, Proceedings of the Latvian academy of sciences, Section B. 71, 190 (2017) 3 BIO Web of Conferences 30, 04004 (2021) https://doi.org/10.1051/bioconf/20213004004 ILS 2020

Comparative analysis of habitus and behavioral responses in birds in desynchronosis conditions Tatyana Pogrebnyak1* , Elena Khorolskaya1 , Oksana Vorobyova1 , and Irina Sagalaeva2 1Department of Biology, Belgorod State National Research University, Belgorod, Russia 2Department of Foreign Languages and Professional Communication, Belgorod State National Research University, Belgorod, Russia Abstract. The dynamics of behavioral reactions is studied. Habit, live weight of roosters in artificially created models of desynchronosis: acute, due to three-day inversion of the light regime, and chronic, due to crowding - increased placing density. An assessment of the behavior, habitus, feed intake, feather cover and molting conditions in combination with the glycemia level, which together provide an objective assessment of the effect of desynchronosis on the functional state of birds and their adaptation to acute and chronic stress. 1 Introduction The animal’s body always responds to the action of any stressor with stereotypical behavior It is a chain of successive reactions that are genetically determined, they are quickly activated by a complex of neuro-endocrine mechanisms [1, 2, 3]. Functionally, these reactions include a complexly organized hypothalamic-pituitaryadrenal and sympatho-adrenal systems [4, 5] Together they act as a system of protection and adaptation on the principle of feedback [6]. A rapid increase in the blood the level of glucocorticoids triggers protective reactions to the stress factor [3, 7]. For example, in the blood of birds, the level of adrenaline, glucogon, corticosteroids, and adrenocorticotropic hormone increases sharply. All these physiological active compounds together cause tachycardia, hypertension in the body, and increase the level of glucose and free fatty acids in the blood [7, 8]. In this state, birds eat less feed, their sexual activity decreases, but against the background of a high level of glycemia, they demonstrate all types of protective behavior [2, 9]. In total these reactions with short-term exposure of the stress factor allow birds to get out of stress quickly. Longterm exposure of strong stress factors causes negative processes in birds: hypertrophy of the adrenal and pituitary glands, involution of the lymphoid system with atrophy of the thymus, spleen, and fabricium bag; the production of antibodies decreases, the chemical and cellular composition of blood changes, anabolic reactions slow down, and overall resistance of the body decreases [2, 10]. In this state, the body of birds cannot exist for a long time. Physiologically, the ability of birds to function at the limit of their physiological capabilities allows them to activate functional and plastic reserves, direct them to * Corresponding author: [email protected] strengthen the processes of protein synthesis, stabilize the blood system, and increase the overall non-specific stability of the body. Birds quickly get out of stress along the way of forming an adaptive effect. But only if the stressor was short-lived. Overtension of body functions determines the development of dystrophic and pathological changes in birds with a decrease in productivity and causes the death of birds [2, 11]. Stress symptoms in birds do not always appear simultaneously and are often not clearly expressed [9, 10]. In addition, birds are less sensitive to changes in natural conditions and circumstances of life. However, unnatural conditions always cause stress [2]. The body of birds is able to gradually adapt to long-term environmental stressors [6]. The resistance of the birds' body decreases sharply when a number of components of stereotypical adaptive behavior fall out during the day in conditions of cellular isolation and restriction of living space [10, 11]. Stress behavior of birds is genetically determined and includes stereotypical movements. Pronounced vocal agitation, alertness with an elongated neck and raised body, sharp and rapid head movements, panic and fear with vocal responses, threats and erratic movements, depression and lack of movement or, conversely, flight correspond to stress situations and a high level of tension in birds [9, 12]. In the course of evolution, the morphofunctional organization of the birds ' body and their adaptive abilities have reached a very high specialization. Despite the research of various aspects of stress in birds, the process of forming adaptive responses involving various brain structures in the implementation of central and peripheral mechanisms of adaptation and disadaptation in stress situations still requires its solution. © The Authors, published by EDP Sciences. This is an open access article distributed under the terms of the Creative Commons Attribution License 4.0 (http://creativecommons.org/licenses/by/4.0/). BIO Web of Conferences 30, 04005 (2021) https://doi.org/10.1051/bioconf/20213004005 ILS 2020

The purpose of the work is to study the features of habitus, daily food and stereotypical behavior in roosters of the white Russian breed in the conditions of experimentally created desynchronosis-acute (photodesynchronosis) and chronic (crowding). 2 Experimental The habit and behavior of 30 mature white Russian roosters aged 1-1. 5 years old were studied in two experimental models of stress when birds were placed in conditions of 30-days desynchronosis. Taking into account that light has a key influence on the rhythm of birds ' life processes, acute stress was simulated by a three-day 12-hour photo-inversion. The shift in the daily photo mode is the strongest non-specific stress factor for birds [10, 13]. It violates the evolutionary stereotype of endogenous rhythms of body functions due to changes in the natural system of reinforcement of conditioned reflex activity formed during evolution [8, 14]. Light rays are transmitted through the retinodiencephalic connections of the brain to the Hpta nuclei, through the ependyma of the third ventricle of the brainstem to the subcomissural organ and epiphysis, which in birds is the central performer of rhythmic processes during the day. The high sensitivity of chickens to shifts in the photo mode is due to the fact that the centers of the autonomous nervous system, regulation of endocrine glands, and RF tone of the brain stem are localized in the hypothalamus [15, 16]. The functional activity of these centers is directly controlled by cortical structures, which trigger a stress-tension reaction in birds by autonomous and humoral mechanisms [8]. Daily mode of illumination is the most powerful regulator of their motor activity, eating behavior and feed consumption for birds [1, 12]. When preparing animals for the experiment, much attention was paid to handling and pre-training them to the experimental environment and the experimenter. At all stages of the work, the experiments were conducted at the same time of day: the roosters were weighed before feeding and taking blood for analysis from 8.00 to 9.00 o'clock. Blood was obtained by drip from the comb. The level of peripheral blood glycemia was determined by a color reaction with an orthotoluidine reagent [7, 13]. The roosters were kept in compliance with the basic zoohygienic norms: in a room with ventilation, in single single-tier wire cages with a mesh floor area of 1350 cm2, one at a time. The birds had free access to food and water, and received a balanced diet. At the end of each day, the amount of food consumed by the animals was evaluated. The chronobiological methodological approach was used to form realistic models of neurogenic stress due to a directed change in the daily endogenous and acquired rhythms of behavioral and physiological processes of the body [13, 16]. The model of chronic stress was created due to the increased density of placing five roosters in a cage for single keeping of a bird (270 cm2 / head) [13]. The severity of the relationship between birds has a linear relationship: the greater is the number of individuals, the higher is the number of antagonistic encounters. In conditions of limited living space, aggressive behavior in birds increases sharply, most often it is accompanied by a beak blow to the side of the trunk of another bird [11]. The habitus of each bird was assessed by the density of the feather cover, the state of the first-order flight feathers on the wings, the degree of expression of stereotypical and emotional-vocal behavior in roosters, as objective indicators of the severity of the stress state [6, 11, 13]. In parallel, the live weight of the bird and the amount of food consumed were evaluated. The level of glycemia was determined as an objective correlate of stress [5, 7]. All these indicators were evaluated before the inversion of the photo mode, after switching the birds to the natural photo mode and crowding on the 1st, 3rd, 7th, 15th, 23rd and 30th day [13]. The data obtained in this work were processed using a package of computer programs "Statistica-6". Research results. During the artificial inversion of the daily photo mode, the daily rhythm of behavior in roosters changed dramatically. Negative emotions and voice responses increased, while at the same time erratic motor activity, anxiety and tension, expressed search and protective-defensive reflexes, especially during the artificial night increased. The subsequent transfer of birds to the natural light mode – from the 1st to the 15th day of the experiment, significantly caused a reduction in the duration of the manifestation of stereotypical behavior associated with feeding and motor activity (head turning, biting, walking, etc.), increased vocal activity, which was accompanied by high aggression and anxiety, fearfulness and fear, the search for threats. On the 15th-30th days of the experiment, the nature and duration of the stereotypical daily behavior of experienced animals was gradually stabilized. However, the pronounced tremor of the extremities observed from day 3 to day 23, as well as the sudden manifestation of increased alertness, "fading", fast approximate search and aggressive vocal responses indicated high nervous tension, which is usually associated with negative emotions [1]. During the inversion period and the first three days of the experiment, the feed consumption in the experimental group of roosters decreased (p>0.1) (Fig. 1). In the subsequent period – from the 7th day and by the end of the experiment, feed consumption was gradually stabilized to the initial level. From the 1st to the 30th day of adaptive period, the live weight of experimental roosters decreased and at the 30th day it was 6.3% (p>0,1) below the baseline (Fig. 2). Its individual fluctuations have been mixed: by the end of the experiment it matches the initial level in three birds, and was below average for 120-350 g in seven birds. Starting from the second and especially in the third week of the experiment, all birds had increased loss and breaking of coverts, flight and tail feathers. By the end of the experiment, all experimental roosters were in a state of rapid molting – their wings were missing from two to five or more flight feathers. Rapid molting indicated the manifestation of a pronounced stress syndrome in birds, which is usually associated with a high level of catabolic hormones in the 2 BIO Web of Conferences 30, 04005 (2021) https://doi.org/10.1051/bioconf/20213004005 ILS 2020

blood, in particular thyroxine, which determines the intensity of metabolic processes [1]. Fig. 1. Dynamics of feed consumption by intact (I) and experimental (II) birds under acute stress. Fig. 2. Dynamics of live weight in intact (I) and experimental (II) birds under acute stress. A decrease in live weight, a sharp deterioration in feather cover, and a shift in the duration and severity of the daily components of the stereotypical behavior of stressed birds indicated the realism of the created model of acute neurogenic stress, which determined their state of photodesynchronosis. The nature of stereotypical behavior, the state of feather cover, and changes in live weight in intact birds (control), which were constantly in natural light mode, did not go beyond the background. In intact roosters during 30 days of observation, the level of glycemia was observed within the physiological norm and ranged from 8.66 to 8.80 mmol / l. From the beginning of the chronophysiological load after 24 hours, the stressed birds were found to have hyperglycemia, which was 10.750.30 mmol/l. The initial level was exceeded by 26.0% (p<0.01), after the transfer of stressed birds to the natural photo mode, the level of glycemia decreased sharply and was lower than the background level by 20.5% for 3 days (p<0.01). On the 15th day, there was a second increase in the level of glycemia, which on the 23d day exceeded the background by 30.8% (p<0.01), amounting to 11.160.22 mmol / l. A week later, on the 30th day of the experiment, the level of glycemia in experimental birds was shown to be within the initial level. The detected shifts in the level of glycemia in roosters in a state of photodesynchronosis correspond to changes in energy homeostasis in birds under acute neurogenic stress. The mode of crowding. The increased density of landing experimental birds caused them high nervous and emotional tension from the first minutes which was indicated by aggressive defensive and tentative search reactions, which were accompanied by pecking in the crest and side, threatening vocal responses. The birds stretching their necks often paused, and then performed rapid head movements. During the 1st day of stress, the birds ' daily behavior changed dramatically with a violation of the duration and nature of their stereotypical behavior related to eating and feather cover care. This pattern of behavior in experimental birds was shown during the first week of crowding, especially during the first three days when hierarchical relationships were established in each cage. On the 1st day of crowding the most pronounced manifestation of negative emotions was recorded in experimental birds. A sharp restriction of motor activity did not allow them to avoid the negative impact of the created conflict stress situation and to implement the dynamic stereotype, that is, the rhythmicity of the previously formed sequence of daily life processes. In each cage, the more aggressive roosters became dominant, standing most of the time and often displaying threatening vocal responses with a sharp movement of the beak towards other birds. The roosters with low social status were mostly in the sitting position, not being able to change the position of the body actively. These birds were the most restless and timid, with a constant display of limb tremors and a decrease in body weight in the first half of the crowding period. Since the 15th day the stressed birds gradually began to reduce the tense and aggressive nature of behavioral reactions, while increasing the severity of the daily motor mode, the duration of approximate search behavior and stereotypical reactions associated with eating and cleaning feathers. Since the third week of crowding, the feather cover of experimental roosters has significantly deteriorated, as they began the processes of intensive loss and breaking of coverts and flight feathers. Intensive molting was observed in all birds and on the 30th day. Its manifestation as a correlate of a pronounced stress state [2] directly indicated a more pronounced stress in all experimental birds. In the first week of crowding, especially in the first three days, the feed consumption of experimental roosters decreased sharply (p0.1), but in the subsequent period it gradually increased and by the end of the third week slightly exceeded its initial level (Fig. 3). The live weight of experimental roosters decreased directionally during the first three weeks of crowding and on the 23rd day was minimal-14.9% (p0.1) below the background. On the 30th day, the live weight of roosters was somewhat stabilized, but compared to the original was 6.8 % (p>0.1) lower (Fig. 4). 3 BIO Web of Conferences 30, 04005 (2021) https://doi.org/10.1051/bioconf/20213004005 ILS 2020

Since the 15th day of crowding, there has been a tendency to approach the initial level of stereotypical behavior and live weight of experimental birds. The obtained data can be considered as indicators of the body's output to a certain level of adaptation to a state of chronic stress, since by this time the birds had established hierarchical relationships in each cage and, accordingly, reduced nervous and emotional tension. During the entire 30-days study period, the indicators of the overall functional state of intact roosters (stereotypical behavior, live weight and feed consumption, feather cover condition) did not go beyond the background values. Fig. 3. Feed consumption of intact (I) and stressed (II) birds under conditions of chronic stress. Fig. 4. Dynamics of live weight in intact (I) and experimental (II) birds under conditions of chronic stress. 3 Results and discussion The loss of a number of components of stereotypical behavior in birds that are the result of an evolutionary process during intensive poultry farming does not allow them to fully adapt to relatively constant industrial conditions. The cage placing of birds with a sharp restriction of motor activity associated with the search for food, deform the evolutionarily formed daily stereotypical behavior of domestic birds and associated cyclic rhythms of physiological functions of the body, violating the mechanisms of homeostasis regulation. To assess the functional state of birds under acute and chronic stress, along with the dynamics of the level of glycemia it is necessary to study the dynamics of changes in the habit of birds including the state of feather cover and the rate of development of molt and pronounced behavioral responses under stress. A longer observation period is needed to study crowding stress. References 1. A.A. Viru, Usp. fiziol. Sciences. 11, 27 (1980) 2. Yu.P. Kvitkin, N.G. Federchenko, I.L. Krivtsov, Stress of poultry. Overview information. (1977) 3. S. Levine, Animal Behav. 217 (1976) 4. T. Cox, Stress. (1981) 5. F.I. Furduy, V.P. Fedoryak, S.Kh. Haidarliu. Chisinau: Shtiintsa. (1987) 6. W.J. Kuenzel, Proceedings. 75 (1982) 7. L.E. Panin, Biochemical mechanisms of stress. (1983) 8. F.P. Vedyaev, T.M. Vorobyo, Models and mechanisms of emotional stress. (1983) 9. B. Novitsky, The behavior of farm animals. (1981) 10. M. Mathew, Poultry Gicide. 18, 59 (1981) 11. A.M. Evstratova, Ways to increase the viability of poultry in industrial conditions. (1979) 12. V.V. Matyushnikov, Natural resistance of poultry. (1985) 13. T.A. Pogrebnyak, T.M. Vorobyova, E.A. Lipunova, Methods of studying the central nervous mechanisms of adaptation of birds to stress. (1990) 14. P.K. Anokhin, Nodal questions of the theory of a functional system. (1980) 15. F.P. Vedyaev, T.M. Vorobeva, Models and mechanisms of emotional stress. (1983) 16. I.A. Bolotnikov, V.S. Mikhneva, E.K. Oleinik, Stress and immunity in birds. (1983) 4 BIO Web of Conferences 30, 04005 (2021) https://doi.org/10.1051/bioconf/20213004005 ILS 2020

Structural features of the vegetative bodies of Hibiscus syriacus L. (Sev. Malvaceae Juss.) growing under the conditions in Uzbekistan Abdikhofiz Rakhimov1* , Lutfullo Yoziev1 , and Guljan Duschanova2 1Dept. of Natural Sciences, Karshi State University, Karshi, Uzbekistan 2Tashkent Botanical Garden named after acad. F.N.Rusanov at the Institute of Botany of the Academy of Sciences of the Republic of Uzbekistan, Tashkent, Uzbekistan Abstract. The article studies the anatomical structure of the vegetative organs, stems, leaves and leaf blades of Hibiscus syriacus L. in Uzbekistan for the first time. 1 Introduction Hibiscus (Syrian hibiscus) is a plant of the Malvaceae family, a species of the genus Hibiscus, native to China, Korea, and West Asia. It is cultivated in open ground in the south of Russia, in the Crimea, in the south of Ukraine, in Moldova and Central Asia. Hibiscus syriacus is a deciduous shrub up to 5-6 m high. The stalk is thick, treelike, conical in shape, bare, highly leafy, gray, the type of branching is sympodial. Leaves are of medium size (up to 10 cm long), green, palmate, slightly corrugated. The nerve node is green. Flowers are single or double. They have a very different colour from white to raspberry, sometimes two-tone. Filaments are short, light yellow. Anthers and pollen are light yellow. Stigmas are not protruding. The plant has small boxes, which are ovoid, five-celled with 3 seeds in each nest. Seeds are medium, unrefined. The species is highly fertile, precocious, frostresistant [1]. The anatomical structure of the autonomic organs of Hibiscus syriacus has not been studied in Uzbekistan. This determines the relevance and novelty of our research. The aim of our research is to study the anatomical structure of the leaf, petiole, and stem of Hibiscus syriacus, in order to determine the diagnostic features of this studied species. 2 Experimental Simultaneously with the morphological description, the vegetative organs (leaf, petiole and stem) were fixed in 700 ml of ethanol for anatomical study. The manual method was used to prepare sections of the vegetative organs. Cross sections of leaf, petiole and stem are prepared manually using a safety razor. Cross sections of the leaf are made through the middle, and the petiole and stem through the base. Sections were stained with * Corresponding author: [email protected] methylene blue and safranin, followed by gluing in glycerol-gelatin (Barykina et al., 2004). Descriptions of the main tissues and cells are given according to C. Esau (1969), N. S. Kiseleva (1971), the epidermis - according to S.F. Zakharevich (1954). Microphotographs were taken by a computer microphoton with a Canon A123 digital camera under the Motic B1-220A-3 microscope. 3 Results and discussion The leaf is a vegetative organ of the plant, performing the function of photosynthesis, transpiration and gas exchange. In the Hibiscus syriacus plant, the leaves are green, palmate, slightly corrugated. On the paradermal section, the outlines of epidermal cells are slightly sinuous, the projection is polygonal. However, the upper epidermis is somewhat different from the lower epidermis. The cells of the upper epidermis are larger than the lower ones. The leaves are amphistomatic, stomata are located on both sides of the leaf blade, located transversely to the longitudinal axis of the leaf. The shape of the stomata is round-oval. The upper (adaxial) epidermis has a significantly lower number of stomata compared to the lower (abaxial) epidermis. All this leads to a reduction in water loss from the surface of the sheet. The closing stomata cells on both sides of the leaf are almost the same length. Stomata are submerged, hemiparacitic and anomocytic type (Fig. 1, 2). Leaf mesophyll is in the cross section of the dorsiventral type, which is represented by palisade cells located under the upper epidermis of the leaf mesophyll, spongy cells – above the lower epidermis of the leaf mesophyll. The epidermis is represented by one row of cells with a thick-walled cuticle layer. Adaxial epidermal cells are larger than abaxial. Between the adaxial and © The Authors, published by EDP Sciences. This is an open access article distributed under the terms of the Creative Commons Attribution License 4.0 (http://creativecommons.org/licenses/by/4.0/). BIO Web of Conferences 30, 04006 (2021) https://doi.org/10.1051/bioconf/20213004006 ILS 2020

abaxial epidermis there is an assimilation tissue consisting of palisade and spongy cells. The palisade parenchyma is under the adaxial epidermis. The palisade chlorophyllbearing parenchyma is large and elongated, which consists of one row of cells and is located between the adaxial epidermis and the spongy parenchyma of the leaf. Druse calcium oxalate was found in palisade and spongy cells (Fig. 2). Fig.1. The structure of the epidermis of the leaf of Hibiscus syriacus on the paradermal section: a-c - adaxial epidermis; Gd - abaxial epidermis. Legend: OT - trichome base, U - stomata, E - epidermis. The spongy chlorophyll-bearing parenchyma consists of 4-5 rows and is located between the palisade parenchyma and the abaxial epidermis. The spongy parenchyma is round, large and small cell with small cavities. Between palisade and spongy cells there are numerous lateral conducting bundles, with 3-4 small vessels (Fig. 2). The main leaf vein extends on the abaxial side. The rest of the vein is occupied by the main parenchyma, into which 1 conductive bundle is immersed, parenchyma cells are thin-walled, round-oval. Conductive bundles are of closed collateral type, numerous, consisting of phloem and xylem. Xylem is thick-walled, elongated. Their walls are thickened in the form of spirals (Fig. 2). Leaf petiole on an oval cross-section, parenchymal-bundle type, consists of a single-row epidermis. A corner 5 6 row collenchyme is under the epidermis. Under the collenchyma, 5-6 rows of parenchymal cells are located. In the center of the petiole there is 1 conductive bundle. The conducting bundle is closed collateral, a ring-shaped and sclerified form due to sclerenchyma cells. Parenchymal cells in the central part of the petiole are thin-walled, round, oval, and hydrocyte cells are found (Fig. 3). The base of the stem on the cross section is rounded, beam type. The structures of the stems of woody plants are due to many years of intensive activity of the apical and lateral meristems. They are powerful, highly lignified, with the early development of secondary integumentary tissue. The integumentary tissue - the cork - consists of several rows of radially located cells with thick corkcovered membranes, and its cells are dark brown, thickwalled, densely closed. Outwardly, during division by tangential septa, the cells of the phellogen are formed by cork cells, and inside - by the cells of the phalloderm (Fig. 4). The core is not wide, it is represented by large and small round-oval, thin-walled parenchymal cells and they contain hydrocyte cells (Fig. 4). Fig. 2. Anatomical structure of the leaf of Hibiscus syriacus: a - general view of the main vein of the leaf; b - mesophyll leaf; v - the epidermis and collenchyma, the main vein of the leaf; g - palisade parenchyma; d - a conductive beam; e - spongy parenchyma and unloaded stomata. Legend: GP - spongy parenchyma, D - drusen, KL – collenchyma, Ks - xylem, P - palisade parenchyma, PP – conducting bundle, U-stomatoma, F – phloema, E- epidermis. Fig. 3. The structure of the petiole of the leaf of Hibiscus syriacus L: a-general view; GD - epidermis and collenchyma; 2 BIO Web of Conferences 30, 04006 (2021) https://doi.org/10.1051/bioconf/20213004006 ILS 2020

