Advances in Cancer Biology - Metastasis

N.G. Sannappa Gowda et al. Advances in Cancer Biology - Metastasis 4 (2022) 100029

and also various cytokines [43,44]. These findings indicate that EAC advanced hepatitis as well as breast cancer associated liver injury.
tumor induces pathological changes in mice liver, which mimics changes
in human breast cancer patients’ liver [45]. Declaration of competing interest

It is known that tumor angiogenesis and its harmful comorbid effects The authors declare that they have no known competing financial
are the major perpetrators for cancer associated liver dysfunction [46, interests or personal relationships that could have appeared to influence
47]. Our work demonstrated the similar findings and here, we are pro- the work reported in this paper.
posing that cancer-induced hepatitis may be the possible cause for breast
cancer associated deaths even after the recovery from the therapy with Acknowledgments
supporting evidence from a published study [48]. As already mentioned,
the cancer cells activate angiogenesis by increasing the expression of This work was supported by Ramalingaswami Re-entry fellowship,
MTDH and the secretion of angiogenic growth factors such as VEGF, Department of Biotechnology(DBT), Govt. of India to PS and stipend
PIGF, TNF-α, and TGF-β along with various cytokines [49,50]. Due to support to VS. We thank Dr. SubbaRao V. Madhunapantula and Dr.
these newly formed capillaries already secreted angiogenic factors and Venugopal Reddy Bovilla for providing EAC cells.
cytokines enters the portal circulatory system and via portal vein and
finally reaches to the liver and binds to the specific receptors and activate Appendix A. Supplementary data
various signal transductions. This pathological event further leads to the
activation of hepatic stellate cells, Kupffer cells and mast cells which are Supplementary data to this article can be found online at https
the mediators of hallmarks of hepatic inflammation, fibrosis and in other ://doi.org/10.1016/j.adcanc.2022.100029.
words liver injury [30]. In contrast, the activation of these hepatic stel-
late cells expresses various chemokines which are also the responsible for References
stimulation of angiogenesis, inflammation as well as fibrosis. Whereas,
the complete molecular mechanism of tumor angiogenesis induced [1] K.G. Wakim, Physiology of the liver, Am. J. Med. (1954) 256–271.
hepatitis is not fully understood [31]. Therefore, in this study, we tried to [2] F.C. Schmitt, A. Longatto Filho, J.M. Lopes, Angiogenesis and Breast Cancer, J
deduce the important mechanism and also to explore the possible action
of tumor angiogenesis and its molecular mechanism associated with the Oncol., 2010, p. 576384.
tumor induced hepatitis [Fig. 7]. [3] N. Nishida, H. Yano, T. Nishida, T. Kamura, M. Kojiro, Angiogenesis in cancer, Vasc.

As we found in our in vivo study the liver weight increases with cancer Health Risk Manag. 2 (2006) 213–219.
progression due to inflammation (immune cells infiltration) and associ- [4] S. Ziyad, M.L. Iruela-Arispe, Molecular mechanisms of tumor angiogenesis, Genes
ated fibrosis (collagen fibres accumulation). These pathological changes
hinder the normal physiological function of hepatocytes as well as whole and Cancer 2 (2) (2011) 1085–1096.
liver. This results in liver injury and in support of this our biochemical [5] J. Novotný, M. Zika n, Tumor angiogenesis, Klin Farmakol a Farm 24 (2010)
assays indirectly revealed an increase in serum ALP, AST, ALT and serum
glucose levels in EAC tumor-bearing mice compared to control mice. 124–126.
Another, published study also supported our hypothesis [21]. The [6] L.V. di Bonzo, E. Novo, S. Cannito, C. Busletta, C. Paternostro, D. Povero, et al.,
elevated level of serum liver enzymes activity clearly indicated the liver
damage in EAC tumor-bearing mice. Angiogenesis and liver fibrogenesis, Histol. Histopathol. 24 (2009) 1323–1341.
[7] M. Kukla, A. Gabriel, D. Sabat, Liszka Ł, M. Wilk, M. Petelenz, et al., Association
Based on our histopathological data from H&E staining we found out
that there was an increased infiltration of inflammatory cells in EAC between liver steatosis and angiogenesis in chronic hepatitis, C. Polish J Pathol. 61
tumor bearing mice liver tissue and it was supported by Masson's (2010) 154–160.
trichome staining results which revealed that there was an increased [8] M. Kukla, Angiogenesis: a phenomenon which aggravates chronic liver disease
hepatic fibrosis due to harmful effects tumor angiogenesis [44]. From our progression, Hepatol Int 7 (2013) 4–12.
in vivo it is also evident that the EAC tumor induces peritoneal angio- [9] M. Fern andez, D. Semela, J. Bruix, I. Colle, M. Pinzani, J. Bosch, Angiogenesis in
genesis and it is also involved in the circulation of proangiogenic factors liver disease, J. Hepatol. 50 (2009) 604–620.
which could contribute to the progression of hepatic inflammation and [10] T. Hashimoto, F. Shibasaki, Hypoxia-inducible factor as an angiogenic master
hepatic fibrosis [16]. switch, Front. Pediatr. 24 (2015) 3–33.
[11] I. Zuazo-Gaztelu, O. Casanovas, Unraveling the role of angiogenesis in cancer
From, our bioinformatics analysis it is clearly evident that there is a ecosystems, Front. Oncol. 2 (2018) 8–248.
significant increase in the expression of MTDH and VEGF in breast cancer [12] Y. Liu, X. Kong, X. Li, B. Li, Q. Yang, Knockdown of metadherin inhibits
patient's tissue sample in comparison with health counterparts. Both angiogenesis in breast cancer, Int. J. Oncol. 46 (2015) 2459–2466.
MTDH and VEGF are known markers of tumor angiogenesis [51,52]. We [13] O. Rosmorduc, C. Housset, Hypoxia: a link between fibrogenesis, angiogenesis, and
also observed an increased expression of TNF-α and TGF-β in breast carcinogenesis in liver disease, Semin. Liver Dis. 30 (2010) 258–270.
cancer patient's tissue sample in comparison with their health counter- [14] G. Neufeld, O. Kessler, Pro-angiogenic cytokines and their role in tumor
part's tissue samples. Both, TNF-α and TGF-β are master regulators of angiogenesis, Cancer Metastasis Rev. 25 (2006) 373–385.
inflammation and fibrosis. Overall, increased expression MTDH, VEGF, [15] Z. Momenimovahed, H. Salehiniya, Epidemiological characteristics of and risk
TNF-α and TGF-β in breast cancer may induces pathological events. This factors for breast cancer in the world, Breast Cancer 11 (2019) 151–164.
might further induce the hepatitis like features in breast cancer patients. [16] A.E. El-Kenawi, A.B. El-Remessy, Angiogenesis inhibitors in cancer therapy:
This may be the most possible reason for liver inflammation and fibrosis mechanistic perspective on classification and treatment rationales, Br. J.
in EAC tumor-bearing mice, in contrast which is absent in non EAC mice. Pharmacol. 170 (2013) 712–729.
[17] H.E. Nazario, R. Lepe, J.F. Trotter, Metastatic breast cancer presenting as acute liver
In conclusion, the data presented here shows the development of an failure, Gastroenterol. Hepatol. 7 (2011) 65–66.
evidence based novel mechanism to study the tumor angiogenesis [18] B. Alotaibi, E. Tousson, T.A. El-Masry, N. Altwaijry, A. Saleh, Ehrlich ascites
induced hepatitis by using the mouse mammary carcinoma model which carcinoma as model for studying the cardiac protective effects of curcumin
mimics human breast cancer. In this EAC mice model, we also showed nanoparticles against cardiac damage in female mice, Environ. Toxicol. 36 (2021)
that how tumor angiogenesis contributes to the activation of liver cells 105–113.
and finally leads the development of hepatitis due to infiltration of in- [19] M.L. Salem, N.M. Shoukry, W.K. Teleb, M.M. Abdel-Daim, M.A. Abdel-Rahman, In
flammatory cells as well as collagen accumulation. Therefore, our find- vitro and in vivo antitumor effects of the Egyptian scorpion Androctonus amoreuxi
ings furnish the possible additional evidence that blocking tumor venom in an Ehrlich ascites tumor model, SpringerPlus 5 (2016) 570.
angiogenesis could be a promising therapeutic option in the treatment of [20] S. Mishra, A.K. Tamta, M. Sarikhani, P.A. Desingu, S.M. Kizkekra, A.S. Pandit, et al.,
Subcutaneous Ehrlich Ascites Carcinoma mice model for studying cancer-induced
cardiomyopathy, Sci. Rep. 8 (2018) 1–11.
[21] S. KunduSen, M. Gupta, U.K. Mazumder, P.K. Haldar, P. Saha, A. Bala, Antitumor
Activity of Citrus Maxima (Burm.) Merr. Leaves in Ehrlich's Ascites Carcinoma Cell-
Treated Mice, ISRN Pharmacol., 2011, p. 138737.
[22] J. Li, K. Hu, D. He, L. Zhou, Z. Wang, Y. Tao, Prognostic value of PLXND1 and TGF-
β1 coexpression and its correlation with immune infiltrates in hepatocellular
carcinoma, Front. Oncol. (2021) 604131.
[23] M. Hegde, S.S. Karki, E. Thomas, S. Kumar, K. Panjamurthy, S.R. Ranganatha, et al.,
Novel Levamisole derivative induces extrinsic pathway of apoptosis in cancer cells
and inhibits tumor progression in mice, PLoS One 7 (2012) e43632.
[24] A.H.A. Moustafa, E.M.M. Ali, S.S. Moselhey, E. Tousson, K.S. El-Said, Effect of
coriander on thioacetamide-induced hepatotoxicity in rats, Toxicol. Ind. Health 30
(2014) 621–629.

7

N.G. Sannappa Gowda et al. Advances in Cancer Biology - Metastasis 4 (2022) 100029

[25] X.D. Zhu, Z.Y. Tang, H.C. Sun, Targeting angiogenesis for liver cancer: past, present, [39] G.C. Jagetia, P. Venkatesh, M.S. Baliga, Aegle marmelos (L.) Correa inhibits the
and future, Genes & Diseases 7 (2020) 328–335. proliferation of transplanted Ehrlich ascites carcinoma in mice, Biol. Pharm. Bull.
28 (2005) 58–64.
[26] K.W. Kim, S.K. Bae, O.H. Lee, M.H. Bae, M.J. Lee, B.C. Park, Insulin-like growth
factor II induced by hypoxia may contribute to angiogenesis of human [40] R. Kapoor, D.B. Gundpatil, B.L. Somani, T.K. Saha, S. Bandyopadhyay, P. Misra,
hepatocellular carcinoma, Cancer Res. 58 (1998) 348–351. Anticancer effect of DL-glyceraldehyde and 2-deoxyglucose in Ehrlich ascites
carcinoma bearing mice and their effect on liver, kidney and haematological
[27] M. Mossenta, D. Busato, L. Baboci, F. Di Cintio, G. Toffoli, M.D. Bo, New insight into parameters, Indian J. Clin. Biochem. 29 (2014) 213–220.
therapies targeting angiogenesis in hepatocellular carcinoma, Cancers 11 (2019)
1086. [41] F. Tayel, M.E. Mahfouz, A.F. Salama, M.A. Mansour, Ethoxyquin inhibits the
progression of murine ehrlich ascites carcinoma through the inhibition of
[28] E. Tousson, E. Hafez, M.M. Abo Gazia, S.B. Salem, T.F. Mutar, Hepatic ameliorative autophagy and LDH, Biomedicines 9 (2021) 1526.
role of vitamin Insulin-like growth factor II induced by hypoxia may contribute to
angiogenesis of human hepatocellular carcinoma B17 against Ehrlich ascites [42] C.H. Chu, S.C. Lin, S.C. Shih, C.R. Kao, S.Y. Chou, Fatty metamorphosis of the liver
carcinoma–induced liver toxicity, Environ. Sci. Pollut. Res. 27 (2020) 9236–9246. in patients with breast cancer: possible associated factors, World J. Gastroenterol. 9
(2003) 1618–1620.
[29] T. Tsuchida, S.L. Friedman, Mechanisms of hepatic stellate cell activation, Nat. Rev.
Gastroenterol. Hepatol. 14 (2017) 397–411. [43] D.J. Hicklin, L.M. Ellis, Role of the vascular endothelial growth factor pathway in
tumor growth and angiogenesis, J. Clin. Oncol. 23 (2005) 1011–1027.
[30] P.K. Santhekadur, M. Akiel, L. Emdad, R. Gredler, J. Srivastava, D. Rajasekaran, et
al., Staphylococcal nuclease domain containing-1 (SND1) promotes migration and [44] G. Hu, Y. Wei, Y. Kang, The multifaceted role of MTDH/AEG-1 in cancer
invasion via angiotensin II type 1 receptor (AT1R) and TGFβ signaling, FEBS Open progression, Clin. Cancer Res. 15 (2009) 5615–5620.
Bio 4 (2014) 353–361.
[45] M.A. Hashem, S.B.A. Shoeeb, Y.M. Abd-Elhakim, W.A.M. Mohamed, The antitumor
[31] R. Ma, Y. Feng, S. Lin, J. Chen, H. Lin, X. Liang, et al., Mechanisms involved in activity of Arthrospira platensis and/or cisplatin in a murine model of Ehrlich
breast cancer liver metastasis, J. Transl. Med. 13 (2015) 64. ascites carcinoma with hematinic and hepato-renal protective action, J. Funct.Foods
66 (2020) 103831.
[32] N.M. Al-Rasheed, H.A. Attia, R.A. Mohamad, N.M. Al-Rasheed, M.A. Al-Amin, A. Al-
Onazi, Aqueous date flesh or pits extract attenuates liver fibrosis via suppression of [46] J. Wang, Q. Zhang, D. Wang, S. Yang, S. Zhou, H. Xu, et al., Microenvironment-
hepatic stellate cell activation and reduction of inflammatory cytokines, induced TIMP2 loss by cancer-secreted exosomal miR-4443 promotes liver
transforming growth factor- β 1 and angiogenic markers in carbon tetrachloride- metastasis of breast cancer, J. Cell. Physiol. 235 (2020) 5722–5735.
intoxicated rats, Evidence-Based. Complement. Altern. Med. (2015) 247357.
[47] S. Wienert, D. Heim, K. Saeger, A. Stenzinger, M. Beil, P. Hufnagl, et al., Detection
[33] B. Zhu, N. Lin, M. Zhang, Y. Zhu, H. Cheng, S. Chen, et al., Activated hepatic stellate and segmentation of cell nuclei in virtual microscopy images: a minimum-model
cells promote angiogenesis via interleukin-8 in hepatocellular carcinoma, J. Transl. approach, Sci. Rep. 2 (2012) 503.
Med. 13 (2015) 365.
[48] J.R. Diamond, C.A. Finlayson, V.F. Borges, Hepatic complications of breast cancer,
[34] R.M. Hazem, A.A. Mohamed, N. Ghareb, E.T. Mehanna, N.M. Mesbah, D.M. Abo- Lancet Oncol. 10 (2009) 615–621.
Elmatty, et al., Anti-cancer activity of two novel heterocyclic compounds through
modulation of VEGFR and miR-122 in mice bearing Ehrlich ascites carcinoma, Eur. [49] B.K. Yoo, L. Emdad, S.G. Lee, Z.Z. Su, P. Santhekadur, D. Chen, et al., Astrocyte
J. Pharmacol. (2021) 173747. elevated gene-1 (AEG-1): a multifunctional regulator of normal and abnormal
physiology, Pharmacol. Ther. 130 (2011) 1–8.
[35] M.M. Al-Harbi, S. Qureshi, M. Raza, M.M. Ahmed, A.B. Giangreco, A.H. Shah,
Influence of anethole treatment on the tumour induced by ehrlich ascites carcinoma [50] V. Ankoma-Sey, Y. Wang, Z. Dai, Hypoxic stimulation of vascular endothelial
cells in paw of Swiss albino mice, Eur. J. Cancer Prev. 4 (1995) 307–318. growth factor expression in activated rat hepatic stellate cells, Hepatology 31
(2000) 141–148.
[36] C. Kampf, J. Bergman, P. Oksvold, A. Asplund, S. Navani, M. Wiking, et al., A tool to
facilitate clinical biomarker studies - a tissue dictionary based on the Human [51] K. Zhu, Q. Pan, L.Q. Jia, Z. Dai, A.W. Ke, H.Y. Zeng, et al., MiR-302c inhibits tumor
Protein Atlas, BMC Med. 10 (2012) 103. growth of hepatocellular carcinoma by suppressing the endothelial-mesenchymal
transition of endothelial cells, Sci. Rep. 16 (2014) 5524.
[37] S. Aleffi, I. Petrai, C. Bertolani, M. Parola, S. Colombatto, E. Novo, et al.,
Upregulation of proinflammatory and proangiogenic cytokines by leptin in human [52] M. Zajkowska, E.K. Głazewska, G.E. Be¸ dkowska, P. Chorazy, M. Szmitkowski,
hepatic stellate cells, Hepatology 42 (2005) 1339–1348. S. Ławicki, Diagnostic Power of Vascular Endothelial Growth Factor and
Macrophage Colony-Stimulating Factor in Breast Cancer Patients Based on ROC
[38] M.A. Aldubayan, R.M. Elgharabawy, A.S. Ahmed, E. Tousson, Antineoplastic Analysis, Mediators Inflamm., 2016, p. 5962946.
Activity and Curative Role of Avenanthramides against the Growth of Ehrlich Solid
Tumors in Mice, Oxid Med Cell Longev., 2019, p. 5162687.

8

Advances in Cancer Biology - Metastasis 4 (2022) 100028
Contents lists available at ScienceDirect

Advances in Cancer Biology - Metastasis

journal homepage: www.journals.elsevier.com/advances-in-cancer-biology-metastasis

CDKN2A-positive melanoma patient treated with combination
immunotherapy – A case report

Katarina Zevnik a, Ana Blatnik b, Srdjan Novakovi c c, Ne zka Hribernik d,e,*

a Department of Nuclear Medicine, Institute of Oncology Ljubljana, Ljubljana, Slovenia
b Department of Genetics Counselling, Institute of Oncology Ljubljana, Ljubljana, Slovenia
c Department of Molecular Diagnostics, Institute of Oncology Ljubljana, Ljubljana, Slovenia
d Department of Medical Oncology, Institute of Oncology Ljubljana, Ljubljana, Slovenia
e Faculty of Medicine, University of Ljubljana, Ljubljana, Slovenia

ARTICLE INFO ABSTRACT

Keywords: Germline aberrations in the CDKN2A gene are observed in 20%–40% of families susceptible to melanoma. Pos-
Familiar melanoma itive CDKN2A status is associated with early age of onset of melanoma, multiple primary melanomas, and
CDKN2A mutation pancreatic cancer. We report here a melanoma patient with a germline mutation c.68G>A p.(Gly23Asp) in
BRAF mutation CDKN2A who had a history of multiple cutaneous melanomas and a family history consistent with familial
Immune checkpoint inhibitors atypical multiple mole melanoma (FAMMM) syndrome. He developed oligometastatic disease with BRAF-positive
melanoma metastases in soft tissue and gallbladder and was treated with surgical resection followed by combi-
nation therapy of PD-1 and CTLA-4 immune checkpoint inhibitor, which resulted in good remission. Molecular
analysis of all primary melanomas and both metastatic sites revealed the same BRAF c.1799T>A p.(Val600Glu)
V600E mutations.

1. Introduction immune system by targeting CTLA-4, a protein receptor that down-
regulates T-cell activation pathway. Blocking CTLA-4 allows for
An estimated 5–10% of all cases of cutaneous melanoma are heredi- enhanced T-cell activation and proliferation. Unfortunately, despite
tary. A germline mutation in cyclin-dependent kinase inhibitor 2A relatively good response rates and long-lasting remissions, a high pro-
(CDKN2A) the major susceptibility gene with high penetrance, is iden- portion of patients still do not respond to ICI. Treatment with rapidly
tified in 20–40% of melanoma families. It is associated with early age of accelerated fibrosarcoma homolog B (BRAF) inhibitors (vemurafenib,
melanoma onset, multiple primary melanomas and pancreatic cancers dabrafenib and encorafenib) together with mitogen-activated protein
and worse survival compared to CDNK2A wild-type patients [1–3]. kinase (MEK) inhibitors (cobimetinib, trametinib and binimetinib) rep-
CDKN2A is a tumor suppressor gene on chromosome 9p21 that encodes resents another treatment option for a subgroup of melanoma patients
two cell cycle inhibitors: p16INK4A and p14ARF. Several CDKN2A loss of with mutation in the BRAF gene. This type of treatment is characterised
function mutations are known to be associated with melanoma and by rapid regression of the tumor and the development of secondary
usually result in nonfunctional p16INK4A protein. A large analysis of resistance, usually after about one year of treatment [3].
French families with CDKN2A mutations identified 40 different CDKN2A
mutations in 83 families [2]. Melanoma patients with a CDKN2A mutation are a special subgroup
for whom treatment strategies with new drugs should receive special
Immune checkpoint inhibitors ICI agents targeting programmed cell attention. Loss of CDKN2A function and dysregulation of the p16/reti-
death-1 (PD-1) (pembrolizumab and nivolumab) and cytotoxic T- noblastoma (RB)1 pathway may intrinsically limit the activity of
lymphocyte-associated protein 4 (CTLA-4) (ipilimumab) have revolu- mitogen-activated protein kinase (MAPK)-directed therapy with BRAF
tionised the field of adjuvant and metastatic treatment of melanoma and MEK inhibitors. It may cause primary resistance to BRAF/MEK in-
patients. PD-1 inhibitors mediate immune response against tumor cells hibitor therapy. However, in contrast to the expected detrimental results
by preventing the binding of PD-1 to programmed death ligand-1 (PD-L1) of targeted therapy, the clinical activity of BRAF and MEK inhibitors was
and programmed death ligand-2 (PD-L2). CTLA-4 inhibitors activate the surprisingly no worse than the clinical trial data in an analysis of 19

* Corresponding author. Department of Medical Oncology, Institute of Oncology Ljubljana, Zalo ska 2, SI-1000, Ljubljana, Slovenia.
E-mail address: [email protected] (N. Hribernik).

https://doi.org/10.1016/j.adcanc.2022.100028
Received 18 October 2021; Received in revised form 8 January 2022; Accepted 10 January 2022
Available online 17 January 2022
2667-3940/© 2022 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-
).nc-nd/4.0/

K. Zevnik et al. Advances in Cancer Biology - Metastasis 4 (2022) 100028

patients with germline CDKN2A mutation [4]. Regarding the efficacy of biopsy was performed, but the pathology report described only necrosis.
novel immunotherapies in this subset of melanoma patients, there are The patient was referred to the Institute of Oncology, where a positron
also some available data. In a retrospective analysis of 19 CDKN2A emission tomography-computed tomography (PET/CT) with [18F]2flu-
germline mutation carriers, eleven (58%) patients responded to immune oro-2-deoxy-D-glucose (18F-FDG) (Fig. 1) was performed. It showed an
checkpoint inhibitors. They concluded that a CDKN2A mutation pre- enlarged left inguinal lymph node with high metabolic activity and
dicted a good response to immunotherapy [5,6]. However, another several hypermetabolic centrally necrotic soft tissue masses in the gall-
recent publication found that concurrent CDKN2A mutation and JAK2 bladder. After multidisciplinary tumor board (MDT) discussion, inguino-
deficiency lead to resistance to immunotherapy [7]. iliac lymphadenectomy and cholecystectomy were performed. The his-
tological result showed three melanoma metastases in the gallbladder
We report here a melanoma patient with germline CDKN2A mutation and one metastasis in the left inguinal lymph node (1/6, 6 cm in size).
and multiple primary melanomas and describe how multidisciplinary
treatment of his metastatic disease led to long lasting remission. Molecular diagnosis of the metastasis in the left inguinal lymph node
was performed. Tumor DNA was analyzed using the next generation
2. Case presentation sequencing (NGS) assay TruSight Tumor 170 (Illumina, San Diego, USA),
as described previously [8]. It revealed a BRAF c.1799T>A p.(Val600-
A 40-year-old man presented in 2001 with two suspicious lesions on Glu) V600E mutation and a CDKN2A c.68G>A p.(Gly23Asp) mutation.
his right hand. The patient had both lesions removed, and the histological Other clinically relevant aberrations were excluded, including those
report confirmed two synchronous cutaneous melanomas (the first Bre- affecting JAK2 gene. Additionally, real-time polymerase chain reaction
slow 1 mm, without ulceration and the other Breslow 0.65 mm, without (RT PCR) tests were performed for research purposes and confirmed the
ulceration). Subsequently, a sentinel lymph node biopsy of the right presence of BRAF c.1799T>A p.(Val600Glu) V600E in the patient’s other
axilla was performed, which was negative (0/3). In 2002, another exci- melanoma lesions (Table 1), as described previously [9].
sion of a cutaneous melanoma on the trunk was performed, this time
Breslow 1.5 mm, without ulceration. Sentinel lymph node biopsy of the Following resection, the patient commenced postoperative immuno-
left axilla was negative (0/1). A fourth melanoma was discovered and therapy with nivolumab (1 mg/kg) in combination with ipilimumab (3
surgically removed in 2004; it was a melanoma in situ. The patient mg/kg). The MDT decided to give this patient only three induction appli-
continued with his regular check-ups with his dermatologist. He is known cations of immunotherapy to prevent the patient from being exposed to
to have a germline aberration in the CDKN2A gene c.68G>A further immune-related adverse events (irAEs). He received three appli-
p.(Gly23Asp), as are his sister and daughter, who had cutaneous mela- cations without interruption. During the treatment period, vitiligo-like
nomas at ages 33 and 26, respectively. depigmentation on the patient's forehead and hands CTCAE grade 1, pru-
ritus CTCAE grade 1, and rash CTCAE grade 1 were the only irAEs reported.
After 16 years, he presented at the local hospital with palpable
inguinal lymph nodes and palpable and painful resistance in the right Two months after the last, third application of immunotherapy, the
upper abdomen under the ribs. Ultrasonography of the inguinal lymph patient’s condition was reevaluated with 18F-FDG PET/CT, which
nodes revealed a suspicious lymph node, and biopsy revealed that it was showed no progression of the disease. At the same time, the examination
a metastasis of malignant melanoma. As for the resistance in the upper revealed interstitial consolidations in the lungs, suggestive of immune-
abdomen, ultrasound showed that it could be an infected gallbladder. A related pneumonitis (Fig. 2). The patient reported dry cough and short-
ness of breath when walking long distances in the previous month.