in - a conducting bunch; d - parenchymal and hydrocytic cells; e - Druse of calcium oxalate. Legend: D - drusen of calcium oxalate, HD - hydrocyte cells, KL - collenchyma, Ks - xylem, Px - parenchyma, PP - conductive beam, SC - sclerenchyma, Fphloem, E-epidermis. Fig. 4. Anatomical structure of the stem of Hibiscus syriacus in a transverse section: a - general view of the stem; b-in - cow parenchyma; g - secondary conductive beams; d - the core. Legend: VL - secondary beam, runway - secondary conductive beams, GD - hydrocyte cells, KP - cortical parenchyma, K - cambium, Ks - xylem, ML - soft bast, PL - primary rays, PLV - primary bast fibers, SPP - primary conductive bundles, Pr - periderm, Px - parenchyma, RL - radial rays, SC - sclerenchyma, TL - hard forehead. 4 Conclusion Thus, the anatomical structure of the vegetative organs of Hibiscus syriacus, growing in the conditions of the Kashkadarya region, was studied. The following diagnostic signs were revealed: in the leaf - slightly sinuous outline of epidermal cells; unburied stomata of anomocytic and hemiparacytic type; dorsiventral type of leaf mesophyll; palisade and spongy chlorophyll-bearing parenchyma; the presence of drusen of calcium oxalate in palisade and parenchymal cells; in the petiole - parenchymal-beam type of structure; under the epidermis there is a numerous angular collenchyma; at the edges, the conducting bundle is closed collateral and sclerated; stem type is more lignitied; lignitied elements represent primary bast fibers; the secondary forehead or secondary phloem, which constitutes the secondary cortex, is inward from the fibers; trapezoidal areas consist of lignified thick-walled cells – a hard bast, and thin-walled elements – a soft bast; the libiform is broard, the core is not wide. These identified signs may serve to identify plant materials. References 1. R.Kh. Allaberdiev, M.D. Kamalova, Floriculture: History, Theory, Practice: Materials of the VII International Scientific Conference, Minsk. 34 (2016) 2. R.P. Barykina, T.D.Veselova, A.G. Devyatov, Handbook of botanical microtechnology (basics and methods), 6 (2004) 3. K. Esau, Plant anatomy. 416 (1968) 4. N.S. Kiseleva, Anatomy and morphology of plants. 89 (1971) 5. S.F. Zakharevich, Bulletin of Leningrad State University, 4, 65 (1954) 3 BIO Web of Conferences 30, 04006 (2021) https://doi.org/10.1051/bioconf/20213004006 ILS 2020

Cytokinetic parameters of erythropoiesis under normal health conditions and during the development of acute lymphoblastic and acute myeloblastic leukemia Evgeniy Seliverstov1* , and Marina Skorkina2 1Department of Biology, Belgorod State National Research University, Belgorod, Russia 2Department of Biochemistry, Institute of Medicine, Belgorod State National Research University, Belgorod, Russia Abstract. The article presents the application of the method for determining the quantitative parameters of erythropoiesis to patients with acute leukemia. The objective of the work is an investigation of erythropoiesis cytokinetic parameters under the normal health conditions and during the development of the acute lymphoblastic leukemia and the acute myeloblastic leukemia. It was found that the distribution of reticulocytes shifts towards an increase of immature reticulocyte fraction while the ratio between maturing and immature cells remains unchanged. The method presented can be used in clinical diagnostic and scientific research of bone marrow hematopoietic activity. 1 Introduction In 1982, in the framework of the USSR space programs and the study of USSR cosmonauts health after being in space, Ilyukhin et al. were improved the method for determining the quantitative parameters of erythropoiesis based on the reticulocyte number count. After comparing with the data of erythrocyte isotope labeling they confirmed the method reliability and recommended it for use in clinical diagnostic and scientific research in cases where the use of direct methods for the study of cytokinetic parameters is not possible [1]. Reticulocyte counts can provide useful information about bone marrow erythropoietic activity, the rate of reticulocyte delivery from the bone marrow into peripheral blood, and the rate of reticulocyte maturation. These parameters can be really important to studying the compensatory-adaptive reactions accompanying the development of malignant proliferation in the blood system such as leukemia and to the prediction of hemopoietic recovery in patients [2,3]. However, there is a probability to determine erroneously elevated immature reticulocyte fraction (IRF) in leukemic patients by automated reticulocyte analysis which means that hematologists should examine reticulocyte distribution carefully and don’t neglect the old methods such as using blood smears [4]. 2 Experimental The work has been performed on the base of the Department of Biology of Belgorod State National Research University in Belgorod, Russia. In the * Corresponding author: [email protected] experimental part of the work venous blood of patients with acute lymphoblastic leukemia (ALL) (41 samples), and patients with acute myeloblastic leukemia (AML) (18 samples), who were undergoing medical treatment in the hematological department of the regional clinical hospital of Belgorod were used. The control studies were performed on the blood of healthy people (n = 50, 26 women and 24 men) of mature age (25–45 years) who underwent a clinical examination in the regional clinical hospital of Belgorod. Blood sampling was performed by venipuncture by specialized medical staff. Blood was collected in Vacuette K3E vacuum tubes containing dry EDTA K3 at a concentration of 2.0 mg (0.006843 mol/L) per 1 mL of blood. The study was approved by the local Ethical Committee of the Medical Institute of Belgorod State University and informed consent of all subjects was obtained according to the recommendations of the Helsinki Declaration (The International Response to Helsinki VI, The WMA’s Declaration of Helsinki on Ethical Principles for Medical Research Involving Human Subjects, as adopted by the 52nd WMA General Assembly, Edinburg, October 2000). Cytokinetic parameters of erythropoiesis were calculated by using the number of reticulocytes in unincubated and incubated blood [1]. Reticulocytes were stained by 0.1% solution of brilliant cresyl blue prepared in 0.9% NaCl solution. The blood smear was made of the unincubated blood mixed with the dye in a 1:1 ratio by volume and left at room temperature for 40 minutes. Also, another blood smear was made of the blood sample (100 μl) placed in a thermostat at 37° C for 4 hours and then stained by brilliant cresyl blue. © The Authors, published by EDP Sciences. This is an open access article distributed under the terms of the Creative Commons Attribution License 4.0 (http://creativecommons.org/licenses/by/4.0/). BIO Web of Conferences 30, 04007 (2021) https://doi.org/10.1051/bioconf/20213004007 ILS 2020

The number of erythrocytes per 1 μl of blood was counted by using a hemocytometer. By using an Axiostar plus microscope (Carl Zeiss, 2010), the number of reticulocytes in unincubated and incubated for 4 hours of blood samples per 1000 erythrocytes was counted. The calculation was carried out by using an oil immersion lens (magnification 100x). Based on the Heilmeyer [5], all groups of reticulocytes were counted. Group I: cells with a densely clumped reticulum, group II: cells with an extended network of loose reticulum, group III: cells with scattered granules with residual reticulum network, group IV: cells with grain as individual strands or scattered granules (Fig. 1). Fig. 1. Reticulocyte maturation groups (photos were taken by the authors). According to formulas, the half-life (the period for which half of the reticulocytes mature into the erythrocytes) of reticulocytes T1/2r (Fig. 2), the half-life (the period for which half of the erythrocytes are destroyed due to their senescence) of erythrocytes T1/2er (Fig. 3) and the value of the erythrocyte daily production per 1 μl of blood Рer/day (Fig. 4) were calculated: Fig. 2. Half-life of reticulocytes. Where Nr0 – the number of all reticulocytes per 1000 erythrocytes before incubation, cells; Nr4 – the number of all reticulocytes per 1000 erythrocytes after 4 hours incubation, cells; t – incubation time (4 hours); T1/2r – the half-life of reticulocytes, hours. Fig. 3. Half-life of erythrocytes. Where T1/2er – the half-life of erythrocytes, days. Fig. 4. Value of the erythrocyte daily production per 1 μl of blood. Where Per/day – a value of the erythrocyte daily production per 1 μl of blood, thousands / (μl x days), Ner – the number of erythrocytes in 1 μl of blood, millions / μl. Using the modified Kolmogorov-Smirnov test the hypothesis about the uniform distribution of empirical data was tested. The significance of differences between control and experimental samples was determined using the Mann-Whitney U-test (p<0.05). All data are represented by the mean values with their standard errors. We did not have an access to the information about sex and age of patients with ALL and AML due to patient confidentiality which did not allow an adequate comparison in the sex and age groups. Therefore, the mean value for all samples was taken as a control and experimental data. 3 Results and discussion Reticulocytes of I and II maturity groups were very rare and were represented by single cells in blood smears from healthy donor samples. The number of group III reticulocytes in the group of healthy donors was 3.11 ± 0.37 cells per 1000 erythrocytes. For group IV reticulocytes this number was 13.60 ± 1.20 cells per 1000 erythrocytes. The cytokinetic parameters of the erythropoiesis between men and women didn’t differ significantly under conditions of blood system physiological regeneration. In 46.1% of the blood samples of patients with ALL and 50% of the blood samples of patients with AML, reticulocytes were not detected, or they were represented by extremely rare single cells thus did not allow to calculate cytokinetic parameters in these samples. Between the control (healthy people) and the experimental (patients with ALL and AML) groups, significant differences in most of the values of cytokinetic parameters were not identified. Nevertheless, there was a general increase tendency in parameters, except the halflife of erythrocytes in the group of patients with ALL, maturing/immature cells ratio (Nr4/Nr0), and number of erythrocytes per 1 μl of blood (tab. 1). There was an increase in the number of immature group I reticulocytes by 2033.3% (p<0.05), group II reticulocytes by 1768.7% (p<0.05) and group III reticulocytes by 216.7% (p<0.05) in the rest 53.9% of patients with ALL (Fig. 5). Also, there was an increase in the number of immature group I reticulocytes by 5933.3% (p<0.05) and group II reticulocytes by 1875% (p<0.05) in the rest 50% of patients with AML (Fig. 6). Also, there were two cases of ALL which we did not count in final results due to their significantly big difference in ratio between reticulocyte number before and after incubation compared to others (tab. 2). According to the literature data, the immature data, the immature reticulocyte fraction (IRF) may be termed as the red cell equivalent of the “left shift” typically associated with neutrophilic white cells [2]. The IRF recovery in patients with acute leukemia after chemotherapy showing bone marrow hematopoietic recovery earlier than absolute neutrophil count [3]. Thus, a favorable prognosis of hematopoietic recovery for patients who showed an increased number of immature reticulocyte fraction can be expected. 2 BIO Web of Conferences 30, 04007 (2021) https://doi.org/10.1051/bioconf/20213004007 ILS 2020

Table 1. Cytokinetic parameters of ALL and AML patients. Parameter Donors ALL AML Ner, millions/μl 3.75±0.08 4.07±0.27 3.70±0.55 Nr0, cells/1000 erythrocytes 16.88±1.37 22.19±3.85 27.44±11.02 Nr4, cells/1000 erythrocytes 9.92±0.97 14.62±3.11 16.56±5.20 Nr4/Nr0 0.60±0.03 0.59±0.05 0.67±0.07 T1/2r, hours 7.83±0.99 9.64±2.38 11.64±3.32 T1/2er, days 23.86±3.51 23.81±6.36 41.13±11.84 Рer/day, thousands/(μl x days) 202.19±20.45 237.15±35.46 236.72±127.42 Group I reticulocytes, cells/1000 erythrocytes 0.06±0.03 1.22±0.64* 3.56±2.47* Group II reticulocytes, cells/1000 erythrocytes 0.16±0.07 2.83±0.92* 3.00±1.35* Group III reticulocytes, cells/1000 erythrocytes 3.11±0.37 6.74±1.44* 6.67±3.74 Group IV reticulocytes, cells/1000 erythrocytes 13.60±1.20 15.04±2.18 14.22±3.98 *p < 0.05 Table 2. ALL data outliers. Parameter ALL case № 1 ALL case № 2 Ner, millions/ μl 4.59 5.02 Nr0, cells/1000 erythrocytes 67 68 Nr4, cells/1000 erythrocytes 1 2 Nr4/Nr0 0.01 0.03 T1/2r, hours 0.66 0.79 T1/2er, days 0.41 0.48 Рer/day, thousands/ (μl x days) 7758.2 7247.6 Group I reticulocytes, cells/1000 erythrocytes 14 0 Group II reticulocytes, cells/1000 erythrocytes 7 20 Group III reticulocytes, cells/1000 erythrocytes 11 15 Group IV reticulocytes, cells/1000 erythrocytes 25 36 Fig. 5. The number of different reticulocyte groups in ALL blood samples. Fig. 6. The number of different reticulocyte groups in AML blood samples. 4 Conclusion It was found that about half of the cases of ALL and AML were characterized by ineffective erythropoiesis when erythroid progenitors were destroyed in the bone marrow. In the rest of the cases, the regulation of erythropoiesis was rearranged by increasing the number of groups I and II immature reticulocytes. About 5% of ALL cases were characterized by accelerated processes of immature red blood cell maturation, erythrocyte destruction, and erythrocyte daily production. However, the ratio between maturing cells and immature ones from the bone marrow remained the same as in the normal health conditions. The formulas used for erythropoiesis cytokinetic parameter calculations can be used in clinical diagnostic and scientific research of bone marrow hematopoietic activity. References 1. A.V. Ilyuhin, T.E. Burkovskaya, A.V. Shafirkin, N.V. Klyuchanskaya, Kosmicheskaja biologija i aviakosmicheskaja medicina. 16, 86 (1982) 3 BIO Web of Conferences 30, 04007 (2021) https://doi.org/10.1051/bioconf/20213004007 ILS 2020

2. R.Z. Raja-Sabudin, A. Othman, K.A. AhmedMohamed, A. Ithnin, H. Alauddin, H. Alias, Z. Abdul-Latif, S. Das, F.S. Abdul-Wahid, N.H. Hussin, Saudi. Med. J. 35, 346 (2014) 3. S.E. Rauf, S.A. Khan, N. Ali, N.K. Afridi, M. Haroon, A. Arslan, Turk. J. Haematol. 33, 131 (2016) 4. J. Huh, H. Moon, W. Chung, Ann. Hematol. 86, 759 (2007) 5. L. Heilmeyer, J. Clin. Med. 121, 361 (1932) 4 BIO Web of Conferences 30, 04007 (2021) https://doi.org/10.1051/bioconf/20213004007 ILS 2020

Species composition of green frogs (Pelophylax Esculentus Complex) of the Belgorod agglomeration based on DNA markers Eduard Snegin1* , Anatoliy Barkhatov1 , Anton Sychev1 , and Elena Snegina1 1 Institute of Pharmacy, Chemistry and Biology, Belgorod State National Research University, Belgorod, Russia Abstract. On the basis of molecular genetic analysis of the intron-1 of the nuclear serum albumin gene (SAI-1) were identified 177 individuals of Pelophylax esculentus complex of 9 localities Belgorod. Two types of population systems R and RE were identified. Pure populations of L-type, E-type and LE-type as well as P. lessonae individuals were not identified. 1 Introduction The European green frogs complex (Pelophylax esculentus complex) includes three species: Pelophylax ridibundus (Pallas, 1771), P. lessonae (Camerano, 1882) and P. esculentus (Linnaeus, 1758) [1]. According to studies by a number of authors, hybrid frogs are distributed almost all over Europe; this fact may indicate their "evolutionary success". Hybrids and their parents often live together and form common breeding groups, despite differences in their lifestyle [2]. Accurate identification of species of the European green frogs complex is difficult, and hybrid species often erase the "boundaries" of parent species, but it is this necessary to solve a number of problems: ecological monitoring, study of species introduction and invasion and to develop a strategy for their conservation [3, 4]. More precise molecular genetic methods should be used to reliably identify the species belonging to Pelophylax esculentus complex [2, 3]. The aim of the study is a reliable species identification of the European green frogs Pelophylax esculentus complex in the Belgorod and its surroundings. 2 Experimental The material was collected during the summer field season 2018-19. In total 177 individuals from 9 localities of Belgorod region were studied by molecular genetic method: 1. «Severskiy Donec» 50.591/36.608 (n=14); 2. «Vezelka» 50.601/36. 556 (n=17); 3. «Oskochnoe» 50.647/36.557 (n=20); 4. «Jachnevskiy» 50.639/ 36.579 (n=16); 5. «Dubovoe» 50.533/ 36.583 (n=17); 6. «Ust'e» 50.530/ 36.649 (n=26); 7. «Maiskiy» 50.515/ 36.462 (n=19); 8. «Severnyi» 50.733 36.487 (n=24); 9. «Shopino» 50.705/36.611 (n=24). Molecular-genetic analysis was carried out Center of genomic selection of «Belgorod State National Research University». * Corresponding author: [email protected] The first phalanges of the hind leg were used as a tissue sample. To isolate genomic DNA, a set of DNA Extran-2 (Sintol) was used, according to the protocol proposed by the company. The obtained DNA solution was stored at -20◦С. Determine hybrids and cryptic forms, the nuclear serum albumin gene (SAI-1) were used according to the developed PCR test of the Pelophylax esculentus complex identification system proposed by Ivanov A. Yu. and Ermakov O. A. [5]. DNA variability was analyzed using polymerase chain reaction method. Samples were prepared per tube before amplification as follows: 2.5x Reaction mixture (2.5x PCR buffer B (KCl, TrisHCl (pH 8.8), 6.25 mM MgCl2), SynTaq DNA polymerase, deoxynucleoside triphosphates, glycerol, Tween 20 - 8 µl; MgCl2 25 mM - 0.5 µl; deionized water - 9.3 µl, mix of primers 0.1 µl (SA1F-Pu: CCATACAAATGTGCTAAGTAGGTT; SA1R-Pr: GATACAAATGATACATTCCCACCT; SA1R-Pl: TACCGTACCGATATTTGTATGC; SA1R-Pb: TTGTTCCCTATACTAAGGTCAC). PCR amplification was performed in the DNA amplifier Veriti (Thermo FS). PCR amplification involved an initial cycle of denaturation at 95 °C for 5 min and 35 subsequent cycles of 94 °C for 30 s, 60 °C for 60 s, and 72 °C for 60 s, followed by a final extension step at 72 °C for 10 min. After PCR, the amplification products were analyzed with electrophoresis in a 4% agarose gel followed by ethidium bromide staining and UV light imaging. 3 Results and discussion Green frogs can form single-species "pure" (R, E and L) and mixed (RE, LE and REL) types of population systems. According to our study, 2 types of population systems - R and R-E types - have been identified in the Belgorod (Table 1). © The Authors, published by EDP Sciences. This is an open access article distributed under the terms of the Creative Commons Attribution License 4.0 (http://creativecommons.org/licenses/by/4.0/). BIO Web of Conferences 30, 04008 (2021) https://doi.org/10.1051/bioconf/20213004008 ILS 2020

Table 1. Green frogs genotypes Population n RR BB LL BR BL LR «Severskiy Donec» 14 3 4 0 4 2 1 «Vezelka» 17 5 7 0 5 0 0 «Oskochnoe» 20 2 9 0 3 4 2 «Jachnevskiy» 16 3 4 0 6 2 1 «Dubovoe» 17 0 0 0 1 11 5 «Ust'e» 26 1 2 0 4 12 7 «Maiskiy» 19 3 3 0 8 3 2 «Severnyi» 24 4 4 0 9 6 1 «Shopino» 24 1 7 0 8 4 4 Note: n - number of individuals; R - alleles of "western" form of marsh frog, B - alleles of "eastern" form marsh frog, L - alleles of pool frog. The performed molecular genetic analysis revealed genetic heterogeneity of the green frog complex. Thus, on the urbanized territory of the Belgorod region, P. cf. bedriagae (BB) and its hybrids (BR, BL) dominate in water bodies, being one of the invasive representatives of amphibians, has a negative impact on local batrochofauna [6]. Our studies confirm that P. cf bedriagae is confined to urbanized landscapes. Pure populations of L-type, E-type, and LE-type, as well as P. lessonae individuals, were not detected. The data obtained should be taken into account in ecological studies of the region's batrochofauna, since P. cf. bedriagae has a higher resistance to anthropogenic press than other representatives of the Pelophylax esculentus complex [7,8,9]. 4 Conclusion As a result of the study, 2 species of green frogs complex were identified in the Belgorod agglomeration - Pelophylax ridibundus and P. esculentus. The study of nuclear DNA showed that the lake frog has alleles of two cryptic forms - "western" (P. ridibundus) and "eastern" (P. cf. bedriagae). It was found that both forms of the lake frog participate in the formation of hybrid individuals (P. esculentus). References 1. N.B. Ananyeva, L.Ya. Borkin, I.S. Darevskiy, N.L. Orlov. Amphibians and reptiles. Encyclopedia of Nature of Russia. (1998) 2. D.V. Dedukh, A.V. Krasikova, Genetics. 53. 885 (2017) 3. A.I. Faizulin, R.I. Zamaletdinov, S.N. Litvinchuk, L.Y. Rozanov, Y.M. Borkin, O.A. Ermakov, A.B. Ruchin, G.A. Lada, A.O. Svinin, I.V. Bashinsky, I.V. Chikhlyaev, Nature Conservation Research. Protected science. 1 (2018) 4. A.Yu. Ivanov. Proc. of Sci. Penza State University. Penza (2019) 5. O. Ermakov, A. Ivanov, S. Titov, A. Svinin, S.N. Litvinchuk, Russian Journal of Herpetology. 26, 367 (2019) 6. V.L. Vershininin, I.A. Sitnikov, S.D. Vershinina, A.G. Trofimov, A.A. Lebedinsky, I.I. Miura Genetics. 55, 972 (2019) 7. O.A. Ermakov, A.I. Faizulin, M.M. Zaks, Izv. Samarsk, center of RAS. 16, 409 (2014) 8. O.A Ermakov, M.M. Zaks, S.V. Titov, Vestnik Tambov. 18, 2999 (2013) 9. А. О. Svinin, A.Yu. Ivanov, M.M. Zaks, S.N. Litvinchuk, L.Ya. Borkin, Yu.M. Rozanov, O.A. Ermakov, Modern herpetology. 15, 120 (2015) 2 BIO Web of Conferences 30, 04008 (2021) https://doi.org/10.1051/bioconf/20213004008 ILS 2020