Fig. 1. 18F-FDG PET/CT scan of the patient with
the first presentation of metastatic disease in
2020. Multiple hypermetabolic lesions were seen
in the gallbladder, which later proved to be mel-
anoma metastases histologically. In addition, an
enlarged hypermetabolic lymph node was noted
in the left inguinal region, which was proven to be
a melanoma metastasis. A standardized semi-
quantitative method was used to determine FDG
uptake in the selected lesions. Software maximal
standardized uptake value (SUVmax) was calcu-
lated in the volume of interest (VOI) that was
manually drawn over the lesions. The SUVmax
value in the gallbladder and left inguinal node
was 20.5 and 22.5, respectively. Fused PET/CT
images in coronal, sagittal and transverse planes
at the level of lesions of interest are shown on the
left images. Maximal intensity projection image
(MIP) is shown on the right. A. Fused PET/CT
coronal, sagittal and transverse sections at the
level of the gallbladder. There are multiple hy-
permetabolic lesions in the gallbladder (white
arrows). B. A pathologic lymph node conglom-
erate with high FDG uptake is seen on fused PET/
CT images in multiple planes (white arrows). C.
Maximal intensity projection (MIP) image of the
patient. Metastases in the gallbladder and left
inguinal lymph node are marked with white
arrows.

2

K. Zevnik et al. Advances in Cancer Biology - Metastasis 4 (2022) 100028

Table 1 period, the patient continues to be examined regularly.
Patient’s molecular analysis of all primary melanomas and metastases.
3. Discussion
Date Melanoma lesions Genetic analysis Method
Patients with a germline CDKN2A mutation have a high lifetime risk
January Cutaneous melanoma, BRAF c.1799T>A RT PCR of developing cutaneous melanoma [10]. In addition to counseling
2001 right hand, pT1a p.(Val600Glu) V600E RT PCR regarding protection against UV exposure, skin self-examination, and
Cutaneous melanoma, BRAF c.1799T>A RT PCR regular dermatologic screenings, a more prudent treatment strategy is
March 2001 right hand, pT1aN0 (0/3 p.(Val600Glu) V600E / needed in the case of metastatic disease.
Cutaneous melanoma, BRAF c.1799T>A NGS
December skin of the back, pT2aN0 p.(Val600Glu) V600E Our patient had resected stage IV melanoma with no evidence of
2002 (0/1) RT PCR residual disease. Based on the results of an IMMUNED trial, postoperative
Cutaneous melanoma in Testing not performed therapy with the PD-1 inhibitor nivolumab in combination with the
January situ CTLA-4 inhibitor ipilimumab prolonged recurrence-free survival in this
2004 Left inguinal lymph BRAF c.1799T>A patient group [11]. In particular, patients with BRAF mutations seemed
nodes metastasis p.(Val600Glu)V600E, to benefit especially from combination immunotherapy. On the other
August CDKN2A c.68G>A hand, very high toxicity was observed with this treatment. A total of 82%
2020 Gallbladder metastases p.(Gly23Asp) mutation, of patients had grade 3 or 4 adverse events and 62% of patients had
JAK2 negative discontinued treatment due to adverse events of any grade. Nevertheless,
August BRAF c.1799T>A the high discontinuation rate did not affect tumor control. In our patient,
2020 p.(Val600Glu) V600E molecular diagnostics revealed a BRAF p.(Val600Glu) V600E mutation in
both metastatic lesions, which made him a good candidate for post-
RT PCR: real-time polymerase chain reaction; NGS: next generation sequencing. operative combination immunotherapy. Another reason for the use of
immunotherapy is a report by Helgadottir et al. A retrospective analysis
Additional diagnostic bronchoscopy with biopsy and bronchoalveolar showed a good response of melanoma patients with CDKN2A germline
lavage was performed. The histologic report showed intense active mutation when treated with ICI [5].
chronic interstitial infiltration with inflammatory cells with evidence of
granulomatous inflammation and focal organization consistent with The patient was scheduled to receive only the first three applications of
immune-related pneumonitis. The patient was treated with methyl- immunotherapy to avoid the high risk of severe immune-related side ef-
prednisolone (1 mg/kg/day p.o.) due to CTCAE grade 2 pneumonitis, and fects of prolonged immunotherapy and to account for his lifelong risk of
after several weeks of systemic glucocorticoid therapy, the dyspnea developing new melanomas. Nevertheless, several immune-related skin
improved significantly. toxicities and immune-related pneumonitis were observed. In addition to

Another 18F-FDG PET/CT scan was performed seven months after
discontinuation of ICI treatment (Fig. 3). The examination showed no
signs of progression and good remission of pneumonitis. In the follow-up

Fig. 2. 18F-FDG PET/CT scan after discontinuation
of immunotherapy treatment. Complete remission is
very likely and there is no evidence of progression of
metastatic disease. Bilateral pulmonary infiltrates
with high FDG uptake were noted, consistent with
immune-related pneumonitis, which was later veri-
fied histologically. A. Fused PET/CT images in mul-
tiple planes are shown. The locations of previously
affected metastatic regions seen on baseline scans
are marked with white arrows. There is no evidence
of vital metastatic remnant or disease progression. B.
Fused PET/CT images in different planes in the lung
window, showing multiple bilateral pulmonary in-
filtrates with high FDG uptake (white arrows). C.
MIP images of the patient. Hypermetabolic foci in
the lungs, seen as black patches, are marked with
white arrows.

3

K. Zevnik et al. Advances in Cancer Biology - Metastasis 4 (2022) 100028

Fig. 3. 18F-FDG scan seven months after discontin-
uation of ICI treatment. There is a very good
response to systemic glucocorticoid therapy with
almost complete remission of pneumonitic lung in-
filtrates. There is still no evidence of metastatic
disease elsewhere in the body, with complete
remission of the malignant disease. A. Fused PET/CT
images of the lungs are shown in all three planes.
There is a complete remission of the inflammatory
lung infiltrates. There are no new hypermetabolic
lesions and no evidence of disease progression in the
lungs. B. The inguinal region is shown on the right
image. There are still no lesions with high FDG up-
take seen in the left inguinal region and elsewhere in
the body (coronal and sagittal sections on the left
and middle images). C. MIP image of the patient
shows no new suspicious hypermetabolic foci.

pruritus and rash, the patient developed vitiligo-like depigmentation. It impair the activity of the p16INK4A protein and is listed in the ClinVar
has been reported that vitiligo-like depigmentation during treatment with database as pathogenic/likely pathogenic.
ICIs may be a prognostic factor for better overall survival in patients with
metastatic melanoma. Indeed, a recent cohort study found that patients Molecular testing of all primary melanomas and metastatic lesions in
with BRAF mutations and vitiligo-like depigmentation had a significant our patient (Table 1) confirmed the presence of a BRAF V600E mutation.
survival advantage [12]. In our patient, vitiligo-like depigmentation However, there are reports of some heterogeneity in somatic driver
appeared very early, in the first two months, in the light-exposed areas. mutations in familiar melanomas, sometimes even with different muta-
This could be considered a feature of an effective response to ICI. tion status in the same patient [14–16]. Molecular testing should there-
fore be performed on tissue from a new metastatic lesion at the time of
In recent years, increasing attention has been paid to resistance to progression to adjust systemic treatment.
immunotherapy. In melanoma, it appears to be associated with acquired
IFNγ resistance, which protects tumor cells from cytokine activity. Horn 4. Conclusion
et al. demonstrated that chromosomal losses of the tumor suppressor
CDKN2A in melanoma increase susceptibility to IFNγ resistance through Treatment of patients with familial melanoma with CDKN2A germ-
concomitant deletion of the JAK2 gene. They suggested that patients with line mutation should be individualised due to the very high lifetime risk
chromosomal CDKN2A losses should be screened for JAK2 deficiency of developing cutaneous melanoma. This case report highlights the
prior to ICI treatment, as they are susceptible to developing immuno- importance of multidisciplinary teamwork in the management of this
therapy resistance [13]. NGS examination of our patient's lymph node type of patient and shows that preclinical science plays an important role
metastasis biopsy specimen revealed a known germline CDKN2A in this process. Particular attention should be paid to the analysis of so-
c.68G>A p.(Gly23Asp) mutation with no deletion or inactivating muta- matic mutations, such as the JAK2 mutation.
tions in the JAK2 gene, making him eligible for ICI therapy. If JAK2 gene
deficiency was present, this patient would likely have been better treated Ethics statement
with targeted therapy with BRAF and MEK inhibitors. For this reason, the
detection of somatic mutations by NGS is becoming increasingly Written informed consent was obtained from the individual for the
important to tailor systemic treatment for melanoma patients. The publication of any potentially identifiable images or data included in this
CDKN2A missense variant detected in our patient has been shown to article.