Health ecology: factors of spread and consequences of viral hepatitis manifestation Ludmila Vetrova 1,* , Tatyana Pogrebnyak 2 , Elena Khorolskaya 2 , Irina Sagalaeva 3 , and Darya Maslova 2 1Regional State Budgetary Healthcare Institution "Infectious Clinical Hospital named after E.N. Pavlovsky", Belgorod, Russia 2Department of Biology Belgorod State National Research University, Belgorod, Russia 3Department of Foreign Languages and Professional Communication Belgorod State National Research University, Belgorod, Russia Abstract. The features of viral hepatitis B (HB) and C (HC) in the initial making of these diagnoses in three age groups of men and women (25-30, 31-55 years old for women and 31-60 years old for men, over 55 for women and 60 years old for men) were studied. High levels of bilirubin in the blood serum in all groups indicated damage of the functions of hepatocytes, especially in men with hepatitis B, in women with hepatitis C. The high ALT activity indicated an increase in cytolytic processes in liver hepatocytes in all groups with viral HB and HC, especially in men of the younger group, in women of the younger and middle-aged groups. The high concentration of AST indicated early stages of HC infection in all age groups, especially in the younger group of men with liver, heart, kidney and muscle damage. A positive thymol test in all groups of men and women with HB and HC indicated a shift in the protein balance along the path of pathologically enhanced synthesis of γ-globulins in hepatocytes and the removal of albumins from the body. The concentration of β-lipoproteins in the blood serum only in men of the younger group with hepatitis C corresponded to the norm, in other groups with HB or HC this parameter exceeded it by an average of 1.5 times, noting a violation of lipid metabolism in hepatocytes of the liver. 1 Introduction The analysis of publication activity on the study of chronic viral hepatitis B (CHB) and C (CHC) shows the interest of researchers in this problem, since the receipt of new data opens up a wide prospect for expanding and deepening knowledge in the field of features of the manifestation of viral hepatitis [1, 2]. Viral hepatitis affects all age and social groups of the population. Taking into account the breadth of their spread, the level of morbidity, the severity of their course, the frequency of development of chronic forms and the economic damage they cause, they belong to one of the leading places among viral infections [3, 4]. All types of viral hepatitis are registered in Russia. They occupy one of the leading places in human infectious pathology [3, 5]. Experts attribute Russia to regions of the world with low endemicity for hepatitis E, with average-for hepatitis A, B, C, D, assessing these data to a certain extent conditionally. Since their accuracy depends on the quality of diagnostics and completeness of registration of all cases of the population infection [5]. The prevalence of viral hepatitis in Russia is estimated by the official indicators of registration of the incidence of acute hepatitis CHA, CHB and CHC in the population and by the frequency of detection of serological markers of infection [6, 7]. For each form of viral hepatitis, markers have been established – specific biological and specific compounds that cause morphofunctional changes in the human body, for which they are successfully diagnosed [8, 9, 10]. The lack of accurate official statistics on CHB and CHC in Russia does not give a complete understanding of the level of their spread due to the low level of medical activity of the population. In some territories of Russian regions there are millions of hepatitis B and C virus carriers [11, 12]. The reaction of the blood system to viral infection of the body is always aimed at eliminating damage in it and restoring the original state of homeostasis. Protective reactions of the blood system, during primary infection with hepatitis C or B viruses, are characterized by a high level of manifestation of protective reactions with simultaneous damage to vital organs and systems of the body itself – the liver, heart, and muscle apparatus [4, 6, 7]. These points actualize the study of the reactivity of the blood system to viral load in different age groups of the population, which causes hepatitis B and C. The purpose of the work is to study the response of the blood system to viral load caused by primary infection of the adult human body with hepatitis B or C. 2 Experimental To achieve this goal in the parameters of immunoenzyme analysis (IEA) the characteristics of the system response of blood viral load in the serum of antibodies at initial diagnosis of viral hepatitis B or C in mature persons were examined: 150 men and 150 women, three age groups (25-30 years old, 31-55 years old for women and 31-60 years old for men, over 55 for women and 60 years old for men) © The Authors, published by EDP Sciences. This is an open access article distributed under the terms of the Creative Commons Attribution License 4.0 (http://creativecommons.org/licenses/by/4.0/). BIO Web of Conferences 30, 04009 (2021) https://doi.org/10.1051/bioconf/20213004009 ILS 2020 * Corresponding author: [email protected]

who had been confirmed primary diagnosis of "hepatitis" or "hepatitis C" in the Regional Infectious Clinical hospital named by E. Pavlovsky (Belgorod). Accordingly, 6 groups of 50 people each were formed as a result of a random sequence of their admission to the diagnostic examination, taking into account age and gender, and confirmation of the diagnosis-hepatitis B or C. These types of VH are almost always marked by tension of the blood system functions and disorders in the immune system [6, 7, 13]. Timely and correctly performed diagnostics of the response to the viral load of the white blood system based on the severity of IEA parameters, taking into account biochemical markers, allows us to assess the functional status of the subjects at the time of diagnosis confirmation – VHB or VHC [6, 7]. The reactivity of the blood system in examined subjects of all age and gender groups was assessed for the presence of hepatitis B or C pathogens [7, 11]. Thus, VHB was found by the presence of corresponding markers of hepatitis B (HBsAg, AHBcor, AHBcorM, AHBe) or hepatitis C (NS3, NS4, NS5, core). The detection of viral hepatitis antibodies was performed on the basis of detection of a complex of structural and non-structural viral peptides using solid-phase of IEA [5, 8, 12]. The nature of the course of viral infection and the degree of liver disfunction were assessed by biochemical parameters: concentrations of aminotransferases (ALT and AST) in blood serum, bilirubin, B-lipoproteins, protein metabolism (thymol test) [10, 14]. For early diagnosis of viral hepatitis, it is important that the activity of the ALT enzyme increases in the prodromal period and against the background of viral hepatitis its concentration in the blood serum on average can increase by 8-10 times, and the AST enzyme-by no more than 2-4 times [6, 7]. The study conducted a comparative analysis of the features of the manifestation of viral hepatitis B and C in different age and sex groups of the adult population. The initial revealed average immunological and biochemical indicators are considered on the basis of their comparison with standard age-sex norms typical for men and women. All the original individual data were statistically processed using descriptive statistics of the computer software package "Statistica 10" with the determination of the values of the average (M), standard error (m) and standard deviation (σ). 3 Results and discussion Features of manifestation in men and women infected with VHB or VHC, who have a positive result for the presence of their corresponding markers in their blood serum, are presented in table I. Among both sex groups, at each age, the markers identified individuals not only with acute exacerbation of HB, but also with signs of a slow current chronic form of infection and even recovering. All individuals with a positive result for HC were found to have a virus replication process, some of them showed signs of current or even past infection. This data indicated a low level of medical activity of the examined different age groups, who only with pronounced pathological manifestations of liver function disorders passed the necessary diagnosis or were accidentally detected with VH after passing a medical examination. The results of the IEA for viral hepatitis B and C in men and women of three age groups allowed us to note that all age groups do not have a proper level of knowledge about the ways of spreading viral hepatitis and there is a lack of formed skills to be protected against them. In each age group of women and men infected with the pathogen HB, the concentration of bilirubin in the blood exceeded the physiological norm, indicating that the degree of pathological changes in men with increasing age was higher (see table I). The analysis of the detected average values of bilirubin showed that the concentration of bilirubin exceeded their physiological norm on average from 33% to 58%, respectively, in the age range. In all age groups of women, the increased bilirubin amount was close in value, exceeding the norm by 39-45%. Similarly, in groups of men and women with hepatitis C, the concentration of bilirubin in the blood was shown within the upper limit of the norm, and in women of all age groups, its indicator was higher, and in comparison, with the groups of men, it was shown in a wider range (table II). In women of the middle age group, the level of total bilirubin was higher (p< 0.05) than in the group of 20-30 years old. Thus, the increased level of bilirubin in the blood serum indicated a pronounced functional tension of liver cell functions in all age groups, especially in men with hepatitis B, and in women with hepatitis C, especially in the group of 20-30 years old. A highly sensitive indicator of hepatocyte cytolysis is the activity of infected enzymes-alanine aminotransferases (ALT) and aspartate aminotransferases (AST) in the blood serum, which characterize the severity of the inflammatory process in the liver. The development of a cytological process in the liver of a patient with viral hepatitis is accompanied by an increase in serum ALT activity to a greater extent and AST to a lesser extent. In all age groups infected with hepatitis B, the indicator ALT in plasma was higher than normal in men of junior and senior age groups in 1,8 times, and women have 2.4 and 2 times respectively in the middle and older groups (table III). The highest indicator of ALT against the norm was established in men of middle-aged group – 2 times, and in women of junior group – 3 times. 2 BIO Web of Conferences 30, 04009 (2021) https://doi.org/10.1051/bioconf/20213004009 ILS 2020

Table 1. IEA results for viral Hepatitis B and C in men and women of three age groups Markers (the number of cases of positive reaction) 25-30 years old 31-60 /31-55 years old More than 61 /56 М F М F М F 50 50 50 50 50 50 HBsAg – the main marker, detected starting from 3-5 weeks of infection 11 10 8 12 10 14 Confirming test for hepatitis B AHB – a previous infection or the presence of post-vaccination immunity 38 41 48 45 42 47 Markers of hepatitis B: a sign of ongoing replication of the virus, a sign of current and past infection 50 50 50 50 50 50 AHBcIgM- active replication and acute infection found 1-2 weeks after HBsAg detection 13 11 17 12 8 6 AHBcor sum-chronic infection 44 35 42 48 48 45 AHBeIgM- acute period of infection 50 50 50 50 50 50 HBeAg- high blood infection, an indicator of active replication of hepatitis B 50 50 50 50 50 50 Anti-VHC- the main marker of infection 42 34 37 43 41 36 A-HCV- spectrum - sign of ongoing virus replication, sign of current and past infection 126 32 25 40 19 25 A-HCVcorIgM- chronic hepatitis C (reactivation phase) Table 2. The concentration of bilirubin in Blood Serum in men and women with Hepatitis В Age male/female Total bilirubin, µmol/l M±m (min-max) Men Women Hepatitis B 20-30 24,8±2,14 10,2-70,4 25,9,0±2,66 8,1-74,7 31-60 / 31-55 27,1±2,52 9,0-78,6 25,8±2,32 9,7-73,8 More than 61 /56 28,5±2,62 11,2-75,6 26,0,1±4,03 9,4-77,8 Hepatitis С 20-30 22,8±3,75 10,4-68,8 28,8±2,90 9,0-84,1 31-60 / 31-55 21,8±2,40 9,2-72,0 21,0±1,62* 8,7-70,8 More than 61 /56 19,7±2,02 9,1-82,8 23,3±2,33 9,1-76,6 * Note: the normal level of bilirubin in the blood serum is 7-17. 2 mmol / l. * - p<0.05. Table 3. The Concentration of ALT in Blood Serum in men and women infected with Hepatitis B Age male/female АLТ, Un/l (M±m, min-max) Men Women Hepatitis B 20-30 80,4±9,54 19-192 110,5±10,46 25-288 31-60 / 31-55 92,3±8,23 20-288 76,1±9,10 18-195 More than 61 /56 79,4±9,62 22-184 68,0±10,2 16-202 Hepatitis С 20-30 85,0±9,64 28-330 89,6±9,10 13-268 31-60 / 31-55 108,8±8,91 29-346 96,8±6,44 14-188 More than 61 /56 90,0±7,84 21-152 95,2±8,86 17-210 * Note: the normal ALT level is equal in men – up to 45 Un/l, in women-up to 34 Un/l. The enhanced cytological process in the liver was characteristic of all groups of patients with hepatitis C, especially men of the middle and older groups and women of all age groups. These changes were close in value and on average exceeded the norm by 2.4-2.6 times, indicating that they had negative changes in internal organs, including the kidneys, liver, heart and skeletal muscles (see table III). ALT output from the liver had a negative effect on these organs of the body in men and women. The activity of this enzyme in all groups infected with hepatitis B exceeded the norm, especially in women of the younger and middle age groups it exceeded on average 2.5 times, and in men of the younger group - 2 times. It is known that when a person is infected with viral hepatitis, ALT concentration in serum is significantly higher than AST concentration by almost 2-2.5 times. On average, the normal concentration of AST in women reaches 31 Un/l, in men it is higher – up to 37 Un/l. In men and women infected with hepatitis B, the concentration of the AST enzyme in the blood serum was increased against the norm (table IV). Higher concentration of the AST enzyme was in women of the younger and middle-aged groups - almost 2 times higher than their values in the older group. The values of AST concentration in men of the older and middle groups were lower by 25% and 29% against women of the same age. In men and women with hepatitis C, the values of AST concentration in the blood serum exceeded the norm, but in men of all groups, compared with women's groups, they were the most significant. Concentration of AST in men of the younger group exceeded the norm by almost 3 times, and in older groups by 2.6 and 2.2 times, indicating early stages of VHC infection, usually occurring without pronounced clinical symptoms. The most pronounced individual values of serum AST concentrations were observed in men and women infected 3 BIO Web of Conferences 30, 04009 (2021) https://doi.org/10.1051/bioconf/20213004009 ILS 2020

with hepatitis C in all age groups. They pointed to the manifestation of pronounced negative shifts in functions not only in the liver, but also in other vital organs. The concentration of β-lipoproteins in the blood serum in all groups of men and women infected with VHB was reduced against the norm (table V). Table 4. Serum AST concentration in men and women infected with Hepatitis B Age male/female АSТ, Un/l (M±m, min-max) Men Women Hepatitis B 20-30 78,2±8,84 25-202 97,8±9,02 17-278 31-60 / 31-55 70,8±9,21 17-198 90,6±10,36 23-198 More than 61 /56 53,8±7,24 16-172 51,2±9,32 18-192 Hepatitis С 20-30 117,6±10,42 23-356 76,0±8,31 22-152 31-60 / 31-55 97,4±7,42 16-358 80,7±4,66 22-189 More than 61 /56 80,4±6,20 20-148 74,1±6,22 23-220 * Note: the normal concentration of AST in the blood serum in men is up to 37 U/l, in women up to 31 U/l The concentration of β-lipoproteins in the blood serum corresponded to the norm, in other groups of men and women it was reduced against the norm by an average of 1.5 times, indicating a violation of lipid metabolism only in the younger group of men infected with HCV due to the disorders of liver hepatocyte functions. Table 5. Serum concentration of Β-Lipoproteins in men and women Infected with Hepatitis В Age male/female β-lipoproteins, % (M±m, min-max) Men Women Hepatitis B 20-30 48,0±2,80 22-74 45,0±3,77 26-59 31-60 / 31-55 40,8±2,22 27-60 47,2±3,13 27-94 More than 61 /56 50,1±4,59 28-100 43,8±3,38 33-58 Hepatitis С 20-30 64,0±11,4 23-238 49,2±3,57 31-69 31-60 / 31-55 43,0±3,12 22-81 48,1±2,66 23-71 More than 61 /56 52,0±3,04 29-59 47,6±4,22 25-94 * Note: normal blood serum lipoproteins are 65-75% Conducting a thymol test (Maclagan test) is aimed at earlier detection of infection with viral hepatitis B and C. The negative value of the intake corresponds to its norm and is 0-4 units. M. value of the intake is higher than 4 units. It is regarded as a positive test that indicates a violation of the protein composition in the blood serum, in particular associated with viral hepatitis. According to the average values, a positive thymol test was detected in all age groups of men and women with hepatitis B, but in the middle-aged groups its values were higher and indicated violations of protein metabolism in the body due to pathological changes under the influence of viral load in liver hepatocytes (table VI). According to the average values a positive thymol test was found in all age groups of men and women with hepatitis C and its values were most pronounced in the middle-aged group of men and women; they were slightly higher in value in all age groups of men with hepatitis B. In all groups of women with hepatitis C the values of the thymol test were more significant, indicating a marked violation of protein metabolism associated with VH. Table 6. Indicators of thymol test in blood serum in men and women with hepatitis B or С Age male/female Thymol test, un. (M±m, min-max) Men Women Hepatitis B 20-30 4,6±0,46 1,2-14 4,2±0,29 1,8-7,0 31-60 / 31-55 6,6±0,62 1,3-19 5,1±0,30 2,1-12,4 More than 61 /56 4,5±0,41 2,1-11 4,4±0,30 2,6-7,1 Hepatitis С 20-30 4,4±0,39 2,1-16,8 5,2±0,52 1,7-12,2 31-60 / 31-55 4,2±0,37 1,3-17,2 5,1±0,54 1,5-19,8 More than 61 /56 4,0±0,22 1,6-4,8 4,6±0,38 2,0-14,1 Taking into account that the liver plays a leading role in protein metabolism in the body, pathological changes in hepatocytes when infected with hepatitis provides the removal of a large number of albumins from the body and an increase in serum γ--globulins. The positive value of the test persists for a long time after the recovering from hepatitis – from 6 months to a year, so it allows to evaluate the process of restoring the functional state of the liver. 4 Conclusion High serum levels of bilirubin in all groups of men and women with viral hepatitis caused damage to the functions of hepatocytes, especially in men with hepatitis B and women with hepatitis C. High concentration and activity of ALT aminotransferase in blood serum indicated enhanced cytological processes in liver hepatocytes in all groups of men and women with viral VHB and HC, especially pronounced in men of the younger group, women of the younger and middle-aged groups. The concentration of AST aminotransferases exceeded the norm in all groups of men and women and was the most pronounced in infected with HC, indicating that their functions of the liver, the heart, kidneys, and muscles were damaged. In men of the younger group with HC, the concentration of aminotransferases exceeded the norm by almost 3 times, and in older men by 2.6 and 2.2 times, corresponding to earlier stages of infection of the body. 4 BIO Web of Conferences 30, 04009 (2021) https://doi.org/10.1051/bioconf/20213004009 ILS 2020

A positive thymol test showed a shift in the protein balance in all age groups of men and women with viral hepatitis towards a pathological increase in the synthesis of γ -globulins in liver hepatocytes and the removal of albumins from the body. The concentration of β-lipoproteins in the blood serum only in the younger group of men infected with hepatitis C corresponded to the norm, in the other groups infected with VHB or HC hepatitis, it on average exceeded the norm by 1.5 times, indicating a violation of lipid metabolism in liver hepatocytes. References 1. V.A. Isakov, V.V. Pokrovsky, “Russia is on the verge of a hepatitis B epidemic,” Problems and prospects of the global fight against the virus, Pediatrician's Practice, (2006) 2. I.V. Mayev, T.E. Polunina, E.V. Polunina, Clinical medicine, 11, pp. 12-18 (2009) 3. V.G. Akimkin, S.V. Skvortsov, A.A. Enaleeva [et al.], World of viral hepatitis, 7-8, pp. 5-6 (2000) 4. S.Yu. Karpov, P.E. Krel, Clinical Medicine, 31, pp. 14-19 (2005) 5. Z.G. Aprosina, Chronic viral hepatitis. Moscow: Meditsina, (2002) 6. M. Amjad, V. Mudgal, M. Faisal, Laboratory medicine, 44, pp. 292-299 (2013) 7. N.D. Yushchuk, E.A. Klimova, O.O. Znoiko [et al.], Russian journal of gastroenterology, Hepatology and Coloproctology, pp. 23-26 (2010) 8. A.N. Burkov, T.V. Blinova, A.N. Mayansky, G.M. Lapshina, Viral hepatitis and their diagnostics in immunoassay systems: Methodological recommendations, N. Novgorod, (1998) 9. N.V. Dunaeva, E.V. Esaulenko, Questions of Virology, 51, 10-14 (2006) 10. V.K. Pimenov., A.Yu. Afanasiev., A.A. Kolobov [et al.], Questions of Virology, 6, 44-47 (2000) 11. A.Yu. Afanasiev, V.K. Pimenov, S.V. Zubov [et al.], Phase of hepatitis C flow according to the data of dynamic control of the spectrum of antibodies to the hepatitis C virus. Hepatitis B, C, D and G-problems of studying diagnosis, treatment and prevention. Moscow, (1997) 12. A.V. Ivanov, A.O. Kochetkov, Advances in biological chemistry, 45, 37-86 (2005) 13. E.L.Krasavtsev, S.V. Zhavoronok, V.M. Mitsura, A.P. Demchilo, Microbiology, 2, pp. 57-61 (2006) 14. A.F. Bluger, Structure and function of the liver in epidemic hepatitis. SYNTEG, (2017) 5 BIO Web of Conferences 30, 04009 (2021) https://doi.org/10.1051/bioconf/20213004009 ILS 2020

Seasonal growth of sprouts in introduced three plants under extra arid conditions of Southern Uzbekistan Lutfullo Yoziev*, Shohista Samatova, and Muhayyo Buronova Karshi state university, Karshi, Uzbekistan Abstract. The article presents the results of the study of the growth dynamics of the sprouts of 52 woody plants, representing 19 genera from 5 families, of different geographical origin. In the conditions of Southern Uzbekistan, the growth of introduced species takes place in early, more favorable spring terms and is characterized by higher intensity. With the onset of the extreme period (early June), the vast majority of species stop growing. Most species studied have a short growth period. The strategy of adaptation of introduced plants is expressed in reduction of growth period and increase of its rate. 1 Introduction Arbor flora of Southern Uzbekistan is not distinguished by the rich in species diversity and the high decorative properties of plants. It is possible to enrich the green assortment only by introducing new decorative plants. Surveys have shown that 215 species, 4 forms and 5 hybrids grow in arboretums, parks and urban plantations - a total of 224 species of introduced trees, representing 113 genera from 52 families. The gymnosperms are represented by 18 species and 2 decorative forms belonging to 12 species from 6 families. The angiosperms are represented by 197 species, 2 forms and 5 hybrids. Introduced species come from 8 floristic regions of the globe. The main mass is from the East Asian region, then from the Circumboreal, Iran-Turan and Atlantic-North American regions [1]. The purpose of the works - to reveal the degree of adaptation of plants to the new extreme conditions of the external environment of Southern Uzbekistan on the basis of long term researches on the growth of introduced species and determine the most promising centers for introducing of woods exotics. 2 Experimental In the research 52 species of wood plants introduced to South Uzbekistan, having different origins and taxonomy. The territory of Southern Uzbekistan covers Kashkadarya and Surkhandarya regions, occupying the south-western part of the Pamir-Alay mountain system and the lowland Karshinsky steppe. The western majority of the Kashkadarya region is occupied by extensive plain spaces. To the east and northeast the territory gradually increases and passes into foothills and then - into mountain areas. Surkhandarya region occupies the southernmost position within Uzbekistan, touching along its entire eastern border with Tajikistan. In the southern part, closer to Amudarya, on the banks of Surkhandarya there are significant sandy areas [2]. The growing period in the region lasts 290-300 days. The annual amount of precipitation is the least in the southern lowland areas and reaches 130 - 250 mm. During the height of summer, temperatures can reach very high limits. Temperature highs exceed 40-42°C each year. In lowland and pre-mountain parts the absolute maximum temperature exceeds 46-48°C, reaching in Termez and Shirabad almost 50°C - the record value for Uzbekistan [3]. On the territory of the region there are two groups of soil regions: a belt of grey earth and a zone of desert soils. In the alluvial conditions of this region there are developed soils of the type of grey, represented by two subtypes - typical and light grey soils, in the second - types of desert soils: grey-brown, desert, sandy, superstition and taker soils with two subtypes - taker soils and takers [4]. Dynamics of sprout growth were studied according to the method of A.A. Molchanov, V.V. Smirnov [5], phonological observations – according to on L.C. Plotnikova [6], literature data on the origin of species are given according to "Trees and shrubs of the USSR" [7], plant names are specified according to S. K. Cherepanov's bulletin [8]. Variation statistics uses computer programs SNEDECOR [9]. 3 Results and discussion For studying the growth of lateral sprouts, the most richly represented genera were chosen first of all. The features of seasonal growth of four species of Salix - S. daphnoides, S. alba, S. babylonica, S. longifolia and four species of Populus - P. bolleana, P. ariana, P. nigra, P. alba (Table I) were studied. The earliest start of growth is species for Salix babylonica - from March 5, S. © The Authors, published by EDP Sciences. This is an open access article distributed under the terms of the Creative Commons Attribution License 4.0 (http://creativecommons.org/licenses/by/4.0/). BIO Web of Conferences 30, 04010 (2021) https://doi.org/10.1051/bioconf/20213004010 ILS 2020 * Corresponding author: [email protected]

alba begins growing in mid-March, the rest of the species - in late March, and Populus alba – at the begin of April. Growth cessation takes place at different times. The four species of named genera stop growing in May, the two - in June, the other two species - in July. For the species finishing growth in May, the main growth of sprouts occurs in April (50.2-62.3), for the species with a long growth period - in May. The latter tend to produce more gain and feature smooth growth during the growing period. The growth in short-growth species is 21.4-27.8 cm, while in long-growth species it is several times higher. The duration of growth and the magnitude of current growth in members of the type Populus are very close to each other, while in Salix species these figures are very different. The example of conifer introducents shows that the duration of growth of sprouts is mainly a generic feature, whereas the intensity of growth is feature a species [10]. The data we have obtained suggest that in deciduous, this pattern persists in not all the genera. In the conditions of Southern Uzbekistan, the most introduced species of Quercus begin to grow in late March, some in early April. Growth cessation and sprout laying occurs in different species at different times. Q. Mongolica is the first to complete the growth - at the end of April, the rest of the species (except species of Caucasian origin) cease in the first decade of May (Table I). In all species, the main growth sprouts occurs in April (55.4-98.4). Growth graph is characterized by singlepeakscrew curves. The species we have studied come from different climatic areas, but they are not dramatically different in growth timing, duration, rate of current growth of sprouts. At the same time, the smallest growth gain (and shorter growth duration) was observed in the Mediterranean species Q. suber, the largest one - in the Crimean and Caucasus species (Q. castaneifolia, Q. pubescens). Of all species in the genus Quercus, secondary growth gain is seen only in Q. castaneifolia. The first growth gain is completed at the end of April and during this period 86.1% of the annual gain is generated. In mid-June, plants start again growing, which lasts for an average of 2 weeks.At the same time, we did not observe the multiple growth of Q. robur, noted by other authors: in Tashkent [11] and in Minsk [12]. In general, the species of the genus Quercus in our conditions are characterized by a short period of growth of sprouts (33-38 days). Unlike previous species, representatives of Fagaceae vary widely among themselves in both of duration and rates of growth and the magnitude of sprout growth gain. Growth of most species from Fabaceae family begins at the end of March, and of the rest - in the first decade of April (Table 2). The cessation of growth also occurs at various times. The first to complete the growth is Gymnocladus dioicus (April 20), then - Claudrastis lutea, Caesalpinia gilliesii and Laburnum anagyroides - in the first decade of May. In the second decade of May, the growth of Cercis canadensis and Genista tincloria is stopped, in the third decade - Cercis siliquastrum, Amorpha fruticosa and Caragana turkestanica. Robinia pseudoacacia, Gleditsia triacanthos, and Sophora japonica finish growing in early June, Wisteria species in early July, Albizia julibrissin in late July, capturing the hottest period of vegetation. The most intense growth in species with a short growth period occurs in April, with an extended growth period in May. Having a long growth period, Albizia julibrissin and Wistrea sinensis differ in its smooth course. The average annual growth varies from 11.2 to 116 cm. Fabaceae are characterized by intense growth of yearlong sprouts. In Acer species, the growth of sprouts in our conditions begins mainly in the II-III decades of March. Rising temperatures and heavy rainfall in April contribute to an intense growth of sprouts. The cessation of growth in A. negundo occurs in late April, in A. campestre, A. ginnala, A. ukurunduense, and A. saccharinum - in the first decade of May, in A. truncatum, and A. semenovii - in the third decade of May (Table III). In the conditions of the Republic of Komi, four species of maple (Acer negundo, A. tataricum, A. ginnala and A. platanoides) also showed an accelerated growth and development rate [13]. The main growth in sprouts (52.4-86.4%) in all species occurs in April. Current growth ranges from 6.75 cm (A. saccharium) to 34.8 cm (A. velutinum). The rest of the species occupy an intermediate position. Growth in all species is characterized by a single-peat curve. The exception is A. velutinum, which is of subtropical origin. This species has two increases in growth (Table III). This phenomenon is observed by other authors in other circumstances. G.N. Gordeeva notes that in the conditions of Hakassia the beginning of summer is dry (June - July), at the end of July - the beginning of August the rains begin, and many plants of arboretum start apical budding a new and begin growth [14]. Meanwhile, in the conditions of Southern Uzbekistan, the studied Acer species differ in a relatively short growth period (44-66 days), timed mainly in the spring period, when the humidity of the air and soil is quite high. Of the Fraxinus species (F. excelsior and F. angustifolia) are the first to begin growth - in the 2nd decade of March. In the third decade of March, growth begins in F. rhynchophylla, F. americana, F. pennsylvanica, and F. sogdiana. Later then all (in early April) F.velutina begins to grow (Table IV). Stopping growth occurs almost in the same sequence as starting growth - species that started growth early tend to finish it earlier. The exception is the drought-tolerant species F. sogdiana, which differs from other species in a prolonged period of growth. 2 BIO Web of Conferences 30, 04010 (2021) https://doi.org/10.1051/bioconf/20213004010 ILS 2020

Species Geographical origins Growth of sprouts Gain beginn ing end long, days monthly, % Annual, III IV V VI VII cm Salix daphnoides Europe 15.03 20.07 128 12.2 23.0 36.9 19.2 8.7 67.5±2.41 S. alba Europe 16.03 05.06 82 18.5 36.6 42.2 2.7 --- 45.5±1.46 S. babylonica East Asia 05.03 03.07 148 15.8 25.4 21.2 20.1 17.3 74.6±1.59 S. longifolia North America 25.03 15.05 51 7.2 62.3 30.5 --- --- 27.8±1.16 Populous bolleana Central Asia 25.03 30.05 66 5.3 51.6 43.1 --- --- 23.8±1.22 P. areana Central Asia 25.03 30.05 66 4.8 53.6 41.6 --- --- 21.4±1.12 P. nigra Europe 30.03 30.05 62 1.3 50.2 48.5 --- --- 23.7±1.33 P. alba Central Asia 05.04 05.06 62 --- 44.0 52.5 3.5 --- 22.8±1.14 Quercus suber Mediterranean 03.04 05.05 33 --- 97.7 2.3 --- --- 10.3±0.97 Q. robur Europe 31.03 05.05 36 1.0 98.4 0.6 --- --- 18.9±2.82 Q.r. f. fastigiata Europe 02.04 05.05 34 --- 93.9 6.1 --- --- 20.5±1.15 Q. castaneifolia Crimea, Caucasus 20.03 30.06 30+15 15.0 71.1 --- 13.9 --- 20.1±2.81 Q. petraea Europe 29.03 05.05 38 5.4 91.4 3.2 --- --- 21.0±1.38 Q. pubescens Crimea, Caucasus 01.04 15.05 45 --- 75.5 24.5 --- --- 22.0±1.67 Q. mongolica Siberia 21.03 25.04 36 20.8 79.2 --- --- --- 25.2±3.01 Q. macrocarpa North America 30.03 05.05 37 2.2 96.3 1.5 --- --- 18.9±1.46 In all Fraxinus species, the main increase in sprouts is observed in April. Their growth on the chart is characterized by a single-peak curve. In general, Fraxinus species have a short period of sprout growth (35-55 days) and the largest annual increase. Among Ligustrum species, L. lucidum stands out, beginning growth last and ending it first. Consequently, the duration of the sprout growth period in this species is shortest (42 days). This species naturally grows in conditions where there is heavy rainfall during the summer period (Central China). In our conditions, the short period of sprout growth is due to apparently hot and dry weather. The remaining Ligustrum species are characterized by a long growth period and differ by a twoturn curve. The main growth in the species studied of this genus occurs in April. Thus, these data suggest that the nature of the growth of sprouts in tree plants, its intensity and duration are significantly determined by the belonging of the species. Species of one genus have close growth rates. In the conditions of Southern Uzbekistan in most species intensive growth is timed mainly to the spring period, when the humidity of the air and soil is quite high. Dry and hot weather, beginning usually in the second half of May, contributes to the completion of growth in many species. In hot conditions, the growth of sprouts in plants is intense. The most intense growth of sprouts in species by a short period of growth is observed in April, with an elongated one in May. 3.1 Features of the growth of introducents depending on their origin. The characteristics of the growth rhythm, its intensity and period duration are determined by the ecologicalbiological properties of the species due to their origin and geographical distribution. It is advisable to compare the features of the growth of sprouts in the genera represented by the largest number of species. The growth data of the most fully represented genera - Salix, Populus, Quercus, Acer, Fraxinus are given in tables 1-4. As a result, it was found that the longest period of growth have species from Crimea and the Caucasus. Thus, Pinus eldarica (164 days) and Taxus baccata (152 days), originating from the area, grow longest from conifers. Duration of growth period of sprouts of other species of conifers varies within 34-95 days. Among Quercus species, the long growth period is also characterized by species from Crimea and the Caucasus - Q. castaneifolia and Q. pubescens (Table 1). The same pattern is observed in Pyrus species: the growth period duration of P. hyrcana and P. elaeagrifolia is 64 and 46 days, respectively, while in the European species P. communis is 31 days. There are 16 of family Fabaceae belonging to 13 species that have the longest growth period in Albizia julibrissin - 123 days (Table 2). The genus Acer is represented by one species of Caucasian origin A. velutinum, also having the longest growth period compared to the rest of the species (Table 3). Table 1. Growth of lateral sprouts of members of family Salicaceae Lindl. and of family Fagaceae A.Br. 3 BIO Web of Conferences 30, 04010 (2021) https://doi.org/10.1051/bioconf/20213004010 ILS 2020

Among North American genera species, natural area of which is located in the southern areas (Gleditsia triacanthos), where the vegetative period lasts longer than of northern species, they grow longer time. The same pattern is observed in species of European origin. Species from Siberia are characterized by an early onset and a short period of growth. Thus, Acer ginnala, A. ukurunduense, Quercus mongolica start growing well ahead of other species of the respective genera and feature a short growth period. This pattern has also been identified in other conditions [13]. According to L.G. Martynov [13], for example, Far Eastern species start growing two or three days earlier than European species. The end of the growth of sprouts in most species takes place at the end of June - the beginning of July. Duration of sprouts growth is 40-65 days. The next place after the Caucasus species by the length of the sprout growth period is occupied by species from East Asia. Thus, of the 3 species of Morus species, East Asian species are characterized by a long growth period: M. alba - 103 days, M. nigra - 90, while M. rubra (North America) - 57 days. From 16 species of family Fabaceae 's longest growth period, following Albizia julibrissin, is characterized by Wisteria sinensis; among Salix is S. babylonica (Table I). Of the 10 species of genus, Acer is second after A.velutinum. Among other species, there are also species with prolonged growth, especially thermopiles and relatively drought-tolerant species. Thus, Melia azedarach, M. toosendan grow 102-111 days. In Mediterranean species - Quercus suber, Buxus sempervirens and Elaeagnus angustifolia - there was a short period of growth (Table 1). In local species, the longest period of growth was observed in droughtresistant species growing in floodplains and foothills. For Ulmus pumila pasteur it lasts 138 days, Fraxinus sogdiana - 55. In this regard, they are at the top of the other species of the genus we have studied. Thus, the results of our research confirm the views of other authors that the characteristics of the growth of wood plants is largely determined by their origin and geographical distribution. The longest period of growth is distinguished by the species of Crimea and Caucasus (especially Gircan species), then East Asian (Central Chinese, North Chinese species) origin. Plants from Siberia and Mediterranean species have a short growth period. Consequently, in the new conditions, species originating from areas with close climatic indicators grow longer. 3.2 Duration of the sprout growth period In the remaining 120 species, the length of the sprout growth period was determined by sprouting term in the early spring and laying them on one-year sprouts. All studied ones (200 species), according to the duration of the growth period of sprouts, are divided into 4 groups (Fig. 1). Fig 1. Distribution of Southern Uzbekistan 's introducents by growth duration I. Species with a very short sprout growth period of 40 days - 33 species (16%). This includes almost all species of Picea, Juglans, Quercus, Celtis, Sorbus, Tilia, Diospyros; from family Fabaceae - Gymnocladus dioicus, Cladrastis lutea and Caesalpinia gilliesii; as such Rhus typhina, Cotinus coggygria, Aesculus hippocastanum, Fraxinus americana and F. pennsylvanica. II. Species with a short period of sprout growth - 41- 70 days. This includes 112 species (56%). It is the largest group including the vast majority of species of large genera - Cupressus, Populus, Ribes, Malus, Pyrus, Crataegus, Spiraea, Acer, Fraxinus; as well as the main representatives of this. Fabaceae of the individual species are included a number of representatives like Maclura aurantiaca, Eucommia ulmoides, Mespilus germanica, Laurus nobilis. III. Species with average sprout growth period (71- 100 days). This group combines 37 species (18.5%) and is represented by Salix, Morus, Amelancher, Pyracanta, Chanomeles, Berberis, Platanus genera; as well as individual species - Sophora japanica, Gleditsia triacanthos, Platycladus orientalis, Taxodium distichum, Juniperus virginiana and other. IV. Species with extended growth period - more than 100 days. This includes 18 species (9%). Members of this group are mostly subtropical trees, shrubs and lians. So, the predominant majority of studied species (72%) in Southern Uzbekistan conditions have a very short (up to 40 days) or short (41-70 days) period of sprout growth. 4 Conclusion Plant growth is a very reliable criterion for species adaptation, reflecting the bioecological features of species due to their taxonomy, origin, evolutionary history and climatic conditions of the introduced species. An abundance of light and heat, the extended growing period ensures the rapid growth of wood introducents. The strategy of adaptation of introducents in our conditions is expressed in reduction of the period of growth and increase of its rate. In the conditions of Southern Uzbekistan, the growth of sprouts of introducent takes place in early, more favorable spring terms and is characterized by higher 0 10 20 30 40 50 60 up to 40 41-70 71-100 over 100 Growth period duration, days 4 BIO Web of Conferences 30, 04010 (2021) https://doi.org/10.1051/bioconf/20213004010 ILS 2020

intensity. With the onset of the extreme period (early June), the vast majority of species stop sprout growing. Species from the Ancient Mediterranean region, the climatic conditions of which are close to those of Southern Uzbekistan, feel better and adapt easier. The same species have the longest growth. These are species from Crimea, Caucasus, East Asia and southern parts of North America. The main limiting factor of the period of sprout growth in our conditions is high temperature and low humidity. Species living in wet conditions and in the boreal zone in our conditions give less growth gain, and their growth processes stop much earlier. References 1. L.H. Yoziev, Experience of introduction of wood plants to South Uzbekistan, Tashkent: Fan (2001) 2. Atlas Uzbek SSR. Geomorphologic card, M.- Tashkent: GUGK Office at SM of the USSR pp. 58- 59 (1982) 3. Agro-climatic bulletin, Tashkent: SARNIGMI publishing house (1990-1996) 4. S.A. Azimbayev, Soils of the southern part of Uzbekistan and their reclamation state, Tashkent: Fan (1991). 5. A.A. Molchanov, V.V. Smirnov, Method of studying the growth of wood plants, Moscow: Science, (1967) 6. L.C. Plotnikova, Method of phonological observations in botanical gardens SSR, Moscow, pp. 40-46 (1972) 7. Trees and shrubs of the USSR, T. I-VI. M.-L., Academy of Sciences of the USSR (1949-1962) 8. S. K Cherepanov, Vascular Plants of Russia and Neighboring States, Saint Petersburg: “Peace and Family-95” (1995) 9. O.D. Sorokin, Applied Statistics on Computer, Krasnoobsk: State Department of RPO SO RASKHN (2004) 10. N.V. Shkutko, “Biological bases of introduction of coniferous plants in Belarus,” Avtoref. yew. doctor of biological sciences, Moscow (1984) 11. A.A. Mavzhudov, Dendrology of Uzbekistan. T. XIII, Tashkent: Fan, pp. 3-91 (1983) 12. T.F. Deryugina, Seasonal growth of hardwood rocks, Minsk: Science and Technology (1984) 13. L.G. Martynov, “Introduction of maple species in the Republic of Komi,” News of Komi Scientific Center of Uro RAS, 32, pp. 25-32 (2017) 14. G.N. Gordeeva, “Seasonal rhythm of development of Tilia L. species in the arboretum of Hakassia,” Mater. report XVIII International Scientific and Practical Conference, Problems of botany of Southern Siberia and Mongolia, Barnaul, pp. 575-579 (2019) Species Geographical origins Growth of sprouts Gain beginning end long, days monthly, % III IV V VI VII Annual, cm Albizia julibrissin Crimea, Caucasus 30.03 30.07 123 1.2 25.0 27.5 24.0 22.3 43.0±1.71 Cercis canadensis North America 01.04 20.05 50 --- 61.8 38.2 --- --- 11.2±0.62 C. siliquastrum Mediterranean 02.04 30.05 59 --- 54.5 45.5 --- --- 33.0±1.20 Caesalpinia gilliesii South America 10.04 10.05 31 --- 71.7 28.3 --- --- 26.5±1.02 Gleditsia triacanthos North America 24.03 05.06 74 5.2 44.3 46.0 4.5 --- 58.3±2.10 G. caspica Crimea, Caucasus 31.04 20.07 112 --- 26.5 29.0 23.5 21.0 38.5±1.15 Gymnocladus dioicus North America 25.03 20.04 27 24.0 76.0 --- --- --- 43.3±1.69 Sophora japonica East Asia 29.03 10.06 74 1.7 43.9 48.3 6.1 --- 51.6±1.92 Cladrastis lutea North America 05.04 05.05 31 --- 86.2 13.8 --- --- 32.3±1.10 Genista tincloria Europe 04.04 16.05 43 --- 62.5 37.5 --- --- 25.5±1.44 Laburnum anagyroides Europe 25.03 10.05 47 16.8 65.0 18.2 --- --- 40.8±1.93 Amorpha fruticosa North America 10.04 30.05 51 --- 42.5 57.5 --- --- 29.5±1.56 Wisteria sinensis East Asia 30.03 07.07 100 1.3 30.2 34.4 29.0 5.1 116.0±6.01 W. floribunda East Asia 10.04 05.07 87 1.0 29.5 35.0 30.5 4.0 107.0±5.93 Robinia pseudoacacia North America 08.04 05.06 54 --- 30.1 52.5 7.4 --- 32.1±1.59 Caragana turkestanica Central Asia 30.03 30.05 62 1.0 52.2 46.8 --- --- 26.4±1.17 Table 2. Growth of lateral sprouts of members of family Fabaceae Lindl. 5 BIO Web of Conferences 30, 04010 (2021) https://doi.org/10.1051/bioconf/20213004010 ILS 2020