4

K. Zevnik et al. Advances in Cancer Biology - Metastasis 4 (2022) 100028

Founding with germline CDKN2A mutations, J. Med. Genet. 57 (5) (2020) 316–321, https://
doi.org/10.1136/jmedgenet-2018-105610.
This research did not receive any specific grant from funding agencies [6] T.T. DeLeon, D.R. Almquist, B.R. Kipp, B.T. Langlais, A. Mangold, J.L. Winters, et
in the public, commercial, or not-for-profit sectors. al., Assessment of clinical outcomes with immune checkpoint inhibitor therapy in
melanoma patients with CDKN2A and TP53 pathogenic mutations, PLoS One 15 (3)
Author contributions (2020), https://doi.org/10.1371/journal.pone.0230306.
[7] H. Helgadottir, V. Ho€iom, R. Tuominen, K. Nielsen, G. Jo€nsson, H. Olsson, et al.,
All authors contributed to the article and approved the submitted Germline CDKN2A mutation status and survival in familial melanoma cases, J Natl
version. Cancer Inst 108 (11) (2016) 1–8, https://doi.org/10.1093/jnci/djw135.
[8] G. Klan car, A. Blatnik, V. S etraj ci c Drago s, V. Vogri c, V. Stegel, et al., A novel
Declaration of competing interest germline MLH1 in-frame deletion in a slovenian lynch syndrome family associated
with uncommon isolated PMS2 loss in tumor tissue, Genes 11 (3) (2020) 325,
The authors declare that they have no known competing financial https://doi.org/10.3390/genes11030325.
interests or personal relationship that could have appeared to influence [9] A. Bombac, B. Zakotnik, M. Bucic, V. Setrajcic Dragos, B. Gazic, V. Stegel, et al.,
the work reported in this paper. Mutational spectrum and classification of novel mutations in patients with
metastatic gastrointestinal stromal tumours, Int. J. Oncol. 56 (2020) 1468–1478,
Acknowledgements https://doi.org/10.3892/ijo.2020.5028.
[10] S. Puig, J. Malvehy, C. Badenas, A. Ruiz, D. Jimenez, F. Cuellar, et al., Role of the
We express special thanks to Prof. Dr. Dirk Schadendorf, University CDKN2A locus in patients with multiple primary melanomas, J. Clin. Oncol. 23 (13)
Hospital Essen, Essen, Germany for his continuous support. (2005) 3043–3051, https://doi.org/10.1200/JCO.2005.08.034.
[11] L. Zimmer, E. Livingstone, J.C. Hassel, M. Fluck, T. Eigentler, C. Loquai, et al.,
References Adjuvant nivolumab plus ipilimumab or nivolumab monotherapy versus placebo in
patients with resected stage IV melanoma with no evidence of disease (IMMUNED):
[1] M. Rossi, C. Pellegrini, L. Cardelli, V. Ciciarelli, L. Di Nardo, M.C. Fargnoli, Familial a randomised, double-blind, placebo-controlled, phase 2 trial, Lancet 395 (2020)
melanoma: diagnostic and management implications, Dermatol. Pract. Concept. 9 1558–1568, https://doi.org/10.1016/S0140-6736(20)30417-7, 10236.
(1) (2019) 10–16, https://doi.org/10.5826/dpc.0901a03. [12] M. Guida, S. Strippoli, M. Maule, P. Quaglino, A. Ramondetta, V. Chiaron Sileni, et
al., Italian Melanoma Intergroup. Immune checkpoint inhibitor associated vitiligo
[2] E. Maubec, V. Chaudru, H. Mohamdi, C. Blondel, P. Margaritte-Jeannin, S. Forget, and its impact on survival in patients with metastatic melanoma: an Italian
et al., French Familial Melanoma Study Group, Bressac-de Paillerets B, Avril MF, Melanoma Intergroup study, ESMO Open 6 (2) (2021) 100064, https://doi.org/
Demenais F. Familial melanoma: clinical factors associated with germline CDKN2A 10.1016/j.esmoop.2021.100064.
mutations according to the number of patients affected by melanoma in a family, [13] S. Horn, S. Leonardelli, A. Sucker, D. Schadendorf, K.G. Griewank, A. Paschen,
J. Am. Acad. Dermatol. 67 (6) (2012) 1257–1264, https://doi.org/10.1016/ Tumor CDKN2A-associated JAK2 loss and susceptibility to immunotherapy
j.jaad.2012.05.014. resistance, J Natl Cancer Inst 110 (6) (2018) 677–681, https://doi.org/10.1093/
jnci/djx271.
[3] U. Keilholz, P.A. Ascierto, R. Dummer, C. Robert, P. Lorigan, A. van Akkooi, et al., [14] M. Casula, P. Paliogiannis, F. Ayala, V. De Giorgi, I. Stanganelli, M. Mandala , et al.,
ESMO consensus conference recommendations on the management of metastatic Italian Melanoma Intergroup (IMI). Germline and somatic mutations in patients
melanoma: under the auspices of the ESMO Guidelines Committee, Ann. Oncol. 31 with multiple primary melanomas: a next generation sequencing study, BMC Cancer
(11) (2020) 1435–1448, https://doi.org/10.1016/j.annonc.2020.07.004. 19 (1) (2019) 772, https://doi.org/10.1186/s12885-019-5984-7.
[15] B. Jovanovic, S. Egyhazi, M. Eskandarpour, P. Ghiorzo, J.M. Palmer, G. Bianchi
[4] F. Spagnolo, B. Dalmasso, E. Tanda, M. Potrony, S. Puig, R. van Doorn, et al., Scarr a, et al., Coexisting NRAS and BRAF mutations in primary familial melanomas
Efficacy of BRAF and MEK Inhibition in Patients with BRAF-Mutant Advanced with specific CDKN2A germline alterations, J. Invest. Dermatol. 130 (2) (2010)
Melanoma and Germline CDKN2A Pathogenic Variants, Cancers 13 (10) (2021), 618–620, https://doi.org/10.1038/jid.2009.287.
https://doi.org/10.3390/cancers13102440. [16] A. Zebary, K. Omholt, R. van Doorn, P. Ghiorzo, K. Harbst, C. Hertzman Johansson,
et al., Melanoma Genetics Consortium (GenoMEL). Somatic BRAF and NRAS
[5] H. Helgadottir, P. Ghiorzo, R. van Doorn, S. Puig, M. Levin, R. Kefford, et al., mutations in familial melanomas with known germline CDKN2A status: a GenoMEL
Efficacy of novel immunotherapy regimens in patients with metastatic melanoma study, J. Invest. Dermatol. 134 (1) (2014) 287–290, https://doi.org/10.1038/
jid.2013.270.

5

Advances in Cancer Biology - Metastasis 4 (2022) 100030
Contents lists available at ScienceDirect

Advances in Cancer Biology - Metastasis

journal homepage: www.journals.elsevier.com/advances-in-cancer-biology-metastasis

The potential role of U2AF1L4 cDNA 3’ stretch mutations in
oral carcinogenesis

Sapna Khowal, Saima Wajid *

Department of Biotechnology, School of Chemical and Life Sciences, Jamia Hamdard, Hamdard Nagar, New Delhi, 110 062, India

ARTICLE INFO ABSTRACT

Keywords: Background: U2 small nuclear RNA auxiliary factor 1-like protein 4 (U2AF1L4) plays a crucial role in the phys-
OSCC iological alternative splicing of pre-mRNA pools.
U2AF1L4 Material and methods: We analyzed the mutations within U2AF1L4 cDNA 3’ stretch, by Q PCR-Tm calling in cancer
Q PCR-Tm calling and pre-cancer oral biopsies. The conservation of U2AF1L4 across mammals and the binding sites on human
Evolution U2AF1L4 for carcinogens and therapeutants were scrutinized followed by String mediated protein interactome
prediction.
Results: In Q PCR-Tm calling, the U2AF1L4 cDNA 3’ stretch showed amplicons with multiple Tm values in diseased
(pre-cancer and cancer lesions) cDNA pools varying from the control, indicating mutation in the U2AF1L4 cDNA
3’ stretch oral cancer and pre-cancer lesions of addicted cases. The evolutionary analyses showed that human
U2AF1L4 is a highly conserved protein. The molecular docking revealed stable interactions between carcinogens
and therapeutants with human U2AF1L4 respectively. The U2AF1L4 interactome comprised of key splice factors
like SRSF indicating the plausible broad impact of 3’cDNA mutations in altering the global splicing processes of
the oral mucosa.
Conclusions: The U2AF1L4 cDNA 3’ stretch comprising exons 6, 7, and 8 imbibes mutations mediated by tobacco,
areca nut, and alcohol chronic addiction; playing a crucial role in oral precancer-cancer pathophysiologies.

1. Introduction composition of the oral epithelia. The induced mutations may alter the
expression level of crucial genes; also, canonical sequence of transcripts
Oral malignancy is a complex chronic disease characterized by & encoded proteins may get changed causing the synthesis of
abnormal cell-cycle attributes imbibed by the cellular frame forming the non-canonical counterparts which may surpass the physiological path-
oral cavity [1]. By GLOBOCAN 2012, oral cancers accounted for nearly ways governing the cellular homeostasis of the oral cavity, thereafter
1.5 lakhs of deaths and three lakhs of newly diagnosed cases globally [2]. leading to a molecular microenvironment benefitting the genesis of the
Following GLOBOCAN 2018, oral cancers caused nearly 1.7 lakhs of oral pre-malignant and malignant conditions [1,5].
deaths and 3.5 lakhs of newly diagnosed cases globally [3]. The incidence
rate of oral cancers is double the mortality rate; implicating an elevated The Homo sapiens gene U2 small nuclear RNA auxiliary factor 1-like
risk of oral malignancies worldwide where less developed countries protein 4 (U2AF1L4) located at 19q13.12 comprises ten exons (NCBI
suffer twice the incidence rate than developed countries [2]. Though the Gene database). By Ensembl, the canonical transcript of U2AF1L4
exact molecular routes affected during oral carcinogenesis are still comprising eight exons encodes for the U2AF1L4 protein constituting
obscure, the well-known environmental aetiologies associated with oral 220 amino acids (a.a.). U2AF1L4 has protein & RNA-interacting domains
malignancies include addictive proclivities for fallacious habits namely and functions as the critical pre-mRNA splicing factor in constitutive and
tobacco chewing, areca-nut chewing, tobacco smoking, and alcohol enhancer-dependent splicing, assuring accurate 3'-splice site [6].
intake. Additionally, the high-risk subtypes of Human papillomavirus Conjointly, U2AF1L4 regulates the alternative pre-mRNA splicing, lead-
(HPV) especially HPV16 may associate with oral mucosa and induce ing to non-canonical transcripts of varying genes. In the T-cell activation
carcinogenesis [1,4]. Tobacco, areca-nut, and alcohol contain numerous process, U2AF1L4 causes exon 5 skipping in the pre-mRNA transcript of
genotoxins and carcinogens that may induce mutations in the genomic the Protein Tyrosine Phosphatase Receptor Type C (PTPRC) gene, resulting
in the non-canonical transcript [7]. The mutations in the splicing factors

* Corresponding author.
E-mail address: [email protected] (S. Wajid).

https://doi.org/10.1016/j.adcanc.2022.100030
Received 19 July 2021; Received in revised form 24 January 2022; Accepted 25 January 2022
Available online 29 January 2022
2667-3940/© 2022 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-
).nc-nd/4.0/

S. Khowal, S. Wajid Advances in Cancer Biology - Metastasis 4 (2022) 100030

have an association with oral carcinogenesis [8]. Serine/arginine-rich PCR reactions were performed in duplicates. The RNA and cDNA samples
splicing factor 3 (SRSF3) performs oncogenic roles in oral malignancies were stored at À80 C. The U2AF1L4 cDNA sequence (accession id:
by hampering the auto-regulation and causing overexpression in SRSF5 ENST00000412391.6) was retrieved from Ensembl. The primers for
[9]. The increased expression of U2AF1 has been recently reported in the U2AF1L4 cDNA 5’ stretch and U2AF1L4 cDNA 3’ stretch was designed
oral potentially malignant diseases and oral cancers [10]. The exact role followed by in silico PCR using MFE primer 2.0 (Table 2). The target region
of U2AF1L4 in oral carcinogenesis has been still obscure. The present U2AF1L4 cDNA 5’ stretch (78 bp) comprised of exon-2 & exon-5 junction
work reports the presence of mutations in the 3’ end of U2AF1L4 cDNA and the exon-5 sequence till the 67th nucleotide residue (Supplementary
pool of precancer and cancer lesions of the oral cavity in clinical cases file S1: figure S1.1). The target region U2AF1L4 cDNA 3’ stretch (158 bp)
suffering from addiction history for tobacco, areca nut, and/alcohol. comprised of 3’ end of exon-6, complete exon-7, and 5’ end of exon-8
Also, the functional significance of the 3’ variations was computationally (Supplementary file S1: figure S1.1). The Q-PCR assay was performed
scrutinized by performing (i) analyses for evolutionarily conserved res- with cDNA samples and specific primers for the normalizer gene [11] and
idues composing the canonical U2AF1L4 protein across the species of the target of interest. GAPDH was used as the normalizer gene while
class Mammalia; (ii) molecular docking analyses of the human U2AF1L4 U2AF1L4 cDNA 5’ stretch (78 bp) and U2AF1L4 cDNA 3’ stretch (158 bp)
with ligands including tobacco, areca-nut & alcohol-specific carcinogens, were analyzed separately. The Q-PCR assay was performed on
and plant-based therapeutants; and (iii) prediction of protein inter- Light-Cycler 480 (Roche) using 10 μl reactions constituting of 1 μl cDNA
actome of the human U2AF1L4. (fivefold dilution), 1 μl of specific forward and reverse primers (0.5 μM), 5
μl of 2X SYBR green master mix (Fermantas), and 2 μl nuclease-free water.
2. Methods The reaction configurations were: (i) pre-incubation: 95 C for 10 min; (ii)
amplification: 52 cycles of denaturation (95 C for 30 s), annealing (62 C
2.1Ethical statement for 30 s), and extension (70 C for 60 s); (iii) melting: 58 C–95 C; (iv)
cooling: 37 C for 5min. For assuring reproducibility, each Q-PCR assay
The study plan was approved by the Jamia Hamdard Institutional was performed twice and all reactions were conducted in triplicates. The
Ethics Committee (Hamdard University, INDIA). The patient’s consent Light cycler 480 software version 1.5 was used for performing melting
for participation was taken before sample collection. The study involved temperature analyses or Tm calling for the amplicons generated by
cases suffering from persistent oral lesions and positive addiction history primer-specific amplification reactions during Q-PCR.
for tobacco, areca-nut, and/or alcohol intake. The patients involved
attended the Out-patient Department of ENT (HAH Centenary Hospital, 2.3. Evolutionarily consanguinity of U2AF1L4 canonical protein among
HIMSR). The pathological conditions of oral diseased lesions were his- the species of class mammalia
topathologically identified as chronic inflammation (four cases), leuko-
plakia (two cases), and oral squamous cell carcinoma-moderately The fasta sequences of the canonical U2AF1L4 protein from forty-
differentiated (two cases). The oral diseased lesions were histopatho- seven mammalian species were retrieved from the protein database
logically grouped as pre-cancer and cancer conditions. The clinical (NCBI). The mammalian species constituted the taxonomic Orders
samples contributed by cases constituted of diseased lesions (patient oral namely Artiodactyla, Carnivora, Cingulata, Didelphimorphia, Diproto-
biopsy: POB) and adjacent visibly normal tissues (ANT). Table 1 show- dontia, Eulipotyphla, Primates, Proboscidea, and Rodentia (supplemen-
cases the details of participating cases. The U2AF1L4 nucleotide and tary file S2: table S2.1). The retrieved fasta sequences were subjected to
amino acid sequences, used in the given work, were retrieved from the multiple sequence alignment by ClustalW using MEGA10.1.7 [12]. The
Ensembl and NCBI databases. phylogenetic relationship between full-length or canonical U2AF1L4
protein sequences across the Mammalia was performed by the UPGMA
2.2. Q-PCR assay and Tm calling method using MEGA10.1.7 [12]. The evolutionary distances were
computed using the Poisson correction method [13]. The phylogeny was
The total RNA preparation from oral tissue samples and quality tested by a bootstrap method employing 1000 bootstrap replications
assurance (using beta globulin-specific primers) was performed [11]. 400 [14]. The conservation scores were evaluated by the Scorecons program
ng total RNA template was subjected to cDNA synthesis using the using the Valdar01 method (with option: for only positions relating to the
First-strand cDNA synthesis kit (Fermantas). The cDNA integrity was sequence) [15,16]. The analysis for U2AF1L4 residues conserved across
checked by performing PCR using GAPDH cDNA-specific primers [11]. All the taxonomic class Mammalia was performed using the Protein