Species Geographical origins Growth of sprouts Gain beginning end long, days monthly, % Annual, III V VI cm Acer truncatum East Asia 30.03 31.05 63 2.1 52.4 45.5 --- 21.5±1.40 A. campestre Europe 28.03 10.05 44 5.5 86.4 8.1 --- 20.2±1.26 A. franchetii East Asia 25.03 15.05 52 7.3 60.2 32.5 --- 22.9±1.41 A velutinum Crimea, Caucasus 22.03 15.06 48+18=66 11.3 59.2 9.5 20.3 34.8±2.34 A. semenovii Central Asia 01.04 27.05 57 --- 61.7 38.3 --- 17.1±1.03 A. ginnala Far East 15.03 11.05 58 39.7 53.5 6.8 --- 19.2±0.96 A. ukurunduense Far East 17.03 08.05 53 32.5 62.0 5.5 --- 27.2±1.59 A. nigrum North America 16.03 08.05 54 15.0 70.4 14.6 19.4±1.20 A. saccharinum North America 21.03 10.05 51 19.5 71.6 8.9 --- 6.75±0.49 A. negundo North America 18.03 30.04 44 32.5 67.5 --- --- 26.3±2.78 Species Geographical origins Growth of sprouts Gain beginning end long, days monthly, % Annual, III V VI cm Fraxinus rhynchophylla Far East 21.03 30.04 41 24.3 75.7 --- --- 23.0±1.69 F. americana North America 27.03 05.05 40 10.5 81.0 --- --- 26.5±1.94 F. pennsylvanica North America 27.03 30.04 35 14.0 86.0 --- --- 21.3±1.78 F. velutina North America 05.04 15.05 41 --- 70.3 29.7 --- 27.5±1.91 F. excelsior Europe 13.03 30.04 49 38.2 61.8 --- --- 32.0±2.70 F. angustifolia Crimea, Caucasus 15.03 30.04 47 31.5 68.5 --- --- 24.2±1.73 F. sogdiana Central Asia 27.03 20.05 55 7.3 65.0 27.7 --- 42.4±3.92 Ligustrum lucidum Far East 04.04 15.05 42 --- 74.0 26.0 --- 20.5±2.14 L. ibota Far East 10.03 05.06 87 22.5 36.0 38.3 3.2 34.0±2.62 L. vulgare Europe 15.03 15.06 93 16.4 43.6 37.5 11.5 42.3±3.03 Table 4. Growth of lateral sprouts of members of family Oleaceae Lindl. 6 BIO Web of Conferences 30, 04010 (2021) https://doi.org/10.1051/bioconf/20213004010 ILS 2020

Effect of pre-sowing treatment of sunflower seeds on plant height and photosynthetic activity of hybrids F1 Borey And F1 Dariy under the conditions of the southwestern part of the Central Black Soil Region Nadejda Kotsareva1 , and Elena Kovalenko2 1 Department of Biology, Belgorod State National Research University, Belgorod, Russia 2 Belgorod State Agricultural University named after V.Gorin Abstract. The results of the research of the effect of seeds pre-sowing treatment with a complex of preparations, including protectant, microelements and growth regulators on economic and biological characteristics and properties of sunflower hybrids F1 Borey and F1 Dariy under conditions of the southwestern part of the Central Black Soil region are presented. The effective pre-sowing treatment scheme for seeds of sunflowers hybrids F1 Borey and F1 Dariy was determined, which allows us to obtain a seed yield up to 29.03 c / ha (increasing 6.6 c / ha) with a profitability level of 156.4% (increasing 39.6%). 1 Introduction Stable price, sound liquidity made sunflower cultivation an attractive one. In the Belgorod region the average sunflower sowing area is 7% of all seeding-downs of this crop in the Russian Federation. The average yield in the Belgorod region is 21.2 c / ha. To obtain high and sustainable sunflower yields pre-sowing seed treatment is one of the important backgrounds for profitable production. According to many researchers [1, 2, 3] the formation and deployment of one leaf takes about 3 days on average, which means that for 35 leaves formation the vegetation period is 105 days. The development of a sunflower plant comes to generative phase only after the formation on the cone maximum number of leaves for a given type. Therefore, in selection process mid- and fastgrowing cultivars one takes into account the number of leaves on a sunflower plant [4, 5]. In sunflower the role of each leaf canopies is different. Leaves from 12-15th to 23-25th leaves are distinguished by the highest photosynthetic activity, minimal water content and intensive assimilants outflow and play an important role in fat biocenosis in seeds [6, 7]. Researchers of the All-Union Scientific Research Institute of Oilseeds named after V.S. Pustovoit (AUSRIO) has proved that decreasing of five upper leaves size, the development of which stops before critical blossom begins, leads to increasing of droughtresistance and overcrowding tolerance [8, 10]. 2 Experimental The research was conducted at the Belgorod State Agricultural University named after V. Gorin during 2012-2014. The soil of the experimental ground plot is typical, medium-thick, heavy loamy black soils on loesslike clay loam soils. The goal of the research was to study the effect of pre-sowing treatment of sunflower seeds on plants height and photosynthetic activity of hybrids F1 Borey and F1 Dariy in the conditions of the southwestern part of the Central Black Soil region. The following tasks were set and solved: one has studied the effect of pre-sowing treatment with various solution of sunflower seeds on growth processes (plant height, photosynthetic activity), on economic and biological characteristics and immunological parameters of the hybrids F1 Borey and F1 Dariy in the southwestern part of the Central Black Soil region. The experiment is two-factor: factor A is sunflower hybrids F1 Borey and F1 Dariy, factor B is treatment elements according to the scheme: 1. Without treatment - control 2. Vincite 2 l/t 3. Maxim 5 l/t 4. Maxim 5 l/t + Hydromix, 200 g/t 5. Maxim 5 l/t + radifarm, 0.2 l/t 6. Maxim 5 l/t + fertigrain start, 1 l/t 7. Maxim 5 l/t + albit, 0.35 l/t 8. Maxim 5 l/t + vympel (humate complex), 0.3 l/t 9. Maxim 5 l/t + hydromix, 200 g/t + radifarm, 0.2 l/t 10.Maxim 5 l/t + hydromix, 200 g/t + fertigrain start, 1 l/t 11.Maxim 5 l/t + hydromix, 200 g/t + albit, 0.35 l/t © The Authors, published by EDP Sciences. This is an open access article distributed under the terms of the Creative Commons Attribution License 4.0 (http://creativecommons.org/licenses/by/4.0/). BIO Web of Conferences 30, 04011 (2021) https://doi.org/10.1051/bioconf/20213004011 ILS 2020

12.Maxim 5 l/t t + hydromix, 200 g/t + vympel (humate complex), 0.3 l/t. The total area of the registration plot is 25 m2 , the total sowing area is 1800 m2 with triplicity tier. the sowing time of sunflower seeds is the third decade of april. the registration plots allocation in the experiment is randomized [3]. The predecessor is barley. fertilizers were not applied under the main treatment. sunflower dosing with complex fertilizer (azophoska at a dose of 100 kg d.m. / ha) was done in a phase of 2-3 leaves. to control weeds the lontrel-300 herbicide at a dose of 1 l/ha was used. The following actions and observations were carried out in the experiment: 1. Phenological observations, counts and measurements - according to the method of state strain test of agricultural crops (1985). 2. The leaf-area duration of the plant - according to B.D. Dospehov [3]. 3. Statistical analysis of experimental data - by the method of variance analysis of two-factor field experience on the ibm personal computer - intel pentium of the department of plant growing, selection and horticulture at the belgorod state agricultural university named after V. Gorin. 3 Results and discussion During 3 year of the hybrids research on average, the length of sunflower stalk in the formation phase of two pairs of real leaves was 4-6 cm, in the phases of anthodium formation it was - 50-65 cm, in blossom phase it was 140-160 cm. in plants of F1 Borey hybrid one has noted a significant effect of seeds pre-sowing treatment on plants height and, therefore, on photosynthetic activity and yield of the crop (table 1). Pre-sowing treatment of sunflower seeds F1 Borey significantly contributed to the acceleration of plant growth processes. the height of sunflower plants in the experiment on average varied from 129.3 cm in the control to 162.5 cm in treatment option maxim (5.0 l / t) + hydromix (200 g / t) + fertigrain star (1.0 l / t). The maximal height of sunflower plants F1 Borey was noted in 2012 - 171.3 cm in the option maxim (5.0 l / t) + hydromix (200 g / t) + fertigrain star (1.0 l / t)”. the differences with control were 33.8 cm. In subsequent years, the height of sunflower plants was lower, but nevertheless the best option of presowing treatment was the option maxim (5 l/t) + hydromix (200 g/t) + fertigrain star (1 l/t). On average for 3 years the hybrid F1 Borey had maximal plant height in the options Maxim (5 l/t) + Hydromix (200 g/t) + Fertigrain Star (1 l/t) and Maxim (5 l/t) + Hydromix (200 g/t) + Albit (0.35 l/t), which was 32.4 cm and 30.2 cm higher than the control one. The height of sunflower plants F1 Dariy was from 145.6 cm in the control to 169.4 cm in the option Maxim (5 l/t) + Hydromix (200 g/t) + Fertigrain Star (1 l/t) (table 2). The most intensive growth processes were founded with the application of the protectant Maxim (5 l/t) + Hydromix (200 g/t) + Fertigrain Start (1 l/t). The middle-early sunflower hybrid F1 Dariy has a leaf-area duration from 20.4 thousand m2 / ha to 23.5 thousand m2 /ha (table 4). The maximum indicators of leaf-area duration were obtained in the option Maxim (5 l/t) + Hydromix (200 g/t) + Fertigrain Start (1 l/t) - 3.1 thousand m2 /ha. Table 1. The effect of pre-sowing treatment on plant height of sunflower Hybrid F1 Borey Plant treatment options Plant height, cm 2012 2013 2014 _ Х ± to the control Without treatment - control 137,5 124,3 126,2 129,3 - Vincite (2 l/t) - standard 141,0 137,2 138,5 138,9 +9 Maxim (5 l/t) 143,5 131,5 141,4 138,8 +9 Maxim (5 l/t) + Hydromix (200 g / t) 151,5 131,5 138,1 140,4 +11 Maxim (5 l/t) + Radifarm (0.2 l / t) 142,4 142,8 140,4 141,9 +12 Maxim (5 l/t) + Fertigrain (1 l/t) 154,0 148,0 149,2 150,4 +21 Maxim 5 l/t + Albit (0.35 l/t) 150,7 157,2 153,8 153,9 +24 Maxim (5 l/t) + Vympel (0.3 l/t) 148,5 138,5 141,5 142,8 +13 Maxim (5 l/t) + Hydromix (200 g / t) + Radifarm (0.2 l/t) 163,2 145,2 148,3 152,2 +23 Maxim (5 l/t) + Hydromix (200 g/t) + Fertigrain Star (1 l/t) 171,3 155,3 160,9 162,5 +33 Maxim (5 l/t) + Hydromix (200 g/t) + Albit (0.35 l/t) 169,0 153,1 155,7 159,3 +30 Maxim (5 l/t) + Hydromix (200 g/t) + Vympel (0.3 l/t) 162,8 142,4 147,1 150,7 +21 НСР05 - 4,52 2 BIO Web of Conferences 30, 04011 (2021) https://doi.org/10.1051/bioconf/20213004011 ILS 2020

Table 2. The effect of pre-sowing treatment on plant height of sunflower Hybrid F1 Dariy Table 3. The effect of pre-sowing treatment on leaf-area duration of sunflower F1 Borey Plant treatment options leaf-area duration, thousand m2 / ha 2012 2013 2014 _ Х ± to the control Without treatment - control 18,7 16,2 16,6 17,2 - Vincite (2 l/t) - standard 19,0 17,7 18,0 18,2 +1,0 Maxim (5 l/t) 19,2 17,5 18,4 18,4 +1,2 Maxim (5 l/t) + Hydromix (200 g/t) 19,6 17,8 18,7 18,7 +1,5 Maxim (5 l/t) + Radifarm (0.2 l/t) 19,5 17,2 18,3 18,3 +1,1 Maxim (5 l/t) + Fertigrain (1 l/t) 20,4 18,3 19,2 19,3 +2,1 Maxim 5 l/t + Albit (0.35 l/t) 20,4 18,8 19,5 19,6 +2,4 Maxim (5 l/t) + Vympel (0.3 l/t) 20,0 17,7 18,3 18,7 +1,5 Maxim (5 l/t) + Hydromix (200 g/t) + Radifarm (0.2 l/t) 20,5 19,2 19,4 19,7 +2,5 Maxim (5 l/t) + Hydromix (200 g/t) + Fertigrain Star (1 l/t) 21,3 20,6 19,8 20,6 +3,4 Maxim (5 l/t) + Hydromix (200 g/t) + Albit (0.35 l/t) 20,9 19,4 18,7 19,6 +2,4 Maxim (5 l/t) + Hydromix (200 g/t) + Vympel (0.3 l/t) 19,7 18,9 18,5 19,0 +1,8 НСР05 = 0,50 Table 4. The effect of pre-sowing treatment on leaf-area duration of sunflower F1 Dariy Plant treatment options leaf-area duration, thousand m2 / ha 2012 2013 2014 Х ± to the control Without treatment - control 21,0 19,7 20,4 20,4 - Vincite (2 l/t) - standard 22,1 21,4 20,9 21,5 1,1 Maxim (5 l/t) 22,2 21,6 21,3 21,7 1,3 Maxim (5 l/t) + Hydromix (200 g/t) 22,7 21,3 22,4 22,1 1,7 Maxim (5 l/t) + Radifarm (0.2 l/t) 22,5 20,8 21,2 21,5 1,1 Maxim (5 l/t) + Fertigrain (1 l/t) 23,4 22,5 22,7 22,9 2,5 Maxim 5 l/t + Albit (0.35 l/t) 23,1 22,8 23,6 23,2 2,8 Maxim (5 l/t) + Vympel (0.3 l/t) 23,0 21,5 22,8 22,4 2,0 Maxim (5 l/t) + Hydromix (200 g / t) + Radifarm (0.2 l/t) 24,6 20,9 20,4 22,0 1,6 Maxim (5 l/t) + Hydromix (200 g/t) + Fertigrain Star (1 l/t) 25,5 22,6 22,3 23,5 3,1 Maxim (5 l/t) + Hydromix (200 g/t) + Albit (0.35 l/t) 25,1 21,7 22,9 23,2 2,8 Maxim (5 l/t) + Hydromix (200 g/t) + Vympel (0.3 l/t) 23,4 21,3 22,4 22,4 2,0 НСР05 = 1,22 Plant treatment options Plant height, cm 2012 2013 2014 Х ±to the control Without treatment - control 157,2 139,4 140,1 145,6 - Vincite (2 l/t) - standard 163,8 147,2 146,3 152,4 6,8 Maxim (5 l/t) 165,2 143,9 143,8 150,9 5,3 Maxim (5 l/t) + Hydromix (200 g / t) 178,1 157,8 156,2 164,0 18,4 Maxim (5 l/t) + Radifarm (0.2 l/t) 174,0 153,9 154,1 160,6 15,0 Maxim (5 l/t) + Fertigrain (1 l/t) 179,5 161,6 160,8 167,3 21,7 Maxim 5 l/t + Albit (0.35 l/t) 175,0 160,2 162,0 165,7 20,1 Maxim (5 l/t) + Vympel (0.3 l/t) 168,0 146,0 144,8 152,9 7,3 Maxim (5 l/t) + Hydromix (200 g / t) + Radifarm (0.2 l/t) 170,3 154,4 153,7 159,5 13,9 Maxim (5 l/t) + Hydromix (200 g/t) + Fertigrain Star (1 l/t) 182,0 163,3 162,9 169,4 23,8 Maxim (5 l/t) + Hydromix (200 g/t) + Albit (0.35 l/t) 180,0 154,1 153,2 162,4 16,8 Maxim (5 l/t) + Hydromix (200 g/t) + Vympel (0.3 l/t) 168,8 149,8 142,2 153,6 8,0 НСР05 = 11,07 3 BIO Web of Conferences 30, 04011 (2021) https://doi.org/10.1051/bioconf/20213004011 ILS 2020

4 Сonclusion Thus, pre-sowing treatment of sunflower seeds with a complex of protective and growth-stimulating solutions maximally contributed to realization of plant adaptability potential and the strong plant stand formation. The growth potential of sunflower hybrids under research was significantly activated in the option Maxim (5 l/t) + Hydromix (200 g/t) + Fertigrain Star (1 l/t), which allowed us to choose this seed treatment as an optimal one. References [1] Alabushev V.A., Alabushev A.V. and other. Crop production: textbook / Ed. V.A. Alabusheva. – (Publishing center "Mart", Rostov-on-Don, 2001). [2] Korenev G.V. Plant growing with the basics of selection and seed production / G.V. Korenev, P.I. Podgorny, S. N. Shcherbak. (Agripromed, Moscow, 1990) [3] Nichiporovich A. A Physiology of photosynthesis and plant productivity / A. A Nichiporovich // Photosynthesis physiology(Science, Moscow, 1982) [4] Kolomeychenko V.V. Plant growing / V.V. Kolomeychenko (Agribusiness Center, Moscow, 2007) [5] Konovalov J. B. Private selection of field crops / J. B. Konovalov, L.I. Dolgodvorova, L.V. Stepanova and others. (Agriprom-ed., Moscow, 1990) [6] Vasilieva N. G. About sunflower photoperiodism // Physiological resistance of winter, spring breads and sunflower (VASKHNIL 56-76, 1936). [7] Kurets V. K. Methods for the determination of certain biometric indicators in plants / V. K. Kurets.( Kar. Phil. USSR Academy of Sciences, Petrozavodsk, 1988) [8] Maysuryan N.A. Crop Production / Under ed. V. N Stepanova and V. I. Lukyanuk. (Kolos, Moscow, 1971) [9] Semikhnenko P.G. Sunflower / P.G. Semikhnenko, A.I. Klyuchnikov, T.M. Tokarev and others(Kolos, Moscow, 1965) [10] Dospehov B.A. The methodology of field experiments (with the basics of statistical processing of the research results) / B.A. Dospekhov (Demand Book, Moscow, 2012) 4 BIO Web of Conferences 30, 04011 (2021) https://doi.org/10.1051/bioconf/20213004011 ILS 2020

Antioxidant potential, biochemical activity and hypoglycemic effects of R. obtusifolius L. seed extracts used in Armenian traditional medicine Mikayel Ginovyan*, Naira Sahakyan, Anush Aghajanyan, and Armen Trchounian Department of Biochemistry, Microbiology & Biotechnology Yerevan State University, Yerevan, Armenia Abstract. The diversity of plants in Armenia is due to the singularity of natural environment. However, biochemical activity of these plants has not been studied well. The goal was to investigate biological activities as well as antihyperglycemic properties of Rumex obtusifolius L. in rabbits with hyperglycemia. According to obtained data, R. obtusifolius extracts possessed high antioxidant activity in chemical-based tests. GS/MS analysis of its methanol extracts allowed identification of several compounds, which could have high contribution on biological activities. The sub-cytotoxic concentration of investigated extract was 10 mgmL-1on Murine microglial BV-2 WT cell lines. Oral administration of ethanol extract showed significant effect on hyperglycemia, reducing fasting glucose levels (57.3%, p<0.05) and improving glucose tolerance. These findings suggest that R. obtusifolius extracts could be source of new biologically active compounds and recommended for treatment of diabetes mellitus. 1 Introduction Armenia is positioned at the junction of several biogeographical zones and appears to be rich in health promoting edible or medicinal plants. These zones are closely linked, resulting in relatively few endemic species of Armenian flora. Overall, 123 endemic plant species are described. These plants are commonly employed in traditional medicine for the prevention and treatment of various diseases from the 15th century and even earlier time. The privilege is the less cytotoxicity of plants to the humans. Armenian flora is rich with with herb species which have been widely used in traditional medicine since ancient times [1]. However, this biodiversity was not studied properly for their biological activities, biochemical properties, including antioxidant properties [2], and hypoglycemic activities [3]. Therefore, there could be hidden a great potential for their antioxidant properties and antihyperglycemic effects which can has huge value for therapeutic uses, as well as food industry [4]. The aim of this research was to evaluate antioxidant potential of crude extracts of R. obtusifolius, identify biologically active compounds using GC-MS technique and to investigate biochemical properties and antihyperglycemic properties of R. obtusifolius alcohol extract in rabbits with hyperglycemia. 2 Materials and methods 2.1 Plant materials Collection of plant material and preparation of plant crude extracts R. obtusifolius L. (seed) samples (voucher specimen number ERCB 13208) were collected from Tavush region (1300-1600 m above sea level). The collection, identification and preparation of plant material was done according to already established protocol [1]. R. obtusifolius L. samples were deposited to the Herbarium of Yerevan State University. Plant crude extracts were prepared by maceration technique using methanol (98%), ethanol (96%) and acetone (99.8%), according to method described previously [1]. Dry crude extracts stored in freezer (-18-20 0C). For determination of hypoglycemic properties, the dried seeds were extracted with 40% ethanol for 20 min at 60∘C. Briefly, 270-280 mg of dry matter are in 6 ml of ethanol. The extract was filtered with Watman filter paper (N1, Unichem, China) and after cooling at room temperature was orally administrated. 2.2 Evaluation of antiradical activity by DPPH assay Antiradical activity of tested plant crude extracts was evaluated by using 2,2-diphenyl-1-picrylhydrazyl (DPPH) assay [5]. Test solutions contained 250 µL (1 mM) DPPH, 750 µL ethanol (96%) and 1000 µL plant crude extract with different concentrations. Catechin was used as positive control. IC50 values for each plant extract were determined. 2.3 Hydrogen peroxide reducing activity Hydrogen peroxide (H2O2) reducing ability of R. obtusifolius was evaluated by the method described by Ruch et al.[6]. Percent reduction of hydrogen peroxide © The Authors, published by EDP Sciences. This is an open access article distributed under the terms of the Creative Commons Attribution License 4.0 (http://creativecommons.org/licenses/by/4.0/). BIO Web of Conferences 30, 05001 (2021) https://doi.org/10.1051/bioconf/20213005001 ILS 2020

calculated by following formula: H2O2 reduction =AcAt/Ac⸱100% where Ac - absorption of control solution, At – absorption of test solution. Ascorbic acid was used as positive control at 10 μg mL-1 concentration.* 2.4 Metal chelating activity Metal chelating activity of R. obtusifolius extracts was assessed by color change due to the formation of ferrozine-Fe2+ complexes [7]. Percent metal chelating activity of plant extracts was calculated according the following formula: ℎ = − ∗ 100% (1) where Ac – absorption of control solution, At – absorption of test solution. EDTA was used as a positive control at 22 μg⸱mL-1 concentration. 2.5 Determination of extent of lipid peroxidation TBARs assay was used for evaluation of R. obtusifolius extracts on extent of lipid peroxidation[8]. Mice brain tissue homogenate (in 20 mM phosphate buffer (pH 7.4)) used during the test. Test solution contains 0.3 mL of plant extract (3 mg/mL concentration), 0.7 mL 250 mM HCl, 1 mL tissue homogenate and 2 mL TBA solution (0.375%). The absorbance of mixtures measured at 532 nm. Malondialdehyde concentration calculated using an extinction coefficient of 1.56⸱105 M-1 cm-1 . 2.6 BV-2 microglia cell culture Murine microglial BV-2 WT cell lines were grown in a 5% CO2 incubator at 37 °C in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% (v/v) heat inactivated fetal bovine serum (FBS) and 1% antibiotics (penicillin, streptomycin); culture medium was changed every 2 days. BV-2 cells were seeded on 96-well microplates at 25⸱104 cells per well for viability assay. 2.7 MTT assay The cell proliferation and/or mitochondrial activity were measured using 3-(4,5-dimethyltrazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT) assay. Cells, plated in 96-wells plates, were treated for 24-72 h with different concentrations of extracts (50 – 5⸱10-4 µL⸱mL-1 in dimethyl sulfoxide. Cells were incubated for 2 h with MTT dye followed by the absorbance (Abs) measurement at the 570 nm with a microplate reader and the subcytotoxic concentration was selected for further investigations [9]. The MTT test was carried out in order to clarify the influence of R. obtusifolius crude methanol extract cell viability. * Corresponding author: [email protected] 2.8 Identification of volatile compounds by GCMS technique For identification of volatile compounds contained in R. obtusifolius crude methanol extract, GC-MS technique was applied using a Hewlett–Packard 5890 Series II gas chromatograph, fitted with a fused silica HP – 5MS capillary column (30 m × 0.25 mm, in thickness 0.25 μm) [10], The identification of peaks was tentatively carried out based on library search using National Institute of Standards and Technology (NIST)-2013. 2.9 Induction of hyperglycemia in experimental rabbits and blood sampling The domestic rabbits (Oryctolagus cuniculus domesticus) (1800-1900g) were divided into three groups ( = 9) as follows: group 1: normoglycemic, group 2: hyperglycemic control, putting immobilization, and group 3: hyperglycemic experimental, in common with immobilization received R. obtusifolius seed extract (150mg kg-1 body weight.). Hyperglycemia was induced by immobilization stress in the rabbits during 21 days (5 h daily) [11]. The animals were authorized by the “International Recommendation on Carrying out of Biomedical Researches with use of Animals,” and the study plan has been approved by the National Center of Bioethics (Armenia). 2.10 Biochemical Analysis Blood samples were taken from the aural vein and collected in serum separation tubes (Clot Activator & Gel, Turkey). Blood clot was removed by centrifugation at 3000 g for 10 min in a centrifuge at 4°C. The resulting supernatant was designated as a serum. The biochemical analysis was performed to measure the serum level of glucose, total cholesterol (TC), high-density lipoprotein (HDL), low-density lipoprotein (LDL), and triglycerides (TG). All parameters were assayed using enzymatic kit. Serum glucose level (mmol/L) was determined using glucose test kit based on the glucose oxidase method [12]. TC and TG were estimated by the method, as described [12]HDL and LDL were measured using the method, as described [13]. Analytical tests were conducted using automatic biochemical analyzers VITROS-5.1/FS (Germany) and MINDRAY B1-120 (China). 2.11 Oral Glucose Tolerance Test On the 10th day of treatment an oral glucose tolerance test (OGTT) was carried out. Animals were fasted overnight before commencing of experiments. 20% glucose solution (2g kg-1 b.w.) was administrated a signal oral dose to all groups of rabbits. The blood glucose level was measured by portable glucometer (Contour TS, Bayer, Switzerland). Blood samples were collected from aural vein at 0, 30, 60, 90, and 120 min after glucose loading. 2 BIO Web of Conferences 30, 05001 (2021) https://doi.org/10.1051/bioconf/20213005001 ILS 2020

2.12 Data processing All experiments were independently repeated at least 3 times. Obtained data were processed; mean values and standard deviations were calculated using GraphPad Prism 8.0.1 (GraphPad Software, Inc.; USA) software. The results obtained in the study are reliable (p <0.05), unless another value is followed. 3 Results and Discussion R. obtusifolius or broad-leaved dock is well known herb which have been widely used in traditional medicine from ancient times for treatment of infectious diseases, skin rash, mucosal inflammations, etc.[14]. In previous research works of our group, promising antimicrobial, antibiotic modulatory, and antiviral activity of its crude extracts was shown [1,15]. TLC-bioautographic analysis allowed separating active antimicrobial fractions from R. obtusifolius extracts against Staphylococcus aureus MDC 5233 and describing the chemical nature of those compounds [14]. It was hypothesized, that polar compounds could have considerable contribution to the antibacterial activity of acetone and methanol extracts of R. obtusifolius[14]. In current research based on chemical tests it was shown that crude methanol and acetone extracts of seeds of R. obtusifolius possessed promising antioxidant activity. Particularly high DPPH, hydrogen peroxide reducing and metal chelating activity were shown (Table I). It was revealed that methanol extract of R. obtusifolius had 25.29 µg mL-1 IC50 value in the presence of DPPH 0.05 mg mL-1 concentration. It was shown that at the presence of 100 μg mL-1 concentration R. obtusifolius acetone extracts have 99.30% hydrogen peroxide reducing activity when the concentration of H2O2 in the mixture was 36 mM. Its methanol extract exhibited moderate activity leading to 40.78% hydrogen peroxide reduction. On the other hand, R. obtusifolius methanol extracts exhibited expressed metal chelating activity as well at the concentration of 125 μg mL-1 by reducing the number of Fe2+-ferrozine complexes by 73.02% at the presence of 0.125 mM FeCl2. Its acetone extract had low metal chelating ability at tested concentrations. TBARs assay revealed that R. obtusifolius methanol and ethanol extracts have not possessed anti-peroxidative activity till 225 µg mL-1 concentration. 3.1 GC-MS Analysis of R. obtusifolius methanol extract. In order to identify biologically active volatile and semivolatile constituents R. obtusifolius methanol extract GCMS technique was used. Based on obtained data various biologically active compounds were identified, which could play important role in their antioxidant effect. In general, 21 compounds were identified in methanol extract of R. obtusifolius. The identified compounds and their characteristics are shown in Table II. Some of the identified compounds are considered to possess biological activities. These were linoleic acid (41.32%), cis-vaccenic acid (24.43%), palmitic acid (12.25%), oleic acid (3.65%) 1,2,4-benzenetriol(0.46%), N-[4-bromo-n-butyl]-2- piperidinone (0.64%) which present in the extracts with relatively high concentrations and have different biological activities based on literature data [16,17]. These compounds could have a contribution to the antioxidant and antimicrobial activities of this plant extracts. Other bioactive compounds also identified in the extract but only at low concentrations (Table 2). 3.2 The effect of R. obtusifolius methanol extract on BV2 cell viability (MTT assay) According to this test the sub-cytotoxic concentration of investigated extract was 10 mgmL-1 (Fig. 1) (p < 0.05). 3.3 Effect of R. obtusifolius on Fasting Glucose Levels. Antihyperglycemic activity of R. obtusifolius seeds ethanol extract was evaluated on hyperglycemic rabbit model. Fasting blood glucose levels in the hyperglycemic control (56.2%) and hyperglycemic + R. obtusifolius extract (48.0%) groups during the first day of immobilization were significantly increased, compared to the normoglycemic group, p<0.05 (Fig. 2). Therefore, it may be noted that disposable strong stressful pressure provokes of hyperglycemia. Treatment with R. obtusifolius (150mg/kg BW) single dose for 21 days showed a significant reduction in fasting glucose to hyperglycemic rabbits (57.3%, p<0.05) in comparison with 1th day value. 3.4 Effect of R. obtusifolius on OGTT The results of effect on OGTT were observed that the seeds extract showed a significant effect on hyperglycemia compared to the hyperglycemic group (Fig.3). Blood glucose in all groups were increased at 30 min time point after glucose load, and then gradually decreased. following hours. At 120 min blood glucose levels were significantly reduced in treated group of rabbits (25.3%) and hyperglycemic control group (14.7%) compared to the values at 30min. Therefore, glucose tolerance was significantly improved in the R. obtusifolius treated animal groups, when compared to the hyperglycemic control group (p<0.05). 3.5 Effect of Ethanol Extract of R. obtusifolius on Serum Lipid Profiles The data of effect of R. obtusifolius ethanol extract on serum lipid profiles showed that the TC and LDLcholesterol levels in the hyperglycemic control group were significantly increased (68.8% and 61.9% respectively), TG level was increased (17.5%) compared to the normoglycemic group (Table III). After 21 days of oral treatment, physiological levels of blood lipids parameters demonstrated significantly decreased TC and LDL-cholesterol levels (53.3% and 38.4%, respectively), 3 BIO Web of Conferences 30, 05001 (2021) https://doi.org/10.1051/bioconf/20213005001 ILS 2020

and reduced TG level (17.5%) compared to the hyperglycemic control group. The HDL levels of the extract treated hyperglycemic group did not differ significantly from the hyperglycemic animals group. Although the hyperglycemic control group of animals demonstrated a tendency towards increased LDLcholesterol level compared to the other groups. Table 1. Antioxidant activity of the tested plant methanol and acetone extracts using different chemical based methods Plant name Extract DPPH* reduction IC50 value (µg mL-1 ) H2O2 %-reduction in the presence of 100 µg mL-1 plant crude extract Fe2+% chelation in the presence of 100 µg mL-1 plant crude extract MDA % reduction in the presence of 225 µg mL-1 plant crude extract R. obtusifolius Methanol 25.29±0.8 40.78±0.9 73.02±1.6 –* Acetone ND** 99.30±2.1 5.56±1.0 – Positive control 3 (Catechin) 11.23±0.9 (Ascorbic acid) 28.57±2.1 (EDTA)*** 91.1±1.4 (Tocopherol) *absence of activity, **ND – not determined, *** EDTA –Ethylene diamine tetraacetic acid. All experiments were independently repeated three times. Average means with standard deviations are represented, p<0.05. Table 2. Compounds identified in the crude extract of R. Obtusifolius Identified compound RT* % Peak area Compound nature Biological activities 1,2,4-Benzenetriol 15.540 0.46 phenolics Antiseptic, fungicidal, insecticide, antioxidant Tritetracontane 19.703 0.12 alkane Insecticide Hexadecanoic acid, methyl ester 21.619 0.30 fatty acid methyl esters Antioxidant, pesticidal, antinematodal 1,2-Benzenedicarboxylic acid, butyl 2-methylpropyl ester (Butyl isobutyl phthalate) 21.893 0.54 - Not reported Palmitic acid 22.572 12.25 fatty acid Antibacterial, antioxidant, pesticidal, antinematodal Hexadecanoic acid, ethyl ester 22.879 1.29 fatty acid ethyl esters Antioxidant, anti-nematodal, pesticidal, hemolytic Eicosane 23.251 0.19 alkane Not reported Oleic Acid 24.018 3.65 fatty acid Antimicrobial Methyl linoleate 24.686 0.45 fatty acid Antifungal, antitumor 11-Octadecenoic acid, methyl ester 24.850 0.68 fatty acid methyl esters Not reported 3,8-Dimethyldecane 25.168 0.16 alkane Not reported Linoleic acid 26.022 41.32 fatty acid Antibacterial cis-Vaccenic acid 26.209 24.43 fatty acid Antimicrobial 4-Methyldocosane 29.11 0.15 alkane Not reported N-[4-bromo-n-butyl]- 2- Piperidinone 31.050 0.64 alkaloids Antimicrobial, antioxidant, anti-inflammatory 1-Heptadecene 32.923 0.32 alkenes Not reported cis-9-Hexadecenoic acid 33.668 0.40 fatty acid Antibacterial Octadecane 34.204 0.27 alkane Not reported 9-Octadecenal, (Z)- 34.872 0.53 fatty aldehydes Antimicrobial Heptacosane, 1-chloro- 35.190 0.31 Not reported Supraene 36.351 0.21 triterpenoids Antibacterial, antioxidant, pesticidal, antitumor None pure ingredients 2.58 *RT – retention time 4 BIO Web of Conferences 30, 05001 (2021) https://doi.org/10.1051/bioconf/20213005001 ILS 2020

Fig. 1. Effects of R. obtusifolius extract on viability of BV-2 WT (MTT assay). Cells were treated for 24 h with extract at different concentrations (50 to 10-4 mgmL-1 ). The results represent the mean ± SD of the three repetitions. Values are given as average of the repetitions. The significance is presented with the Student-t test: p < 0.05. Fig. 2. Effect R. obtusifolius ethanol extract on OGTT in normoglycemic and hyperglycemic rabbits. Data are represented as mean ± SD for 3 animals per group. ∗Significantly different levels compared to the normoglycemic group. The significance is presented with the Student-t test: p < 0.05. Fig.3 Effect of R. obtusifolius ethanol extract on fasting blood glucose levels in normoglycemic and hyperglycemic rabbits. Data are represented as mean ± SD for 3 animals per group. ∗Significantly different levels compared to the nonhyperglycemic group. ∗∗Significantly different levels compared to the hyperglycemic control group. The significance is presented with the Student-t test: p < 0.05. Table 3. The effects of SR aqueous extracts on Serum lipids in rabbits Parameters (mmol L-1 ) Experimental groups of animals Normoglycemic Hyperglycemic control Hyperglycemic + R.obtusifolius TC 1.4 ± 0.08 4.5 ± 0.16 * 2.1 ± 0.09** TG 0.85 ± 0.12 1.03 ± 0.4 * 0.85 ± 0.05 ** HDL 0.78 ± 0.04 1.02 ± 0.15* 1.04 ± 0.08** LDL 1.0 ± 0.15 2.63 ± 0.09* 1,.62 ± 0.08** VLDL 0.17 ± 0.03 0.46 ± 0.07* 0.38 ± 0.02** ∗Significantly different from normoglycemic group (p<0.05). Data are represented as mean ± SD for 3 animals per group. 4 Conclusion Thus, high antioxidant activity of R. obtusifolius seed extracts was revealed. GS/MS analysis of R. obtusifolius seed methanol extracts allowed identification of several compounds, which could have high contribution on biological activities. On the other hand, it was shown that the sub-cytotoxic concentration of investigated extract was quite low (10 mgmL-1 ) on Murine microglial BV-2 WT cells. The ethanol extract of R. obtusifolius seeds revealed hypoglycemic activity, improved lipid profile in hyperglycemia induced by immobilization stress in rabbits. Further investigations should be performed to clarify the mechanisms of action. These findings suggest that R. obtusifolius extracts could be source of new biologically active compounds and might be recommended for treatment of diabetes mellitus. References 1. M. Ginovyan, M. Petrosyan, A.Trchounian, BMC Complement. Altern. Med.,17, pp. 1–9 (2017) 2. N. Sahakyan, M. Petrosyan, I. Koss-Mikołajczyk, A. Bartoszek, T. Gabour Sad, M.J Nasim., M.Vanidze, A. Kalandia, C. Jacob, A. Trchounian, " Free Radic. Res., pp. 1–10 (2019) 3. Aghajanyan A, Movsisyan Z, Trchounian A., Biomed Res. Int., 2017, Article ID 9251358, pp. 1–6 (2017) 4. N. Sahakyan, A. Bartoszek, C. Jacob, M. Petrosyan, A. Trchounian, Curr. Pharmacol. Reports, 6, pp. 131– 136 (2020) 5. R. Apak, S. Gorinstein, V. Böhm, K.M. Schaich, M. Özyürek, K. Güçlü, Pure Appl. Chem., 85, 5, pp. 957– 998 (2013) 6. R.J. Ruch, S.J. Cheng, J.E. Klaunig, Carcinogenesis, 10, pp. 1003–1008 (1989) 7. M.N. Alam, N.J. Bristi, M. Rafiquzzaman, Saudi Pharm. J., 21, pp. 143–152 (2013) 8. Kulisic T, Radonic A, Katalinic V, Milos M. Food Chem., 85, pp. 633–40 (2013) 9. A.B. Abdel-Naim, A.A. Alghamdi, M.M. Algandaby, F.A. Al-Abbasi, A.M. Al-Abd, B.G. Eid, H.M. 0,0000 0,0500 0,1000 0,1500 0,2000 0,2500 0,3000 0,3500 0,4000 OD concentrations mg/mL R. obtusifolius 5 BIO Web of Conferences 30, 05001 (2021) https://doi.org/10.1051/bioconf/20213005001 ILS 2020

Abdallah, A.M. El-Halawany " Oxid. Med. Cell. Longev., 2018, Article ID 5106469, pp. 1-10 (2018) 10. A. Avetisyan, A. Markosian, M. Petrosyan, N. Sahakyan, A. Babayan, S. Aloyan, " BMC Complement. Altern. Med., 17, pp. 1–8 (2017) 11. S.M. Lim, S.H. Park, N. Sharma, S.S. Kim, J.R. Lee, J.S. Jung, H.W. Suh, Brain Res. Bull., 124, pp. 116– 122 (2014) 12. P. Trinder, " Ann. Clin. Biochem., 6, pp. 24–27 (1969) 13. W.T. Friedwald, R.I. Leve, D.S. Clin. Chem., 18, pp. 499–502 (1972) 14. M. Ginovyan, A. Ayvazyan, A. Nikoyan, L. Tumanyan, A. Trchounian, Curr. Microbiol. (2020) 15. M. Ginovyan, A. Trchounian, J. Appl. Microbiol., 127, pp. 472–480 (2019) 16. M. Sermakkani, V. Thangapandian, Asian J. Pharm. Clin. Res., 5, pp. 90–94 (2012) 17. B.T.S. Yff, K.L. Lindsey, M.B. Taylor, D.G. Erasmus, A.K. Jäger, " J. Ethnopharmacol., 79, pp. 101–107 (2002) 6 BIO Web of Conferences 30, 05001 (2021) https://doi.org/10.1051/bioconf/20213005001 ILS 2020

The effect of dissolved oxygen on microgreen productivity Alexander Grishin*, Andrey Grishin, Natalia Semenova, Vladimir Grishin, Inna Knyazeva, and Alexey Dorochov Federal State Budgetary Scientific Institution «Federal Scientific Agroengineering Center VIM», Moscow, Russia Abstract. The effect of oxygen dissolved in water was researched (1.3 mg/l – without saturation, 6.1 mg/l – air saturation, 14.7 mg/l – oxygen saturation) on the microgreen productivity of “Ivolga” variety wheat of and ‘Aida’ variety lentils. It was found that the enrichment of water for seed germination with oxygen stimulates the speedy germination and receipt of wheat and lentils sprouts 1 day faster than in the variant without saturation. An increase in oxygen concentration contributes to the rapid root system growth of the researched cultures, stimulates the formation of 2 order roots, accelerates the development of the overhead plant parts without dry weight loss. On the 7th day of cultivation, the wet weight of wheat increased by 21 % in the variant with air saturation and 56% with oxygen saturation, wet weight of lentils – by 57% and 77 %, respectively. Both a deficiency and an excess of oxygen in water can adversely affect the content of basic pigments. Therefore, it is necessary to select the species composition of cultures for composing multicomponent mixtures, to obtain higher microgreen quality when grown on oxygen-rich solutions. 1 Introduction The world’s population is increasing every year, and the urban population is also growing rapidly. Among urban residents, natural and environmentally friendly products, including food, are gaining popularity, while confidence in large manufacturers is declining. Against this background, city farming has developed. According to “Research and Markets”, the global vertical farming market in 2017 amounted to about $ 2.3 billion, and by 2023 it will grow to almost $ 7.5 billion, adding more than 20% annually. City farmers are able to solve the main problem of traditional agriculture - complex logistics [1]. In recent years, a new trend in nutrition has emerged - eating sprouts or “Baby Leaf” and microgreens (young green shoots up to 15 cm long, depending on the crop) to enrich the diet with minerals and vitamins [2, 3]. The nutrient content in microgreens is several times greater than in an adult plant [4-6]. Microgreens are characterized by an increased concentration of vitamin C [7], which is lost during heat treatment, in addition, after collection, it quickly loses moisture and nutritional value, so it is so important to use it fresh [8]. The microgreen is rich in chlorophyll, which strengthens the immune system, promotes the healing of wounds and ulcers, and is a natural cancer protector [9]. The chemical structure of chlorophyll is similar to human hemoglobin, therefore, the consumption of microgreens contributes to the process of hematopoiesis, improves oxygen supply to the lungs, optimizes the function of internal organs, and also prevents hypercholesterolemia [10]. There are various methods of microgreens growing. The traditional method is cultivation in soil or peat, where the seed germination occurs in containers filled with soil substrate. Sometimes, special paper towels, perlite, coconut fiber substrates, linen rugs, jute-kenaffiber and biodegradable polylactic acid materials are used as a substrate. In industrial cultivation, a nonsubstrate technology is used – aeroponics or hydroponics [11]. Hydroponics ensures that the root area is saturated with all the necessary building elements and more intensive growth, in comparison with the soil method, but the solution is practically not enriched with natural oxygen, which often leads to the development of pathogenic microflora [12]. By forming the first pair of leaves, the microgreen seedling receives all the substances necessary for growth from the seed, thus, on the basis of its own nutrients, it is able to grow up to 2 weeks, which makes it possible to grow environmentally friendly products without the use of substrates and nutrient solutions. In moist seeds, there is an active consumption of oxygen, which stimulates germination, the intensity of aerobic processes increases, oxidases activate, the mitochondria respiratory activity increases to obtain energy during respiration [13, 14]. Therefore, we researched the effect of saturation of the nutrient solution with oxygen on the quantitative and qualitative indicators of microgreen production. *Corresponding author: [email protected] © The Authors, published by EDP Sciences. This is an open access article distributed under the terms of the Creative Commons Attribution License 4.0 (http://creativecommons.org/licenses/by/4.0/). BIO Web of Conferences 30, 05002 (2021) https://doi.org/10.1051/bioconf/20213005002 ILS 2020