Table 1
The details of the paired samples used in the given work. The OSCC MD corresponds to cases with moderately differentiated OSCC pathologies respectively. POB
represents patient oral biopsy; ANT indicates adjacent normal tissue of the diseased oral lesion. I_4 N sample was used as the control.

S. No. Samples Patient code Age/Gender History of addictive proclivities Conditions Groups

Chewing Smoking Alcohol

1 I_3 N OC.020517 60 y/M 45y 45y 45y ANT Chronic inflammation
Chronic inflammation
I_3T OC.020517 60 y/M 45y 45y 45y POB Chronic inflammation
Chronic inflammation
2 I_4 N* OC.230217.2 20 y/M 2y No No ANT Chronic inflammation
Chronic inflammation
I_4T OC.230217.2 20 y/M 2y No No POB Chronic inflammation
Chronic inflammation
3 I_5 N OC.230217.1 36 y/M 20y 10y No ANT Leukoplakia
Leukoplakia
I_5T OC.230217.1 36 y/M 20y 10y No POB Leukoplakia
Leukoplakia
4 I_7 N OC.030414.1 32 y/M 5y 5y No ANT OSCC MD
OSCC MD
I_7T OC.030414.1 32 y/M 5y 5y No POB OSCC MD
OSCC MD
5 L_1 N OC.28042014 52 y/M No 35y 12y ANT

L_1T OC.28042014 52 y/M No 35y 12y POB

6 L_2 N OC.230215 40 y/M 16y No No ANT

L_2T OC.230215 40 y/M 16y No No POB

7 VIII_10 N OC.100317 60 y/F No 25y No ANT

VIII_10T OC.100317 60 y/F No 25y No POB

8 VIII_12 N OC.231216 34 y/M 20y 5y No ANT

VIII_12T OC.231216 34 y/M 20y 5y No POB

2

S. Khowal, S. Wajid Advances in Cancer Biology - Metastasis 4 (2022) 100030

Table 2
The detail of the used primer sets.

Genes Template Primer Amplicon Length Amplicon Sequence Ta References
(bp) ( C) [50,51]
β-globin gDNA GH20: GAAGAGCCAAGGACAGGTACGGCTGTCATCACTT 56
GAAGAGCCAAGGACAGGTAC 268 AGACCTCACCCTGTGGAGCCACACCCTAGGGTTG [52]
PC04: CAACTTCATCCACGTTCACC GCCAATCTACTCCCAGGAGCAGGGAGGGCAGGAG 58
CCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCAT [53]
GAPDH cDNA Forward: 496 CTATTGCTTACATTTGCTTCTGACACAACTGTGTT 62 This study
CAAGGTCATCCATGACAACTTTG CACTAGCAACCTCAAACAGACACCATGGTGCACC This study
Reverse: TGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCT
GTCCACCACCCTGTTGCTGTAG GTGGGGCAAGGTGAACGTGGATGAAGTTG
CAAGGTCATCCATGACAACTTTGGTATCGTGGAA
GAPDH cDNA (Q- Forward: 72 GGACTCATGACCACAGTCCATGCCATCACTGCCA
PCR) GCCACATCGCTCAGACACCAT 78 CCCAGAAGACTGTGGATGGCCCCTCCGGGAAACT
Reverse: 158 GTGGCGTGATGGCCGCGGGGCTCTCCAGAACATC
ACCAGGCGCCCAATACG ATCCCTGCCTCTACTGGCGCTGCCAAGGCTGTGG
Forward: GCAAGGTCATCCCTGAGCTGAACGGGAAGCTCAC
CATTCAGCCAGGAGGTGTTCAC TGGCATGGCCTTCCGTGTCCCCACTGCCAACGTG
Reverse: TCAGTGGTGGACCTGACCTGCCGTCTAGAAAAAC
CAAGGTTGTCGCACACATTCATCT CTGCCAAATATGATGACATCAAGAAGGTGGTGAA
Forward: GCAGGCGTCGGAGGGCCCCCTCAAGGGCATCCTG
AGCTGTCTCCTGTCACTGACTTC GGCTACACTGAGCACCAGGTGGTCTCCTCTGACT
Reverse: TCAACAGCGACACCCACTCCTCCACCTTTGACGCT
GGGTGACCTGCGCCTGGGT GGGGCTGGCATTGCCCTCAACGACCACTTTGTCA
AGCTCATTTCCTGGTATGACAACGAATTTGGCTAC
AGCAACAGGGTGGTGGAC
GCCACATCGCTCAGACACCATGGGGAAGGTGAAG
GTCGGAGTCAACGGATTTGGTCGTATTGGGCGCC
TGGT

U2AF1L4 cDNA 5’ cDNA (Q- CATTCAGCCAGGAGGTGTTCACAGAACTGCAGGA 62
stretch PCR) GAAGTATGGGGAGATTGAAGAGATGAATGTGTGC
GACAACCTTG

U2AF1L4 cDNA 3’ cDNA (Q- AGCTGTCTCCTGTCACTGACTTCCGGGAGTCATG 62
stretch PCR) CTGTCGCCAGTATGAGATGGGGGAATGTACCCGA
GGTGGCTTCTGCAACTTCATGCATCTGCGGCCCA
TTTCCCAGAACCTCCAGAGGCAGCTCTATGGGCG
GGGACCCAGGCGCAGGTCACCC

Variability Server (Health Sciences Library System, University of Pitts- indicating both functional and physical protein associations, was gener-
burgh) [17,18]. ated at the minimum required interaction score of 0.900 (highest con-
fidence). The network was built using active interaction sources namely
2.4. Molecular docking of human U2AF1L4 canonical protein with text mining, experiments, databases, co-expression, neighbourhood, gene
tobacco, areca-nut, and alcohol-based carcinogens fusion, and co-occurrence.

The three-dimensional (tertiary) structures were designed on the 3. Results
PHYRE2 Protein Fold Recognition Server and structure validation was
performed using ProSA [19–21]. The ligand structures were retrieved in 3.1. Q-PCR assay and Tm calling
*.sdf format from the Pubchem database (NCBI) followed by conversion
to docking compatible *.mol2 format using OpenBabel tool [22]. The total RNA samples showed A260/A280 (purity) between 1.8 and
Three-dimensional structures of the human U2AF1L4 canonical protein 2.0. The absence of 268bp amplicon in the reaction products, amplified
(*.pdb structure) and ligands (*.mol2 format) were subjected to ‘stable using total RNA and GH20/PC04 primer set, confirmed the absence of
docking’ using iGEMDOCK software version 2.1 [23]. The eighteen genomic DNA in the extracted total RNA samples. The presence of 496bp
carcinogens & two therapeutants were analyzed for binding sites on the amplicon in the reaction products, amplified using cDNA (synthesized
protein. The tobacco specific carcinogens were namely 1-hydroxypyrene using 400 ng of normalized total RNA) samples and GAPDH cDNA spe-
[24,25], 4-nitroquinoline n-oxide (4-NQO) [24,26], 4-(methylni- cific primers, confirmed PCR compatibility of synthesized cDNA samples
trosamino)-1-(3-pyridyl)-1-butanone (NNK) [24,27], N'-nitro- (supplementary file S1: figure S1.2). The Q-PCR assays including the
sonornicotine (NNN) [24,27], and nicotine 23-(methylnitrosoamino) normalizer gene (GAPDH) and the target of interest (U2AF1L4 cDNA 5’
propionitrile [28], 3-(methylnitrsoamino)propionaldehyde [28]. The stretch or U2AF1L4 cDNA 3’ stretch) were performed twice, using cDNA
alcohol specific carcinogens were namely acetaldehyde [29,30], benzene samples of oral biopsies and specific primers (Table 2), on the Light
[29,30], acrylamide [29,30], ethanol [29,30], furan [29,30], aflatoxin Cycler 480 instrument (Roche). The Tm calling was accomplished using
B1 [29,30]; N-nitrosodimethylamine [29,30], 4-methylimidazole [29, Light Cycler 480 software version 1.5 (Roche). The obtained Tm values
30], ethyl carbamate [29,30]. The plant-based therapeutants were for the Q-PCR assays: GAPDH-U2AF1L4 cDNA 5’ stretch and GAPDH-
beta-carotene [31] and hesperidin [32]. U2AF1L4 cDNA 3’ stretch have been shown in the supplementary file S3
(table S3.1, table S3.2, table S3.3, and table S3.4).
2.5. Interactome analysis
In the Q-PCR assay, GAPDH - U2AF1L4 cDNA 5’ stretch, the Tm values
The network constituting of interacting protein partners for U2AF1L4 of amplicons generated using GAPDH specific primers (normalizer gene)
was generated using STRING V11 [33]. The full network, with the edges and control - diseased cDNA samples were observed to be ~80 C (Tm1)
(supplementary file S3: table S3.1). The diseased samples constituted of

3

S. Khowal, S. Wajid Advances in Cancer Biology - Metastasis 4 (2022) 100030

cDNA prepared from (i) total RNA sample of the chronic inflammatory most distant mammals were Orangutan, Lesser hedgehog, Dolphin, and
oral lesion (I_4T) of case I_4 (addiction history of 2y) and (ii) total RNA Shrew.
samples of paired biopsies comprising lesion (POB) - adjacent visibly
normal tissue (ANT) of three cases of chronic inflammation (addiction The ‘diversity of position scores’ evaluated by the ScoreCons program
history of 5 to 45y), (iii) total RNA samples of paired biopsies comprising was 80.1%, an indication of highly diverse and informative alignment to
lesion (POB) - adjacent visibly normal tissue (ANT) of two cases of leu- identify crucial residues conserved during evolution [15,16]. The ‘con-
koplakia (addiction history of 16–35 y), (iv) total RNA samples of paired servation scores’ for each position ranged between 0 (unconserved res-
biopsies comprising cancer lesion (POB) - adjacent visibly normal tissue idue) and 1 (highly conserved residue) (Fig. 2). Out of 220, only 110
(ANT) of two OSCC cases (addiction history of 20 to 25y). The control positions (50%) showed conservation scores 0.5 and 58 positions
cDNA was prepared from the ANT (I_4 N) of the case I_4. The Tm values (26.3%) showed the score !0.7 amongst which 26 positions (11.8%)
of amplicons generated using U2AF1L4 cDNA 5’stretch specific primers showed the score >0.9 [16]. The value of the conservation score evalu-
(target of interest: 78bp) and control - diseased cDNA samples were ~77 ated for each amino acid position has been tabulated in the supplemen-
C (Tm1) (supplementary file S3: table S3.2). tary file S4 (table S4.1).