2 Experimental To research the influence of dissolved oxygen on microgreen productivity, a test bench was developed (Fig. 1). It has 3 independent compartments for conducting a comparative analysis of microgreen growing with the possibility of gas saturation of the root zone: control variant – without saturation (oxygen concentration 1.3 mg/l); saturation with air (oxygen concentration 6.1 mg/l); saturation with oxygen (oxygen concentration of 14.7 mg/l). Each of the three containers has a mesh base on which plant seeds are partially immersed in water. The base has holes for the growth of the root part of plants, falling into the container. There are aeration nozzles at the base of containers 2 and 3. Through these nozzles, ambient air is supplied to the plant roots in a container 2 and oxygen in container 3. Oxygen was obtained in the membrane electrolyzer which made it possible to abandon the use of gas cylinders to saturate the solution with oxygen. The use of the electrolyzer is safe and can also be used in domestic conditions. The electrolyzer of this type has compact dimensions and can be used in serial installation used for growing microgreens or sprouts. The oxygen concentration in water was measured using an Expert-001-4 instrument with a Clark sensor DKTP-02.4 with a measurement accuracy of 0.1 mg/l. The experiment was conducted at the test bench, in each compartment of which, in the first series of experiments (3 replicates), 1000 seeds of spring wheat (Triticum aestivum L.) seeds of the “Ivolga” variety were planted, in the second series of experiments – 100 lentil (Lens culinaris Medik.) seeds of ‘Aida’ variety in order to study the effect of dissolved oxygen on microgreen productivity (development of productive shoots and root system). All compartments of the stand were evenly lit by natural sunlight. Daily, the number of germinated seeds was recorded, after 7 days of cultivation, samples were taken of 10 plants in each diagonal of a rectangular container to take into account the growth parameters and determine the dry weight of the sample, 3 samples were taken in the same way to determine the quantitative content of pigments. To determine the dry matter mass in plants, the sample was ground and dried in an oven at a temperature of 105 °C for 1 hour. Weighing of the samples was carried out on an analytical balance with accuracy of 0.0001g. A quantitative analysis of pigments was carried out by extraction from plant tissues using a solvent (100 % acetone), separation of the mixture into individual components and spectrophotometry. The results were processed using one-way analysis of variance (Tukey's HSD test) using Microsoft Exсel 2016. Fig. 1. Scheme of the test banch (1 – without saturation, 2 – saturation with air, 3 – saturation with oxygen) 3 Results and discussion Before carrying out the experiment, we carried out preliminary experiments to determine the laboratory germination of seeds (4 replications of 100 seeds). Laboratory germination of wheat was 99 %, lentils – 95 %. The main experience showed that oxygen concentration did not affect the germination of seeds of both species, but significantly accelerated the rate of germination. Already on the 2nd day of vegetation, fullfledged sprouts were obtained in variant with oxygen saturation, which is 1 day faster than in the other variants of the experiment. On day 3, in the variant with oxygen saturation, the microgreen reached 2-3 cm, it was already prepared for consumption (Fig. 2). For the purity of the experiment, the evaluation of the results was carried out 7 days after sowing (according to the standard terms for obtaining products). The increase in oxygen concentration had a significant effect on the root system development of both cultures (Table I). It was established that an increase in oxygen concentration contributed to the rapid growth of the root system, and for lentils, which have a taproot, stimulated the formation of roots of the 2nd order. An increase in the root suction surface accelerated the development of the overhead parts of plants: the average height of the wheat plants increased by 29 % with air saturation and 64 % with oxygen saturation, the average height of the lentil plants increased by 64% and 91%, respectively (Table 2). Fig. 2. Sprouts of spring wheat cultivar ‘Ivolga’ on the 3rd day after sowing (from left to right: without aeration, air saturation, oxygen saturation) 2 BIO Web of Conferences 30, 05002 (2021) https://doi.org/10.1051/bioconf/20213005002 ILS 2020

The average in repetitions wet weight of the wheat plant overhead part increased by 21% with air saturation and by 56 % when saturated with oxygen, lentils by 57 % and 77 %, respectively, while the losses in the percentage of dry matter are negligible (1-2 %) Therefore, the developed method of growing does not lead to a loss of microgreen quality. An increase in the oxygen concentration in water had a significant positive effect on the content of chlorophyll a in wheat microgreens (Ссl.a = 0.017 in the variant without aeration, 0.026 when saturated with air and 0.035 mg/g when saturated with oxygen), and did not significantly affect the concentration of chlorophyll b and carotenoids (Fig. 3). As for lentils, the highest content of all 3 pigments was observed in the variant with aeration by air, which allows us to conclude that both the lack and excess of oxygen in the water negatively affects these indicators. Thus, experience shows the species-specificity of the effect of oxygen concentration on the content of basic pigments. 4 Сonclusion In the course of research, it was found that enrichment of water for seed germination with oxygen stimulates the speedy germination and receipt of sprouts of wheat and lentils 1 day faster than in the variant without saturation. An increase in oxygen concentration contributes to the rapid growth of the root system of the studied cultures, and for plants with a taproot, it stimulates the formation of 2-order roots. Increasing concentration of oxygen also accelerates the development of the overhead parts of plants, without loss of dry mass. An increase in the concentration of oxygen in water has a significant effect on the content of basic pigments in microgreens. However, both a deficiency and an excess of oxygen in water can adversely affect these indicators, and the reaction to the concentration is species-specific. Thus, it is necessary to select the species composition of the cultures for the preparation of multicomponent mixtures, to obtain higher quality microgreen for functional nutrition when grown on oxygen-enriched solutions. An increase in the oxygen concentration in the solution enlarges the mass and nutritional value of microgreen, and the developed oxygen enrichment devise is safe and compact, which makes it possible to recommend it both for industrial plants and for domestic use. Fig. 3. The content of the main pigments (chlorophyll a, chlorophyll b and carotenoids) in the microgreen of wheat of the Oriole variety and lentils of the Aida TABLE 1. Root growth indicators of ‘Aida’ lentil and ‘Ivolga’ wheat microgreens cultivated with immersion of the root system in water with various oxygen concentrations on 7th day after seeding Crop, variety Test options (oxygen concentration, mg/l) Average total root length, cm Average total number of roots Lentils “Aida” Without oxygen saturation (1.3 mg/l) 1.30 1.0 Air saturation (6.1 mg/l) 4.87 3.2 Oxygen saturation (14.7 mg/l) 5.69 5.2 Least significant difference (P < 0.05) 1.18 1.4 Wheat “Ivolga” Without oxygen saturation (1.3 mg/l) 4.41 5.6 Air saturation (6.1 mg/l) 6.53 6.0 Oxygen saturation (14.7 mg/l) 18.76 5.3 Least significant difference (P < 0.05) 2.37 0.5 TABLE 2.. Growth overhead indicators of ‘Aida’ lentil and ‘Ivolga’ wheat microgreens cultivated with immersion of the root system in water with various oxygen concentrations on 7th day after seeding. Crop, variety Test options (oxygen concentration, mg/l) Average shoot length, cm Average green plant mass, g Dry weight, % Lentils Aida Without oxygen saturation (1.3 mg/l) 4.35 0.041 13.1 Air saturation (6.1 mg/l) 7.15 0.064 12.0 Oxygen saturation (14.7 mg/l) 8.37 0.072 13.4 Least significant difference (P < 0.05) 1.41 0.012 - Wheat Ivolga Without oxygen saturation (1.3 mg/l) 6.91 0.048 13.5 Air saturation (6.1 mg/l) 8.94 0.058 11.8 Oxygen saturation (14.7 mg/l) 11.26 0.075 11.7 Least significant difference (P < 0.05) 1.18 0.009 - 3 BIO Web of Conferences 30, 05002 (2021) https://doi.org/10.1051/bioconf/20213005002 ILS 2020

References 1. N. Kamitdinov, Beds up. Who and why build vertical farms in Russian cities, URL: https://incrussia.ru/understand/vertical-farming/ 2. T.I. Makeeva, Sprouted grain. Live product at home, Competitiveness of territories: materials of XXII All-Russian. econ. forum of young scientists and students, 1, 197–190 (2019). 3. Z. Xiao, E.E. Codling, Y. Luo, X. Nou, G. E. Lester, Q. Wang, J. Food Compos. Anal. 49, 87 (2016) 4. L. P. Yadav, T. K. Koley, A. Tripathi, S. Singh, Agric. Res. 8(2), 165 (2019) 5. N. L. Waterland, Y. Moon, J. C. Tou, M. J. Kim, E. M. Pena-Yewtukhiw, S. Park, Hortscience 52(4), 566 (2017) 6. C. F. Weber, Front. Nutr. 4, 7 (2017) 7. Z. Xiao, “Nutrition, sensory, quality and safety valuation of a new specialty produce: microgreens”, Doctoral dissertation, Faculty of the Graduate School of the University of Maryland, 2013 8. E.R. Turner, Y. Luo, R. L. Buchanan, J. Food Sci. 85(4), 870 (2020) 9. N.Y. Stepanova, News of St. Petersburg State Agrarian University, 41, 56–64 (2015). 10. H.Q. Huang, X.J. Jiang, Z.L. Xiao, L. Yu, Q. Pham, J.H. Sun, P. Chen, W. Yokoyama, L.L.L. Yu, Y.S. Luo, T. T. Y. Wang, J. Agric. Food. Chem. 64(48), 9161 (2016) 11. R.T. Timakova and T.I. Makeeva, “Features of the technology of growing microgreen wheat and milk thistle”, E-FORUM, 1, 79– 89 (2020). 12. A.S. Dmitrieva, Chronoeconomics 6(19), 35–38 (2019) 13. V.V. Rogozhin, T.T. Kurilyuk, T.V. Rogozhina, Agricultural Biology, 47(1), 60 (2012) 14. G.A. Plutakhin, K.P. Fedorenko, and Y.D. Molchanov, Political network electronic scientific journal of the Kuban State Agrarian University, 100, 276–290 (2014). 4 BIO Web of Conferences 30, 05002 (2021) https://doi.org/10.1051/bioconf/20213005002 ILS 2020

Genus Metagentiana T. N. Ho & S. W. Liu (Gentianaceae Juss.) – a new record for flora of Vietnam Khuat Van Quyet1* , Ha Minh Tam1 , Nguyen Thi Thuy Hang1 , and Nguyen Thanh Hai1 1Faculty of Biology and Agricultural engineering, Hanoi Pedagogical University N°2, Hanoi, Vietnam Abstract. Ho et al. proposed to exclude Stenogyne section from the genus Gentiana and classifying it as a distinct genus (Metagentiana). Fourteen species of this genus have been recorded and distributed in China, Myanmar and Thailand. This is the first time there has been a confirmed genus Metagentiana distributed in Vietnam. This genus has two species: Metagentiana rhodantha and Metagentiana primuliflora, which are proposed in Vietnam. Particularly, Metagentiana rhodantha, which had only been known from China, was reported in Vietnam. A detailed description along with their distribution, habitat, ecology, illustrations, and photos has been provided to aid species identification. The key to identify all taxa of the genus has been constructed 1 Introduction Stenogyne is one of Gentiana’s 16 sections, belonging to the gentian family (Gentianaceae Juss.) [1]. It was established by Franchet [2] and was revised by Kusnezov [3]. It is the most disputable and poorly known of Gentiana’s 16 sections. Genus Metagentiana was established by Ho et al [4] on the basis of removing the Stenogyne section from the genus Gentiana based on data on gross morphology, floral anatomy, chromosome number, palynology, embryology, and molecular data. Before Ho Ting Nong, many botanists considered it as a section of the Gentiana genus [5-7]. However, contrary to the point of view of many authors at that time, Smith [8] and Löve [9] based on observations of gross morphology, realized the difference between the Stenogyne section and the sections another in the genus Gentiana and its close relationship with the genera Tripterospermum and Crawfurdia. Löve and Löve (1976) proposed to transfer this section to the genus Tripterospermum, which is intended to be a new subgenus of this genus [10] also noticed this difference, but in his classification, the author classified this section as a subgenus of the genus Gentiana. Subsequent authors' karyological studies continued to support evidence that this section differs from the other sections in the genus Gentiana [11-14]. Authors [12-13] in their initial studies, published chromosome numbers for six species belong to this section; at the same time, based on their differences in the number of haploid chromosomes. They suggested to separate the location of this section within the genus Gentiana. Their subsequent research results on ITS sequencing of the DNA ribosome continued to confirm the difference of the Stenogyne section compared to other sections in the Gentiana genus [14]. Thereafter, species of this section continue to be studied by many authors in a relatively comprehensive way [15-26]. Based on the summary of research data of previous authors and based on their own research, suggested removing Stenogyne section from the genus Gentiana and classifying it as a distinct genus (Metagentiana) [4]. They affirmed that this new genus was more related to Tripterospermum and Crawfurdia than to Gentiana, though it was more primitive than the first two genera; together with Tripterospermum and Crawfurdia the new genus formed a monophyletic group, which was the sister group to the genus Gentiana [4]. Fourteen species (China – thirteen species; Myanmar – one species and Thailand – one endemic species) of the genus Metagentiana have been proposed. The species of this genus are mainly distributed in high mountains, grassland, and coniferous forests. In Vietnam, Loureiro [27] was the first botanist to study on Gentiana genus; two species of this genus have been recorded by the author to be distributed in Vietnam. The "Flore du Cambodge, du Laos et du Vietnam" [28] is considered the most complete classification work of this genus in Vietnam; nine species of the genus distributed in Vietnam were authored detailed description, including Gentiana primuliflora species (belonging to Stenogyne section) which was first recognized by the author to be distributed in Vietnam, it was previously endemic to China. During the course of revisionary on the Gentianaceae in Vietnam, interest arose in the specimens, which were housed in the herbarium of Institute of Ecology and Biological Resource, Hanoi (HN). After thorough morphological study with the help of the relevant literature [1,4, 27-30], it was identified as Metagentiana rhodantha (Franch.) T. N. Ho & S. W. Liu, a new distributional record for Vietnam. This taxon was so far known only from China [4] and had never been recorded in Vietnam. Earlier, Hul Sovanmoly [28] recorded species Gentiana primuliflora Franch.in Vietnam, distributed in * Corresponding author: [email protected] © The Authors, published by EDP Sciences. This is an open access article distributed under the terms of the Creative Commons Attribution License 4.0 (http://creativecommons.org/licenses/by/4.0/). BIO Web of Conferences 30, 05003 (2021) https://doi.org/10.1051/bioconf/20213005003 ILS 2020

Da Lat city (Lam Dong province). The specimen is currently stored in herbarium of Hanoi National University (HNU) and Muséum National d’Histoire Naturalle, Paris (P). We have been revised this species name to Metagentiana primuliflora (Franch.) T. N. Ho & S. W. Liu… This is the first time there have been a confirmed genus Metagentiana distributed in Vietnam. This genus has two species: Metagentiana rhodantha and Metagentiana primuliflora, which are proposed in Vietnam. In this article, we describe the characteristic of genus Metagentiana and two specises of this genus in Vietnam along with brief information about their distribution, habitat and ecology; illustrations and photos have been provided to aid species identification. The key to identify all taxa of the genus has been constructed. 2 Material and methods The study area covers the entire territory of Vietnam. The collected specimens were processed and preserved in the herbarium of Institute of Ecology and Biological Resource, Hanoi (HN). In addition, we also researched dry specimens that were kept in the herbarium of Hanoi National University (HNU); the herbarium of Institute of Ecology and Biological Resource, Hanoi (HN); the herbarium of National Institute of Medicinal Materials (HNMM); Botanical Museum - Institute of Tropical Biology, Ho Chi Minh City (VNM). The total samples studied are 46 specimens belong to the genus Gentiana and 6 specimens belong to the genus Metagentiana. On the other hand, photographs of herbarium sheets were obtained (or downloaded) from A, BM, E, GH, K, M, MO, NY, P, S, and UPS. The identification of the species belonging to these two genera was confirmed in consultation with standard literature [1,4,27-30]. Updated nomenclature is determined consulting The Plant List (2020), a working list of all plant species. 3 Taxonomic treatment Metagentiana T. N. Ho & S. W. Liu, 2002. Bot. Bull. Acad. Sin. 43(1): 89. – Gentiana sect. Stenogyne Franchet, 1884. Bull. Soc. Bot. France, 31: 375. – Gentiana subgen. Stenogyne (Franchet) Halda, 1995. Acta Mus. Richnov. 3: 29. Type: Metagentiana primuliflora (Franchet) T. N. Ho & S. W. Liu Herbs annuals or perennials. Stems erect; branches spreading, 4-angled. Leaves opposite, sessile to subsessile; leaves blade usually elliptic, ovate to cordate, margin serrulate, base rounded to cordate, apex acute; veins 3 or 5. Flowers terminal on branches, solitary, 5-merous, sessile, subtended by a pair of leaf-like bracts. Calyx tubular; tube membranous, 5- angled; lobes 5, midvein prominent outside and decurrent into angles of calyx tube. Corolla tubular to funnelform or salverform; tube usually much longer than lobes, lobes triangular or ovate; plicae between lobes, asymmetrical, very oblique, margin long fringed or erose. Stamens 5, unequal; filaments inserted on corolla tube; anthers narrowly ellipsoid. Ovary superior, 1-locular, ellipsoid; style filiform, about as long as ovary; stigma 2-lobes, linear. Capsule included in persistent corolla, ellipsoid, wingless, many seeded. Seeds brown, triquetrous, ellipsoid, ovoid to subglobose, winged or wingless. In the world, fourteen species of the genus Metagentiana have been recorded, distributed in China, Myanmar, and Thailand. In Vietnam, two species have been recorded of this genus, distributed in north and central Vietnam. Key to species of two genera Metagentiana and Gentiana in Vietnam 1a. Flowers solitary at the top of the branches; leaf sessile to subsessile, base leaf cordate; stamens commonly unequal; seeds triquetrous; calyx tube with 12 vascular bundles. Metagentiana T. N. Ho & S. W. Liu (2) 1b. Flowers many, paired or fasciculate (except Gentiana loureiroi); leaf petiolate, base leaf commonly attenuate (rarely rounded); stamens equal; seed not triquetrous; calyx tube with 15 vascular bundles ...........................................Gentiana L. (3) 2a. Perennials; corolla pale purple; plicae margin fringed; seeds broadly winged ........................ Metagentiana rhodantha 2b. Annuals; corolla pale blue to violet blue; plicae margin erose; seeds wingless .......................Metagentiana primuliflora 3a. Calyx lobes unequal (2 larger than other 3); seed coat alveolate.................................................................................(4) 3b. Calyx lobes equal; seed coat rugose .........................(5) 4a. Basal rosettes usually well developed; lowermost stem leaves not scalelike but with expanded herbaceous blades .................................................................Gentiana cephalantha 4b. Basal rosettes none or poorly developed; lowermost stem leaves scale like, membranous .................... Gentiana rigescens 5a. Flowers ± solitary on short to long branches .................. ................................................................................................... Gentiana loureiroi 5b. Flowers many, paired or fasciculate .........................(6) 6a. Stems stoloniferous; corolla plicae with the margin obliquely truncate; capsule wingless ................Gentiana lowryi 6b. Stems not stoloniferous; corolla plicae with a free part; capsule winged ......................................................................(7) 7a. Corolla scarcely exceeding calyx; calyx lobes ovatespathulate ...............................................Gentiana moniliformis 7b. Corolla usually twice as long as calyx; calyx lobes triangular............................................................................... (8) 8a. Herb with stems ± erect, sometimes exceeding 10 cm tall; stems angled ..................................................................(9) 8b. Herb ± caespitose, ± tufted, never more than 10 cm tall; stems not angled .................................................................(10) 9a. Corolla tube narrowly campanulate; ripe capsules completely exserted, obovoid to widely obovoid ........Gentiana langbianensis 9b. Corolla tube infundibuliform; ripe capsules ± exserted, ± obovoid ...................................................... Gentiana jouyana 10a. Leaves elliptic-oblong or oblong, sometimes spathulate; ripe capsule ± exserted ............................................. ................................................................................................... Gentiana greenwayae 10b. Leaves elliptic or subobovate; ripe capsule included .................................................................................................... ................................................................. Gentiana tonkinensis Metagentiana rhodantha (Franch.) T.N. Ho & S.W. Liu, 2002. Bot. Bull. Acad. Sin. 43(1): 89. - Gentiana rhodantha Franch. in Forbes & Hemsl. 1890. J. Linn. Soc. Bot. 26: 133; Kusnez. 1896-1904. Acta Hort. Petrop. 15: 251; Forrest. 1907. Not. Bot. Gard. Edinb. 4: 70; Lévl. 1914-1915. Fl. Kouy-Tcheou: 172; id. 1916. Cat. Pl. Yunnan: 114; Hand.-Mazz. 1936. Symb. Sin. 7: 951; T.N. Ho, 1988. Fl. Reipubl. Popul. Sin. 62: 24; T.N. Ho & J.S. Pringle in Wu Z.Y. & Raven P.H. (eds.), 1995. Fl. China, 16: 61. - Gentiana jankae Kanitz, 1891. Pl. exped. Szechenyi in As. centr. coll.: 41. - Gentiana rhodantha Franch. var. wilsonii Marquand, 1928. Bull. 2 BIO Web of Conferences 30, 05003 (2021) https://doi.org/10.1051/bioconf/20213005003 ILS 2020

Misc. Inform. Kew.: 55. Type: China (Tapintze - NW Yunnan). Delavay 1869 (Lectotype: P photo 1; isolectotypes: BM, K, UPS). Vernacular name: Long đởm tua Perennials 25-52 cm tall, with a short rhizome. Stems erect; branches spreading, 4-angled. Leaves opposite, sessile to subsessile; leaf blade elliptic, ovate to cordate, 1.5-4 by 0.5-2 mm, margin serrulate, base narrowed, rounded to cordate, apex acute; veins 3 or 5. Flowers terminal, solitary, 5-merous, sessile; bracts foliaceous, ovate-triangular, 0.8-1.5 by 0.4-1 mm, margin serrulate, base narrowed, rounded to cordate, apex acute. Calyx tubular, narrowly obconic; tube long 8-12 mm, membranous, 5-angled; lobes 5, linear-lanceolate, long 5- 7 mm, midvein prominent outside and decurrent into angles of calyx tube. Corolla tubular to funnelform, pale purple; tube long 2-4 cm; lobes ovate, long 5-8 mm, margin entire, apex obtuse; plicae broadly triangular, long 4-5 mm, apex long fringed. Stamens 5, unequal; filaments inserted at basal part of corolla tube, long 8-12 mm; anthers narrowly ellipsoid, long 2-3 mm. Ovary superior, 1-locular, ellipsoid; style long 6-8 mm; stigma 2-lobes, linear. Capsule included in persistent corolla, ellipsoid, long 2-2.5 cm, gynophore 3.5-5 mm. Seeds light brown, triquetrous, ellipsoid to subglobose, 0.6-1 by 0.5 mm, broadly winged. (Fig. 2) Habitat & Ecology: Grasslands, alpine scrub or forests; at an altitude of 1000-2000 m. Phenology: Flowering: November to December; Fruiting: January. Ditribution: Vietnam: Ha Giang (Dong Van district); China (Yunnan, SW Sichuan, Guizhou, W Hubei, Henan, Gansu, S Shaanxi, Shanxi, Guangxi). Specimens examined: Ha Giang, Ban-Bien-HiepKhoi 19 (HN). Metagentiana primuliflora (Franch.) T.N. Ho & S.W. Liu, 2002. Bot. Bull. Acad. Sin. 43(1): 89. - Gentiana primuliflora Franch. 1884. Bull. Soc. Bot. France, 31: 375; F. Forbes & Hemsl. 1890. J. Linn. Soc. Bot. 26: 132; Kusnez. 1896-1904. Acad. Hort. Petrop. 15: 253; Hand.-Mazz. 1936. Symb. Sin. 7: 952; T.N. Ho, 1988. Fl. Reipubl. Popul. Sin. 62: 154; T.N. Ho & J.S. Pringle in Z.Y. Wu & P.H. Raven (eds.), 1995. Fl. China, 16: 62; Hul, 2003. Fl. Camb. Laos Vietn. 31: 30. Type: China (Mo che tchin - Yunnan). Delavay Gent. n. 9 (Holotype: P photo 1.). Vernacular name: Long đởm Anh thảo Annuals 4-22 cm tall. Stems ± erect; branches spreading, 4-angled. Leaves opposite, sessile to subsessile; leaf blade ovate to cordate, 3-10 by 2-7 mm, margin serrulate, base rounded to cordate, apex acute; veins 3 or 5. Flowers terminal, solitary, 5-merous, sessile or subsessile; bracts foliaceous, 4-5 by 2-3 mm, apex acute. Calyx tubular; tube long 8-10 mm, membranous, 5- angled; lobes 5, triangular to subulate, 1.5-2 by 0.5 mm, midvein prominent outside and decurrent into angles of calyx tube. Corolla salverform, pale blue to violet blue; tube long 8-14 mm; lobes triangular, 5-8 by 3 mm, margin entire, apex obtuse; plicae triangular, 2.5-3 by 1-2 mm, margin erose. Stamens 5, unequal; filaments inserted at middle of corolla tube, long 5-8 mm, linear; anthers narrowly ellipsoid, long 1-2 mm. Ovary superior, 1- locular, ellipsoid; style long 4-6 mm; stigma 2-lobes, linear. Capsule included in persistent corolla, ellipsoid, 8- 14 by 2-3 mm, gynophore ca. 2 mm. Seeds brown, triquetrous, ellipsoid to ovoid, 1 by 0.5-1 mm, wingless. (Fig. 3) Habitat & Ecology: Grassland slopes or forests; at an altitude of 1500-2000 m. Phenology: Flowering: October to November; Fruiting: December. Ditribution: Vietnam: Lam Dong (Pren waterfall, Da Lat city); China (NW & C Yunnan, SW Sichuan). Specimens examined: Lam Dong, Evrard 1468 (HNU, P), 2218 (HNU, P). 4 Conclusion In this study, we agreed with Ho et al. (2002) [4] when proceeding to separate Stenogyne section from the genus Gentiana and classify it as a separate genus (Metagentiana). During the research, we have classified nine species of the genus Gentiana (Fig. 1) and two species of the genus Metagentiana that are distributed in Vietnam. This is the first time there has been a confirmed genus Metagentiana distributed in Vietnam. This genus has two species: Metagentiana rhodantha and Metagentiana primuliflora, which are proposed in Vietnam. Particularly, Metagentiana rhodantha, which had only been known from China, was reported in Vietnam. A detailed description along with their distribution, habitat, ecology, illustrations, and photos has been provided to aid species identification. The key to identify all taxa of the genus has been constructed. Authors’ contributions This study was performed in collaboration between all authors. The two first authors, Khuat Van Quyet and Nguyen Thanh Hai, were the main investigators of the study. Other authors participated in the collection of materials, the preparation of experiments, and data collection. Kalashnikova E.A. designed the study, wrote the manuscript, and is the corresponding author of this research. References 1. T. N. Ho and J. S. Pringle, “Gentianaceae,ˮ in Flora of China, vol. 16, Z. Y.Wu and P. H. Raven, Eds. Beijing/St Louis: Science Press/Missouri Botanical Garden, 1-140 (1995) 2. M. A. Franchet, “Description de quelques espéces de Gentiana du Yun-nan,ˮ Bulletin de la Société Botanique de France, 31, pp. 373-378 (1884) 3. N. I. Kusnezov, Tproceedings of the St. Petersburg Society of Natural Scientists, 24, 1-507, (1894) 4. T. N. Ho, S. L. Chen, and S. W. Liu, “Metagentiana, a new genus of Gentianaceae,ˮ Botanical Bulletin of Academia Sinica, 43, pp. 83-91 (2002) 3 BIO Web of Conferences 30, 05003 (2021) https://doi.org/10.1051/bioconf/20213005003 ILS 2020

5. J. S. Pringle, “Sectional and subgeneric names in Gentiana (Gentianaceae),ˮ Contributions to Botany, 7, pp. 232-247 (1978) 6. T. N. Ho and S. W. Liu, “The infrageneric classification of Gentiana,ˮ Bull. Brit. Museum Bot, 20, pp. 169-192, (1990) 7. L. Struwe, J. W. Kadereit, J. Klackenberg, S. Nilsson, M. Thiv, K. B. Von Hagen, and V. A. Albert, “Systematics, character evolution, and biogeography of Gentianaceae, including a new tribal and subtribal classification,ˮ in Gentianaceae: systematics and natural history, L. Struwe and V. A. Albert, Eds. Cambridge: Cambridge University Press, pp. 21-309 (2002) 8. H. Smith, Notes from Royal Botanic Garden (Edinburgh), 26, pp. 237-258 (1965) 9. A. Löve and D. Löve, “Natural genera of Gentianinae,ˮ in Recent Advances in Botany, P. Kachroo (Dehra Dun, Delhi, pp. 205-222, 1976) 10.J. J. Halda, “Acta Musei Richnoviensis Section Nature, 3, pp. 25-29, (1995) 11. Y. M. Yuan, Cytologia, 46, pp. 99-114 (1993) 12. Y. M. Yuan and P. Küpfer, Bulletin de la Société Neuchâteloise des Sciences Naturelles, 116, pp. 65- 78, (1993) 13. Y. M. Yuan and P. Küpfer, Cytologia, 58, pp. 115- 123, (1993) 14. Y M Yuan, P. Küpfer, and J. J. Doyle, American Journal of Botany, 83, 641-652 (1996) 15. S. L. Chen, T. N. Ho, and J. Q. Liu, “Acta Botanica Boreali-Occidentalia Sinica, 17, pp. 547-550 (1997) 16. S. L. Chen, T. N. Ho, and D. Y. Hong, Journal of Systematics and Evolution, 36, pp. 58-68 (1998) 17. S. L. Chen, T. N. Ho, J. Q. Liu, and D. Y. Hong, Acta Biologica Plateau Sinina, 14, pp. 26-34 (1999) 18. S. L. Chen, T. N. Ho, J. Q. Liu and D. Y. Hong, Acta Biologica Plateau Sinina, 14, pp. 35-46 (1999). 19. S. L. Chen, T. N. Ho, J. Q. Liu, and D. Y. Hong, Acta Bot. Yunnan, 22, pp. 53-58 (2000) 20. T. N. Ho and J. Q. Liu, “Acta Bot. Bor.-Occid. Sinica, 19, pp. 234-240 (1999) 21. T. N. Ho, J. Q. Liu, and D. C. Zhang, Acta Biol. Plateau Sin, 13, pp. 9-19 (1997) 22. T. N. Ho, W. Wang, and C. Y. Xue, Acta Botanica Boreali-occidentalia Sinica, 19, pp. 546-551 (1999) 23.J. Q. Liu and T. N. Ho, Acta Biol. Plateau Sinica, 13, pp. 31-41 (1997) 24.J. Q. Liu, C. Y. Xue, and T. N. Ho, Journal of Northwest Normal University (Natural Science), 34, pp. 59-66 (1998) 25.C. Y. Xue, T. N. Ho, and J. Q. Liu, Journal of Systematics and Evolution, 37, pp. 259-263 (1999) 26.C. Y. Xue, T. N. Ho, and J. Q. Liu, Acta Botanica Yunnanica, 21, pp. 212-217 (1999) 27.J. Loureiro, Flora cochinchinensis, 1st ed. (Berolini, 2020) 28. S. Hul, Flore du Cambodge, du Laos et du Viêt-Nam: révision de la Flore générale de l'Indochine, 31, Muséum national d'Histoire naturelle (2003) 29. F. Gapnepain, Flore Générale de L'Indo-Chine, 4, Paris: Muséum National d'Histoire Naturelle, Laboratoire de Phanérogamie (1912) 30. P. H. Ho, An illustrated flora of Vietnam, vol. 2, Hanoi: Young Publishing House, pp. 676–677 (2000) 4 BIO Web of Conferences 30, 05003 (2021) https://doi.org/10.1051/bioconf/20213005003 ILS 2020

Fig.1 Gentiana species are distributed in Vietnam: 1. G. cephalantha Franch. (Fan Si Pan at an altitude of 2400 m, Lao Cai province, photo by Khuat Van Quyet, 2012); 2. G. loureiroi (G. Don) Griseb. (Lam Dong province, photo by Tran The Bach, 2012); 3. G. greenwayae Merr. (Lam Dong province, photo by Tran The Bach, 2012); 4. G. lowryi Hul (Fan Si Pan at an altitude of 2500 m, Lao Cai province, photo by Khuat Van Quyet, 2012); 5. G. rigescens Franch. (photo by Khuat Van Quyet, 2013, based on specimens Le Kim Bien 7808 (HN)); 6. G. langbianensis A. Chev. ex Hul (photo by Khuat Van Quyet, 2013, based on specimens VH 3844 (HN)); 7. G. tonkinensis Hul (photo by Khuat Van Quyet, 2013, based on specimens Pételot 5735 (HNU)); 8. G. jouyana Hul (photo by Khuat Van Quyet, 2013, based on specimens Poilane 3561 (HNU)); 9. G. moniliformis C. Marquand (photo by Khuat Van Quyet, 2013, based on specimens CBL 1382 (HN)). 5 BIO Web of Conferences 30, 05003 (2021) https://doi.org/10.1051/bioconf/20213005003 ILS 2020

Fig.2 Metagentiana rhodantha (Franch.) T.N. Ho & S.W. Liu; - 1. Flowering branch; 2. Showing angled on the stem; 3. Leaf; 4. Bracts foliaceous; 5. Flower; 6. Opened calyx abaxial view; 7. Opened corolla showing stamens; 8. Fruit; 9. Seeds broadly winged (photo by Khuat Van Quyet, 2013, based on specimens Ban-Bien-Hiep-Khoi 19 (HN)). 6 BIO Web of Conferences 30, 05003 (2021) https://doi.org/10.1051/bioconf/20213005003 ILS 2020

Fig.3 Metagentiana primuliflora (Franch.) T.N. Ho & S.W. Liu; - 1. Flowering plant; 2. A pair of leaves and flowering branch; 3. Flower (photo by Khuat Van Quyet, 2013, based on specimens Evrard 1468 (HNU)) 7 BIO Web of Conferences 30, 05003 (2021) https://doi.org/10.1051/bioconf/20213005003 ILS 2020

The study of the consequences of preserving berry crops in vitro on the processes of subsequent clonal micropropagation Inna Knyazeva * Federal State Budgetary Scientific Institution «Federal Scientific Agroengineering Center VIM», All-Russian Horticultural Institute for Breeding, Agrotechnology and Nursery Moscow, Russia Abstract. As a result of studies, it was found that collection samples of berry crops in vitro can be maintained in viable condition on specially selected nutrient media for 12 months. The effect of mannitol concentration (0.45, 0.75 and 1.05%; sucrose control - 3%) on the regenerative potential of microprobe of the studied berry crop varieties was estimated. When studying the effect of the reproduction cycle on the morphogenesis of meristemic cultures, it was found that the dynamics of changes in shoot length, number of leaves and shoots depended on the concentration of the active substance. In general, the majority of berry crops that were viable after storage of explants retained the ability to grow again, in many cases reaching or exceeding the control level. 1 Introduction Plant genetic resources serve as a strategic basis for the effective stable development not only of agriculture, but also of all sectors of the economy and social sphere of the Russian Federation and the world as a whole [1-3]. Improving biotechnological methods and techniques will allow for a long time to save plant objects and create doublet genetic collections in controlled environmental conditions. Preservation of plants using techniques for culturing cells, tissues and organs in vitro is the safest alternative for reproduction and long-term maintenance of a large number of cultures [4, 5]. To increase the interval between passages various techniques are used based on slowing down the growth of test plants, the most important of which is not only temperature, but also the mineral composition of the nutrient medium, carbohydrate content and biologically active substances [6]. Raspberry and strawberry shoots can be stored in vitro for 24 months [7] or longer at 2–4 ◦C on media without growth regulators, although multiplication after storage is significantly lowered [8]. A feature of in vitro scientific work is the development of clonal micropropagation protocols for each variety and genotype, taking into account biological characteristics. [9]. At the Research Institute of Pomology and Floriculture (Poland) three-millimeter-long shoot tips of strawberry ‘Senga Sengana’ and raspberry ‘Norna’ encapsulated in calcium alginate were stored in vitro at 4◦C in the dark. Regrowth ability of the stored explants and in vitro multiplication in three successive subcultures were evaluated. The multiplication rate of strawberry and raspberry shoots in the first subculture after storage was lower than that of non-stored cultures. Multiplication of strawberry in the second subculture was generally higher than in non-stored cultures, but multiplication of raspberry was lower also in the second subculture, with the exception of the combination stored for 9 months and pre-cultured on mannitol. In the third subculture, shoot multiplication in both species was similar to that in non-stored cultures [10]. Nodal segments (Rubus spp.) of the ‘Guarani’, ‘Caingangue’, ‘Ébano’, and ‘Xavante’ genotypes were conserved under minimal growth conditions at 20ºC, for 15 months. Microshoots were regenerated and multiplied by up to five successive subcultures, when they were rooted and acclimatized. After 30 days of acclimatization in a greenhouse, rooted plantlets showed no significant losses. Blackberry cultivars can be conserved in vitro for 15 months, without subcultures and, after this time, they can be micropropagated on a large-scale, maintaining the regenerative potential and multiplication [11]. Berry crop regeneration protocols are available for different varieties, however, there is limited information on individual varietal and hybrid profiles in the direction of restoring explant viability after direct cultivation in vitro. The purpose of these studies was to establish the patterns of the aftereffect of medium-term conservation of in vitro berry culture explants on the processes of subsequent clonal micropropagation. 2 Experimental Studies on the maintenance and restoration of the regenerative ability of explants of berry crops: Ribes nigrum L. (variety ‘Bryanskiy Agat’) Fragaria x ananassa Duch. (variety ‘Nashe Podmoskov'e’) and Rubus idaeus L. (cultivar ‘Bryanskoe Divo’) were conducted in the biotechnology laboratory at the AllRussian Horticultural Institute for Breeding, Agrotechnology and Nursery (Moscow). *Corresponding author: [email protected] © The Authors, published by EDP Sciences. This is an open access article distributed under the terms of the Creative Commons Attribution License 4.0 (http://creativecommons.org/licenses/by/4.0/). BIO Web of Conferences 30, 05004 (2021) https://doi.org/10.1051/bioconf/20213005004 ILS 2020

As initial explants, shoots of approximately 1.5 cm long were used, which were placed in test tubes (150x160 mm) pre-sterilized with dry heat (150-200°C) with 10 ml of agarized Murashige and Skoog nutrient medium (MS) supplemented with mannitol in concentrations 0.45% (A), 0.75% (B), 1.05% (C), sucrose control 3% and 0.7 mg L-1 6-benzylaminopurine (BAP), 0.1 mg L-1 indole-3-butyric acid (IBA) and 8 g L1 agar-agar (Panreac, Spain), pH 5.7. At this stage, the explants were cultivated for up to 12 months in a Liebherr refrigerator (Germany) at a temperature of 4±2ºC, an illumination intensity of 70-80 μM m2 s-1 and a photoperiod of 8/16 hours. After medium-term depositing, the shoots were transferred to 100 mL glass jars containing 20 mL of MS medium supplemented with 1.0 mg L-1 6- benzylaminopurine (BAP) and 3% sucrose. Evaluation of the regenerative ability (shoot height, number of leaves and number of shoots per explant) of the explants was carried out in the climatic chamber KS-200 (Russia) under standard conditions (24±2ºC, 16-hour photoperiod and illumination of 3000-5000 lux) for three consecutive (after 45 days) subcultures. For statistical analysis, we used the variance analysis, and the averages were compared by the Tukey's (HSD test) test, at a 5% probability, calculated by the Stat Nov. The experimental design was completely randomized. Maintaining the Integrity of the Specifications. 3 Results and discussion As a result of studies it was found that collection samples of berry crops in vitro can be maintained in a viable state for 12 months on specially selected nutrient media. (Fig. 1). 0 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 A B C control % of clones Clones recovered in 1 subcultures black currant strawberry raspberry Fig. 1. The effect of mannitol concentration on the viability of explants of berry crops after 12 months of storage at 4° C When microboots were transferred to standard conditions after medium-term storage at 4±2ºC, the number of shoots capable of regeneration in blackcurrant on a medium with mannitol was 40.3% and 50.1% on a nutrient medium with sucrose. While maintaining garden strawberries, a decrease in viable explants in the nutrient medium with the addition of mannitol to 30.1% was noted compared to control samples – 73.3%. After 12 months, only 5.0% of raspberry shoots on mannitol medium and 25.0% on sucrose were viable. For three passages under standard cultivation conditions, after a medium-term deposit, a change in the morphometric characteristics of berry crops was observed. In strawberry, after deposition on media with different concentrations of mannitol, all studied parameters were lower or at the level of the control variant. No significant differences in shoot height were found in the third subculture in variants A and C. Explants cultivated on medium with mannitol at a concentration of 0.75% (variant B) averaged 2.81 cm in size. The effect of mannitol on leaf formation has also been established. For variety ‘Nashe Podmoskov'e’, the number of leaves in all variants of the experiment varied between 10-13 pieces. For the formation of new shoots, the best results were obtained when the explants were preserved in a medium with sucrose (control) or with mannitol in a reduced concentration of 0.45% (option A) from micrograins developed on average up to 3.10-3.33 pcs. new shoots (Table 1). After transfer to under standard conditions, all black currant explants were capable of active regeneration. A significant effect of mannitol concentration on shoot height and the number of leaves and shoots was established. Mannitol in the medium for medium-term storage had a positive effect on the subsequent regenerative ability of the variety ‘Bryanskiy Agat’ explants, in which the number of regenerated shoots increased with subsequent subculture. The maximum breeding rate (3.80 sprouts per explant) was observed in the 3rd passage of cultivation after the medium with mannitol 0.45%. In addition, mannitol improves the quality of microprobe, increases the number of leaves and the length of shoots (Table 2). It was noted that the addition of mannitol to the nutrient medium at various concentrations reduced the preservation of viable raspberry explants in comparison with the addition of sucrose in relation to other cultures (strawberry and black currant). After 12 months of direct cultivation, the shoots died completely on a medium with mannitol at a concentration of 1.05% (option C). The effect of storage and the concentration of mannitol on the regenerative capacity of explants cultivar ‘Bryanskoe Divo’ shows that the best morphometric indicators were observed in shoots that were obtained during cultivation at storage on a medium with sucrose. When mannitol was introduced into the nutrient medium, it did not reveal its significant effect both on the number of leaves and shoots, and on the size of the shoots; all parameters were lower or within control. It should be noted that after the action of mannitol, inhibition of shoots growth is observed, which can help extend the terms of replantation (Table 3). The results suggest that genotype-affected behaviour when cold-stored cultures were replaced into the multiplication medium under standard conditions. The optimal sources of carbon nutrition (mannitol and sucrose) of the nutrient medium were revealed, which provide a significant positive effect of the restoration of regenerative ability after prolonged storage in vitro: for blackcurrant medium with the addition of mannitol, for wild strawberry and raspberry, the maximum 2 BIO Web of Conferences 30, 05004 (2021) https://doi.org/10.1051/bioconf/20213005004 ILS 2020