In the Q-PCR assay, GAPDH - U2AF1L4 cDNA 3’ stretch, the Tm values The evolutionarily conserved backbone of mammalian canonical
of amplicons generated using GAPDH specific primers (normalizer gene) U2AF1L4 was identified by PVS (supplementary file S5: figure S5.1). The
and control - diseased cDNA samples were observed to be ~80 C (Tm1) paired alignment (Clustal omega) of conserved mammalian and Homo
(supplementary file S3: table S3.3). The amplicons generated using sapiens canonical U2AF1L4 protein sequences revealed nearly 91% of
U2AF1L4 cDNA 3’stretch specific primers (target of interest: 158 bp) and percent identity (figure S5.2). The Homo sapiens canonical U2AF1L4
control - diseased cDNA samples showed varying Tm values (supple- evolutionarily conserved regions comprised of five motifs (containing
mentary file S3: table S3.4). For the cDNA sample of I_4 N (control), the residues >6; M_1 to M_5) and nine amino acid stretches (constituting one
amplicons generated using U2AF1L4 cDNA 3’ stretch specific primers to five amino acids; R1 to R9) (supplementary file S5: table S5.1). By
showed a single Tm value of ~76 C (Tm1). While, for the cDNA sample Uniprot, the human canonical U2AF1L4 protein contains two zinc fingers
of I_4T (inflamed oral lesion of the case with 2y of addiction history), the (ZF) namely (i) ZF1: N-terminus C3H1-type 1 (Glu12 to Pro40), (ii) ZF2:
amplicons generated using U2AF1L4 cDNA 3’stretch specific primers C-terminus C3H1-type 2 (Asp149 to Pro176). The middle region
showed multiple Tm values higher than ~76 C (Tm value observed for sequence (Ser65 to Val147) constitutes an RRM domain (Supplementary
the control); implicating to the presence of multiple types of U2AF1L4 file S1: figure S1.3). These three regions of the canonical protein
cDNA 3’ stretches in the U2AF1L4 cDNA pool of I_4T. For the cDNA comprised >95% of conserved residues (Table 3). The sequences at the
samples of POB and ANT of two OSCC addicted cases (VIII_10 and N-terminus, and sandwiching between ZFs and RRM domain were highly
VIII_12), the amplicons showed multiple Tm values higher than ~76 C conserved (100%). On the contrary, the sequence at the C-terminus was
(Tm value observed for control); indicating the ubieties of numerous <70% conserved. All residues encoded by seven exon-exon junctions
types of U2AF1L4 cDNA 3’ stretches in the U2AF1L4 cDNA pools of both (composing of both overlapping and non-overlapping junctions; EJ_1 to
POB and ANT of the addicted OSCC cases. The amplicons generated using EJ_7) were highly conserved (supplementary file S5: table S5.1). In the
cDNA samples, prepared from POB and ANT, of two addicted leukoplakia non-overlapping exon-exon junction of a processed/mature transcript, the
cases (L_1 and L_2) and U2AF1L4 cDNA 3’stretch specific primers showed 3’ codon of the predecessor exon and the 5’codon of the successor exon
Tm value higher than ~76 C (Tm value was of the control); uncovering separately encode an amino acid. In the overlapping junction, the 3’ nu-
the disparity existent within the U2AF1L4 cDNA 3’ stretch of U2AF1L4 cleotide(s) of the predecessor exon and the 5’ nucleotide(s) of the suc-
cDNA pool expressing in the POB and ANT of oral pre-cancer cases. The cessor exon jointly form a single codon that further encodes an amino
amplicons generated using cDNA samples, prepared from POB and ANT, acid. The conserved exon-exon junction (EJ) residues were as followed:
of three addicted chronic inflammation cases (I_3, I_5, and I_7) and Lys-15 (EJ_1); Gln-44 & Thr-45 (EJ_2); Cys-67 (EJ_3); Glu-83 & Glu-84
U2AF1L4 cDNA 3’stretch specific primers showed Tm value higher than (EJ_4); Lys-116 & Phe-117 (EJ_5); Gly-161 (EJ_6); Arg À193 (EJ_7).
~76 C (Tm value was of the control); indicating the variations present The EJ_1, EJ_3, EJ_6, and EJ_7 residues were encoded by the overlapping
within the U2AF1L4 cDNA 3’ stretch of U2AF1L4 cDNA pool expressed in exon-exon junctions while the EJ_2, EJ_4, and EJ_5 residues were enco-
the POB and ANT of oral pre-cancer cases. ded by the non-overlapping exon-exon junctions. The N-terminus region
of Homo sapiens canonical U2AF1L4 protein comprised more conserved
Hence, the U2AF1L4 cDNA 3’ stretch may play a crucial association residues than the C-terminus region.
with oral squamous cell carcinoma and oral pre-cancer pathologies.
Further, the exons 6, 7 & 8, comprising the U2AF1L4 cDNA 3’stretch may 3.3. Molecular docking of human U2AF1L4 protein with tobacco, areca-
suffer high susceptibility towards the mutagenic changes induced by nut and alcohol-based carcinogens
tobacco, areca nut, and/or alcoholic products.
The three-dimensional structure of human U2AF1L4 protein was
3.2. Evolutionary consanguinity of U2AF1L4 canonical protein among the modelled for 176 (80%) residues with more than 90% accuracy using
species of class mammalia Phyre2. The fold template c4yh8A (splicing factor u2af 23 kDa subunit of
yeast) was selected to model the protein based on heuristics to maximize
The multiple alignments of the U2AF1L4 canonical protein sequence confidence (100%), percentage identity (55%), and alignment coverage
of forty-seven mammalian species were used to generate the phyloge- (15–189 residue; 79% coverage). 45 residues were modelled by ab initio.
netic tree using the UPGMA method on MEGA 10. The optimal tree with The three-dimensional structure was validated with z-score À6.34 on
the sum of branch length ¼ 1.28 has been shown in Fig. 1. The percentage ProSA. The molecular docking between ligands and modelled human
of replicate trees in which the associated taxa clustered together in the U2AF1L4 canonical protein was accomplished on iGEMDOCK. The
bootstrap test (1000 replicates) has been shown next to the branches interacting residues and negative free energy (NFE) or total binding en-
[14]. The tree was drawn to scale, with branch lengths in the same units ergy (TBE) of each protein-ligand interaction have been shown in
as those of the evolutionary distances used to infer the phylogenetic tree. Table 4. The key residues interacting with OSCC carcinogens included
The evolutionary distances were computed using the Poisson correction Cys-18, Phe-20, Tyr-21, Cys-27, Cys-33, Arg-35, Leu-51, Tyr-52, Arg-53,
method [13] and were in the units of the number of amino acid sub- Asn-54, Asn-57, Gln-60, Glu-95, Glu-97, Asp-103, Asn-104, Gly-106, His-
stitutions per site. All ambiguous positions were removed for each 108, Val-110, Gly-111, Arg-118, Phe-135, Asn-136, and Gln-138, Gly-
sequence pair (pairwise deletion option). There was a total of 467 posi- 166, Cys-169, Asn-170, Tyr-186, Arg-191, Pro-195, His-215, Phe-220.
tions in the final dataset. The U2AF1L4 of Homo sapiens shared the The key residues interacting with OSCC therapeutants included Glu-3,
smallest evolutionary distance with Bonobo, and Chimpanzee while the Tyr-4, Phe-86, Glu-97, Glu-98, Lys-116, Arg-118, Gln-182, Tyr-186,

4

S. Khowal, S. Wajid Advances in Cancer Biology - Metastasis 4 (2022) 100030

Fig. 1. The phylogenetic relatedness of full-length U2AF1L4 expressed in Homo sapiens and other mammals, analyzed using MEGA10.1.7. The amino acid
sequences of canonical (or full length) U2AF1L4 from varying mammalian species were aligned using ClustalW inbuilt in the MEGA software. The optimal tree has
been shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches.

Fig. 2. The scattered plot of conservation scores calculated for each amino acid residue position using the alignment of sequence of mammalian U2AF1L4
canonical proteins on the ScoreCons program. Shown are the conservation scores for the residue positions with the spot colored according to the exonic peptides
(Ex-1 to Ex-8) encoded from mammalian U2AF1L4 mRNA and the overlapping exon-exon junctions (J, red). The score ranges from 0 for unconserved to 1 for highly
conserved residues. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

His-209, Cys-211, Ser-212, Pro-213, His-215 (the underlined residues ZF2. The areca-nut specific carcinogens arecaidine, n-nitrosoguavaco-
were not conserved across evolution). Fig. 3 displays the best dock poses line, 3-(methylnitrosoamino) propionitrile bound with the ZF1 at the
of the ligands on the human U2AF1L4 protein. The tobacco-specific same binding site; arecoline and 3-(methylnitrsoamino) propionalde-
carcinogens NNK, NNN, and nicotine interacted with the RRM domain hyde showed binding with the RRM domain. The alcohol-specific car-
at the same binding site; the 4NQO interacted with ZF1 while 1- cinogens acetaldehyde, benzene, acrylamide, furan, n-
hydroxypyrene interacted with residues comprising the RRM domain and nitrosodimethylamine, 4-methylimidazole, and ethyl carbamate

5

S. Khowal, S. Wajid Advances in Cancer Biology - Metastasis 4 (2022) 100030

Table 3
List of functional regions comprising the Homo sapiens U2AF1L4 protein. The green and blue colour residues represent alter-
nated exonic peptide 1 to 8. The residues highlighted in red font colour represent the residue encoded from the codon of overlapping
splice site. The underlined residues in represent non-conserved residues.

interacted with residues of the same/similar binding site formed at the network suggests that the mutations in U2AF1L4 may affect its binding
interface of the RRM domain and ZF2. Ethanol bound at the RRM domain with other splice proteins thereby hindering or modulating the alternate
while aflatoxin B1 bound at the binding site comprising residues from the splicing process in the affected cells at a cumulative/global cellular level.
RRM domain and ZF2. The therapeutant beta carotene bound to residues
of the RRM domain and both zinc fingers while hesperidin interacted 4. Discussion
with residues of the RRM domain and ZF2. Amongst, carcinogens the TBE
ranged between À12 and À97 kcal/mol while for therapeutants the Oral cancer is an aggressive form of malignancy associated with
range was À115.52 to À123.48 kcal/mol. The therapeutants showed chronic inflammation and immune suppression. The management of oral
higher TBE than carcinogens. cancers is challenging due to delayed diagnosis and early recurrence.
Despite rigorous research worldwide the genetic basis for the genesis of
3.4. Interactome analysis oral cancers is abstruse yet. OSCC, the highly prevalent form of oral
malignancy, arises from the oral epithelia. The oral pre-cancer conditions
Ten interacting protein partners predicted for U2AF1L4 were as fol- are easily treatable and their early detection may allow blocking its
lowed BUD31 (score 0.997), HNRNPA1 (0.984), PRPF19 (0.962), PRPF8 progression to cancerous form. The analyses of genetic mutations con-
(0.961), SF3A1 (0.959), SF3B1 (0.955), SRSF1 (0.955), SRSF2 (0.954), current to oral pre-cancer and cancer conditions may contribute to the
SRSF3 (0.953), and U2AF2 (0.953) (Fig. 4). The biological processes early diagnosis or even prognosis of these oral pathologies in the people
associated with the network proteins were as followed mRNA splicing, at risk (exposure to the aetiologies) [34].
via spliceosome (false discovery rate 2.96E-18), regulation of RNA
splicing (5.15E-12), regulation of mRNA splicing, via spliceosome Primary RNA splicing is a quintessential step in eukaryotic gene
(9.56E-11), RNA export from nucleus (1.92E-09), mRNA transport expression. The splicing proteins work on the primary RNA by trimming
(3.14E-09), mRNA 3'-end processing (1.27E-08), mRNA export from introns and withholding a specific array of exons that result in mature
nucleus (4.70E-08), spliceosomal complex assembly (3.87E-07), ribo- RNA that further undergoes translation into the desired protein or the
nucleoprotein complex assembly (6.72E-07), positive regulation of RNA mRNA may serve as the functional entity (RNA genes). Deregulations of
splicing (7.48E-06), regulation of alternative mRNA splicing, via spli- the splicing process cause non-physiological quality and quantity of
ceosome (1.69E-05), spliceosomal tri-snRNP complex assembly mature RNAs, thereby culminating in chaos in the cellular proteome.
(0.00023), cellular protein localization (0.00034), macromolecule Aftermaths of mutations in the genes encoding for splicing proteins are
localization (0.00046), regulation of gene expression (0.00049), mRNA precarious and may associate with fatal malignancies [35]. The deregu-
splice site selection (0.00097), regulation of RNA metabolic process lated splicing process produces alternately spliced non-physiological
(0.0015), positive regulation of nucleobase-containing compound mRNAs that may encode a non-physiological protein or may lose
metabolic process (0.0093), positive regulation of macromolecule protein-encoding potentials (non-coding RNA). The genesis and pro-
metabolic process (0.0178), positive regulation of RNA metabolic pro- gression of OSCC are associated with non-physiological alternate splicing
cess (0.0434). The core molecular function affected by the network of primary RNAs transcribed from genes [36]. The eukaryotic splicing
proteins was pre-mRNA 3’ splice site binding, pre-mRNA binding, single- protein SRSF3 overexpresses in the pre-cancer and cancer lesions of the
stranded RNA binding, and protein domain-specific binding. The protein oral cavity [37]. The U2AF1L4 gene, encoding for a splice protein, along
with the Gfi1 gene has a role in T-cell differentiation by regulating

6

S. Khowal, S. Wajid Advances in Cancer Biology - Metastasis 4 (2022) 100030

Table 4 Table 4 (continued ) TBE Residues
iGEMDOCK predicted stable interactions between ligands and canonical S. Ligand (Kcal/
U2AF1L4. TBE is the total binding free energy of the protein-ligand interactions. No. mol) 182, V–S-Gln-182, V-M-Tyr-
V and H indicate Van der waal and Hydrogen bonding (type of interactions). S 186, V–S-Tyr-186, V-M-Ser-
and M represents the side chain and main chain of the interacting residues, A. Tobacco-specific carcinogens 212, V–S-Ser-212, V-M-Pro-
respectively. TBE is the total binding free energy of the protein-ligand in- 213, V–S-His-215
teractions. Majority residues framing the ligand binding sites were found to be V–S-Phe-86, V-M-Glu-97,
evolutionary conserved across mammals; the underlined residues were found to V–S-Glu-97, V-M-Glu-98,
be not conserved evolutionarily. V–S-Lys-116, V–S-Arg-118,
V-M-Gln-182, V–S-Gln-182,
S. Ligand TBE Residues 2 Hesperidin À123.48 V-M-Tyr-186, V–S-Tyr-186,
No. (Kcal/ V-M-His-209, V–S-His-209,
mol) V-M-Cys-211, V-M-Ser-212,
V–S-Ser-212, V-M-Pro-213,
A. Tobacco-specific carcinogens V–S-His-215

1 1- Hydroxypyrene À78.43 V–S-Glu-95, V–S-Glu-97, V–S-

Arg-118, V–S-Tyr-186, V–S-

Arg-191, V–S-Pro-195, V-M-

Phe-220

2 4NQO À43.43 V-M-Cys-18, V–S-Phe-20,

V–S-Tyr-21, V-M-Cys-27,

V–S-Arg-35 alternative splicing PTPRC gene [38,39]. Collective transcription of
PSENEN and U2AF1L4 is necessary for the regulation of T-cell activity
3 NNK À64.62 V–S-Tyr-52, V-M-Arg-53, [40]. The up-regulated expression of splicing factors has been reported as
the prognostic biomarker (negative) of prostatic cancer [41].
V–S-Arg-53, V-M-Asn-54,
The analyses for the molecular evolution of canonical U2AF1L4
V–S-Asn-54, V-M-Asn-57, protein across mammals showed that in humans canonical U2AF1L4 has
the high percentage of evolutionarily conserved amino acid residues; the
V–S-Asn-57, V–S-Gln-60, V- N terminus (>90%) has more conserved residues than the C-terminus
(<70%); implicating the importance of C-terminus residues in deter-
M-Asp-103, V-M-Asn-104, mining the species specificity of canonical U2AF1L4 protein. Within a
species, the sequence of a canonical protein or transcript remains con-
V–S-Asn-104, V-M-Val-110, stant from one molecule to another [42]. Thus, the observed variation in
the U2AF1L4 cDNA 3’ stretch of oral pre-cancer and cancer cases may
V–S-Val-110, V-M-Gly-111 have biological significance and potentially may be amicable for prog-
nostication of oral carcinogenesis in the oral cancer risk groups (tobacco,
4 NNN À79.99 V–S-Tyr-52, V-M-Arg-53, areca nut, and/or alcohol users). The high percentage of evolutionarily
conserved residues in U2AF1L4 canonical protein indicates the necessity
V–S-Arg-53, V-M-Asn-54, of its functional intactness within the cell for assuring the maintenance of
homeostasis in the ongoing splicing processes. Serine and arginine-rich
V–S-Asn-54, V-M-Asn-57, (SR) proteins constitute a family of pre-mRNA splicing factors,
involved in the regulation of both constitutive and alternative splicing,
V–S-Asn-57, V–S-Gln-60, V- that are highly conserved residues across the evolution [43,44].

M-Asp-103, V-M-Asn-104, The three functional regions (currently known) of humans canonical
U2AF1L4 namely ZF1, RRM domain, and ZF2 were comprised of a high
V–S-Asn-104, V-M-Val-110, percentage of conserved residues (>95%). The molecular docking showed
that the prominent carcinogens found in tobacco, areca-nut, and alcohol
V–S-Val-110, V-M-Gly-111 may potentially bind with one or more functional domains of the canonical
U2AF1L4 protein, thereby hindering the required molecular (protein-
5 Nicotine À74.98 V–S-Tyr-52, V-M-Arg-53, protein and protein-RNA) interactions and associated alternative splicing
processes. Thus, the role of U2AF1L4 protein in oral epithelia of chronic
V–S-Arg-53, V-M-Asn-54, addicts may be ruined by dual threats posed by carcinogens (i) inculcation
of mutation in the 3’ U2AF1L4 cDNA and (ii) interaction with the func-
V–S-Asn-54, V-M-Asn-57, tional domains of U2AF1L4 protein. The tobacco, areca-nut, and alcohol
sourced carcinogens induce genetic mutations affecting the expression
V–S-Asn-57, V–S-Gln-60, V- and/or functioning of the destined products [1].

M-Asp-103, V-M-Asn-104, Low levels of serum beta carotene (in comparison to healthy in-
dividuals) have been reported in OSCC patients [45]. Beta carotene, a
V–S-Asn-104, V-M-Val-110, carotenoid with antioxidant attributes, is metabolized by the body to
vitamin A whose derivatives (like retinoids) affect key cellular processes
V–S-Val-110, V-M-Gly-111 (differentiation, proliferation, and apoptosis) and executes a crucial
physiological role in varying biological processes [46]. Vitamin A re-
B. Areca-nut specific carcinogens duces the incidence of tumours in experimental models. Also, retinoids
inhibit the growth and progression of malignancies affecting vital organs
1 Arecaidine À29.46 V-M-Cys-18, V–S-Tyr-21 like the oral cavity, prostate, lungs, liver, gastrointestinal, mammary
glands, bladder, and skin [46]. Beta carotene has shown attributes of
2 Arecoline À66.38 V-M-Leu-51, V–S-Arg-53, V- tumour regression or tumour inhibition in hamster cheek pouch tumour
model for OSCC [31]. We observed that beta carotene may interact with
M-Phe-135, V-M-Asn-136, V- all functional domains of U2AF1L4, implicating its potential for

M-Gln-138, V–S-Gln-138

3 N-nitrosoguavacoline À27.09 V-M-Cys-18, V-M-Phe-20,

V–S-Tyr-21

4 3-(Methylnitrosoamino) À39.24 V-M-Arg-53, V–S-Arg-53, V-

propionitrile M-Asn-54, V–S-Gln-60

5 3-(Methylnitrsoamino) À12.53 V–S-Tyr-21, V-M-Cys-33

propionaldehyde

C Alcohol-specific carcinogens

1 Acetaldehyde À19.79 V-M-His-108, V-M-Asn-170

2 Benzene À47.76 V-M-His-108, V-M-Asn-170

3 Acrylamide À22.36 V-M-His-108, V-M-Asn-170

4 Ethanol À18.41 V–S-Tyr-52

5 Furan À38.44 V-M-Asn-104, V–S-Asn-104,

V-M-Val-110, V–S-Val-110,

V-M-Cys-169

6 Aflatoxin B1 À97.07 V-M-Glu-97, V–S-Glu-97,

V–S-Arg-118, V–S-His-215,

V-M-Phe-220

7 N-Nitrosodimethylamine À32.29 V-M-Asn-104, V–S-Asn-104,

V-M-Val-110, V–S-Val-110,

V-M-Gly-166, V-M-Cys-169

8 4-Methylimidazole À43.27 V-M-Gly-106, V-M-Cys-169,

V-M-Asn-170

9 Ethyl carbamate À20.2 V-M-Asp-103, V-M-Asn-104,

V–S-Asn-104, V–S-Val-110,

V-M-Gly-166, V-M-Cys-169

D Therapeutics

1 Beta-carotene À115.52 V–S-Glu-3, V-M-Tyr-4, V–S-

Tyr-4, V-M-Glu-97, V–S-Glu-

97, V-M-Glu-98, V–S-Lys-

116, V–S-Arg-118, V-M-Gln-

7

S. Khowal, S. Wajid Advances in Cancer Biology - Metastasis 4 (2022) 100030

Fig. 3. Molecular docking of U2AF1L4
with ligands. A. The three-dimensional
structure of U2AF1L4 showing the (i) N-ter-
minus zinc fingers C3H1 type-1 (blue), (ii) C-
terminus zinc finger C3H1 type-2 (red), and
(iii) middle region RRM domain (orange). B.
The best dock poses of tobacco specific car-
cinogens namely (i) 1- Hydroxypyrene (yel-
low), (ii) 4NQO (magenta), (iii) NNK (light
blue), (iv) NNN (green), and (v) Nicotine
(gray). C. The best dock poses of areca-nut
specific carcinogens namely (i) Arecaidine
(green), (ii) Arecoline (magenta), (iii) N-
nitrosoguavacoline (yellow), (iv) 3-(Methyl-
nitrosoamino) propionitrile (light blue), and
(v) 3-(Methylnitrsoamino) propionaldehyde
(gray). D. The best dock poses of alcohol-nut
specific carcinogens namely (i) Acetaldehyde
(green), (ii) Benzene (yellow), (iii) Acryl-
amide (gray), (iv) Ethanol (light blue), (v)
Furan (magenta), (vi) Aflatoxin B1 (dark
green), (vii) N-Nitrosodimethylamine (red),
(viii) 4-Methylimidazole (dark gray), and
(ix) Ethyl carbamate (blue). E. The best dock
poses of therapeutants namely (i) Beta-
carotene (green), and Hesperidin (yellow).
(For interpretation of the references to
colour in this figure legend, the reader is
referred to the Web version of this article.)

preventing the interaction of carcinogens (tobacco, areca-nut, and precancer and cancer lesions. The U2AF1L4 cDNA 5’ stretch comprised of
alcohol) with any of the three functional domains; thereby eliminating mainly canonical exons 2nd & 5th junction and partial exon 5 and the
the pernicious molecular aftermaths on oral epithelia. In addition, we U2AF1L4 cDNA 3’ stretch composed of canonical partial exon 6, exon 7,
observed hesperidin, a flavonoid, to interact with RRM and ZF2 domains, and exons 7th & 8th junction. The evaluated Tm values for amplicons from
implicating its interaction preventing potential for the selected carcino- GAPDH and U2AF1L4 cDNA 5’ stretch were similar in both diseased le-
gens. Hesperidin has anticancer properties and combats the chemically sions and control; whereas Tm values evaluated for amplicons from
induced tongue cancer in animal models [47]. The beta carotene and U2AF1L4 cDNA 3’ stretch showed substantial variations; thereby
hesperidin, potential therapeutants of OSCC, are phytochemicals pos- showing the potential association between genetic variability of
sessing minimal or nil toxicity on healthy tissues and may serve as che- U2AF1L4 cDNA 3’ stretch and oral precancer - cancer pathologies.
mopreventive agents in the risk groups of oral cancer (chronic addicts) Interestingly, U2AF1L4 cDNA 3’ stretch encoded for residues Leu-144 to
[48]. Moreover, the interaction of therapeutants (with higher negative Pro-195 (supplementary file S1: table S1.1) with 90% evolutionary
TBE than carcinogens) may play a role in stabilizing the U2AF1L4 conserved residues (Table 3), implicating its plausible functional
structure, allowing the physiological protein-protein or protein-RNA in- importance. The U2AF1L4 cDNA 3’ stretch encoded residues comprised
teractions to occur even in the presence of carcinogens. More, experi- of following regions (i) partial RRM domain, (ii) Thr-148 sandwiching
mental endeavours are needed to explore further insights into the between RRM domain and ZF2, (iii) ZF2 domain, and (iv) partial C-ter-
interaction dynamics of U2AF1L4 with therapeutants & carcinogens. minus. Thus, U2AF1L4 cDNA 3’ stretch mutations may encode U2AF1L4
proteins with mutated ZF2 domain and flanking residues. Thereby,
In the present work, we have performed Q PCR – Tm calling strategy- implicating compromised or altered nucleic acid binding attributes. Ac-
based analyses of the variations present within U2AF1L4 cDNA 5’ and cording to the Uniprot, U2AF1L4 belongs to the splicing factor serine
U2AF1L4 cDNA 3’ stretches transcribed in the total cDNA pool of oral

8

S. Khowal, S. Wajid Advances in Cancer Biology - Metastasis 4 (2022) 100030

Fig. 4. The protein –protein interaction network for U3AF1L4 generated Data availability statement
by STRING.
arginine-rich (SR) family. The ZF2 domain of canonical U2AF1L4 is The data that supports the findings of this study are available in the
quintessential for interaction with GFI1 and for performing alternative supplementary material of this article.
pre-mRNA splicing. Also, the region Glu-162 to Phe-220 is essential for
the nuclear import of the U2AF1L4 protein as it lacks the nuclear local- Acknowledgements
ization signal. This region enables the interaction with C1QBP which is
needed for the nuclear translocation, assuring localization in nuclear dot- We are highly grateful to the University Grants Commission (UGC),
like structures, and may also allow nucleo-cytoplasmic shuttling of the India, for the financial support (F.4-1/2006(BSR) 7–357/2011(BSR);
protein [49]. U2AF1L4 cDNA 3’ stretch mutations may alter the inter- 22nd Oct ‘13) to Sapna Khowal (UGC-BSR fellow) during this study. The
action of encoded U2AF1L4 protein with GFI1 and affect the quintes- authors are thankful to the Department of ENT and the Department of
sential process of alternative splicing of pre-mRNA; also, the encoded Pathology (Hamdard Institute of Medical Sciences and Research, HAH
protein may suffer non-physiological nucleo-cytoplasmic shutting. Centenary hospital).
Therefore, indicating the association of U2AF1L4 cDNA 3’ stretch mu-
tations with hindered alternative splicing processes that may birth to Abbreviations
non-canonical protein isoforms from target gene(s) creating a global
molecular chaos in the affected oral cells leading to oral carcinogenesis. a.a. Amino acids
kb Kilobasepairs
5. Conclusions KD Kilodaltons
MNPA 3-(Methylnitrsoamino) propionaldehyde
U2AF1L4 encodes an important splicing protein that determines the MNPN 3-(Methylnitrosoamino) propionitrile
alternative splicing process of cellular pre-mRNA pool in humans. The NDMA N-Nitrosodimethylamine
present work, involving the clinical samples from oral pre-cancer and NNK 4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone
cancer conditions, unraveled the existence of mutations in the 3’ stretch NNN N-nitrosonornicotine
of the U2AF1L4 cDNA transcribed in the diseased lesions and adjacent 4NQO 4-Nitroquinoline 1-oxide
normal tissues of the oral cavity in the cases with chronic addiction OSCC Oral squamous cell carcinoma
history for tobacco, areca-nut, and alcohol (common OSCC aetiologies). U2AF1L4 U2 small nuclear RNA auxiliary factor 1-like protein 4
The mutated U2AF1L4 cDNA 3’ stretch indicated mal-functional ZF2 Ta Annealing temperature
domain of the encoded protein; implicating the deregulated and
abnormal splicing process (an important attribute of cancers) in the Appendix A. Supplementary data
affected cells of the oral cavity. The human U2AF1L4 gene encodes a
highly conserved protein and plays a critical role in oral carcinogenesis. Supplementary data to this article can be found online at https
The mutated U2AF1L4 cDNA 3’ stretch holds a strong candidature for ://doi.org/10.1016/j.adcanc.2022.100030.
prognostication of oral malignancy in the risk groups (addicts for to-
bacco, areca-nut, and alcohol). Further experiments are required for References
revealing the type(s) of mutations suffered by the U2AF1L4 cDNA 3’
stretch and getting a better understanding of the structural-functional [1] S. Khowal, S. Wajid, Role of Smoking-Mediated molecular events in the genesis of
abnormalities induced in the encoded protein. Also, the knowledge of oral cancers, Toxicol. Mech. Methods 29 (9) (2019) 665–685.
the genes suffering splicing aberrations driven by the abnormal U2AF1L4
protein (mutated ZF2 domain) in oral pre-cancer & cancer lesions may [2] J. Ferlay, et al., Cancer incidence and mortality worldwide: sources, methods and
delineate the molecular pathways (triggered or muted) that are critical major patterns in GLOBOCAN 2012, Int. J. Cancer (5) (2015), 136, E359-E386.
for oral carcinogenesis.
[3] F. Bray, et al., Global cancer statistics 2018: GLOBOCAN estimates of incidence and
Declaration of competing interest mortality worldwide for 36 cancers in 185 countries, CA A Cancer J. Clin. 68 (6)
(2018) 394–424.
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence [4] Khowal, S., S.K. Jain, and S. Wajid, Prevalence of human papillomavirus type 16 in
the work reported in this paper. persistent oral lesions arising in patients with tobacco, areca nut, and alcohol
habits. Int. J. Oral Sci..

[5] S. Khowal, et al., Assessment of cellular and serum proteome from tongue squamous
cell carcinoma patient lacking addictive proclivities for tobacco, betel nut, and
alcohol: case study, J. Cell. Biochem. 119 (7) (2018) 5186–5221.

[6] O. Herdt, et al., The zinc finger domains in U2AF26 and U2AF35 have diverse
functionalities including a role in controlling translation, RNA Biol. 17 (6) (2020)
843–856.

[7] F. Heyd, G. Dam, T. Mo€ro€y, Auxiliary splice factor U2AF26 and transcription factor
Gfi1 cooperate directly in regulating CD45 alternative splicing, Nat. Immunol. 7
(2006) 859–867.

[8] O. Anczuko w, A.R. Krainer, Splicing-factor alterations in cancers, RNA (New York,
N.Y 22 (9) (2016) 1285–1301.

[9] S. Yang, R. Jia, Z. Bian, SRSF5 functions as a novel oncogenic splicing factor and is
upregulated by oncogene SRSF3 in oral squamous cell carcinoma, Biochim.
Biophys. Acta mol. Cell Res. 1865 (9) (2018) 1161–1172.

[10] F. Yin, et al., The significance of PA28γ and U2AF1 in oral mucosal carcinogenesis,
Oral Dis. 26 (1) (2020) 53–61.

[11] S. Khowal, S.K. Jain, S. Wajid, A potential association between mutations in the
iNOS cDNA 30 stretch and oral squamous cell carcinoma-A preliminary study, Meta
Gene 16 (2018) 189–195.

[12] S. Kumar, et al., Mega X: molecular evolutionary genetics Analysis across computing
platforms, Mol biol evol 35 (6) (2018) 1547–1549.

[13] E. Zuckerkandl, L. Pauling, Evolutionary Divergence and Convergence in Proteins,
in: Evolving Genes and Proteins, Elsevier, 1965, pp. 97–166, p.

[14] J. Felsenstein, Confidence limits on phylogenies: an approach using the bootstrap,
Evolution 39 (4) (1985) 783–791.

[15] W.S. Valdar, Scoring residue conservation. Proteins: structure, function,
Bioinformatics 48 (2) (2002) 227–241.

9

S. Khowal, S. Wajid Advances in Cancer Biology - Metastasis 4 (2022) 100030

[16] E. Usifo, et al., Low-density lipoprotein receptor gene familial hypercholesterolemia [34] S. Khowal, et al., Molecular winnowing, expressional analyses and interactome
variant database: update and pathological assessment, Ann. Hum. Genet. 76 (5) scrutiny of cellular proteomes of oral squamous cell carcinoma, Adv. Cancer Biol.
(2012) 387–401. Metastasis. 2 (2021) 100003.

[17] C.M. Díez-Rivero, P. Reche, Discovery of Conserved Epitopes through Sequence [35] J. Taylor, S.C. Lee, Mutations in spliceosome genes and therapeutic opportunities in
Variability Analyses, in: In Bioinformatics For Immunomics, Springer, 2009, myeloid malignancies. Genes, Chromosomes Cancer 58 (12) (2019) 889–902.
pp. 95–101, p.
[36] Y. Zhang, et al., Alternative splicing and cancer: a systematic review, Signal
[18] M. Garcia-Boronat, et al., PVS: a web server for protein sequence variability analysis Transduct. Targeted Ther. 6 (1) (2021) 78.
tuned to facilitate conserved epitope discovery, Nucleic Acids Res (2008) 36 (suppl_
2): p. W35-W41. [37] L. Peiqi, et al., Expression of SRSF3 is Correlated with Carcinogenesis and
Progression of Oral Squamous Cell Carcinoma, Int. j. med. sci. 13 (7) (2016)
[19] M.J. Sippl, Recognition of errors in three-dimensional structures of proteins, 533–539.
Proteins: Struct. Funct. Bioinf. 17 (4) (1993) 355–362.
[38] N.A. Sokhonevich, et al., Effects of immunoregulatory cytokines (IL-2, IL-7, and IL-
[20] M. Wiederstein, M.J. Sippl, ProSA-web: interactive web service for the recognition 15) on expression of Gfi1 and U2afll4 genes in T cells at different stages of
of errors in three-dimensional structures of proteins, Nucleic Acids Res (2007) 35, differentiation, Bull. Exp. Biol. Med. 159 (2) (2015) 236–239.
p. W407-W410.
[39] S.A. Zamorina, et al., The role of human chorionic gonadotropin in regulation of
[21] L.A. Kelley, et al., The Phyre2 web portal for protein modeling, prediction and naïve and memory T cells activity in vitro, Int. Immunopharm. 54 (2018) 33–38.
analysis, Nature protocols 10 (6) (2015) 845–858.
[40] D.A. Didych, et al., Human PSENEN and U2AF1L4 genes are concertedly regulated
[22] N.M. O'Boyle, et al., Open Babel: an open chemical toolbox, J. Cheminf. 3 (1) by a genuine bidirectional promoter, Gene 515 (1) (2013) 34–41.
(2011) 33.
[41] Z. Chen, H. Hu, Identification of prognosis biomarkers of prostatic cancer in a
[23] K.-C. Hsu, et al., iGEMDOCK: a graphical environment of enhancing GEMDOCK cohort of 498 patients from TCGA, Curr. Probl. Cancer 43 (6) (2019) 100503.
using pharmacological interactions and post-screening analysis, BMC
bioinformatics 12 (S1) (2011) S33. [42] K. Roberts, et al., Molecular Biology of the Cell, New York: Garland Science, 2002.
[43] A.M. Zahler, et al., SR proteins: a conserved family of pre-mRNA splicing factors,
[24] S.S. Hecht, Tobacco carcinogens, their biomarkers and tobacco-induced cancer,
Nature Reviews Cancer 3 (10) (2003) 733–744. Genes Dev. 6 (5) (1992) 837–847.
[44] P.J. Shepard, K.J. Hertel, The SR protein family, Genome Biol. 10 (10) (2009) 242.
[25] S.R. Singaravelu, S. Sellappa, Assessment of genotoxicity in exfoliated buccal [45] P. Chippagiri, A. Im, S.R. Banavar, Role of serum ß-carotene in the diagnosis and
epithelial cells of foundry workers occupationally exposed to polycyclic aromatic
hydrocarbons, Asian J. Pharmaceut. Clin. Res. 6 (2013) 339–342. prevention of oral squamous cell carcinoma - a case control study. Journal of
clinical and diagnostic research, J. Clin. Diagn. Res. (4) (2014) 8, p. ZC01-ZC3.
[26] M. Vered, N. Yarom, D. Dayan, 4NQO oral carcinogenesis: animal models, [46] E. Doldo, et al., Vitamin A, cancer treatment and prevention: the new role of cellular
molecular markers and future expectations, Oral oncol. 41 (4) (2005) 337–339. retinol binding proteins, BioMed Res. Int. 2015 (2015) 624627, 624627.
[47] T. Tanaka, et al., Chemoprevention of 4-nitroquinoline 1-oxide-induced oral
[27] A. Garg, P. Chaturvedi, Prevention of Oral Cancer, in: Contemporary Oral Oncology, carcinogenesis by dietary curcumin and hesperidin: comparison with the protective
Springer, 2017, pp. 445–459, p. effect of β-carotene, Cancer res. 54 (17) (1994) 4653–4659.
[48] T.-Y. Lee, Y.-H. Tseng, The potential of phytochemicals in oral cancer prevention
[28] K. Sundqvist, et al., Cytotoxic and genotoxic effects of areca nut-related compounds and therapy: a review of the evidence, Biomolecules 10 (8) (2020) 1150.
in cultured human buccal epithelial cells, Cancer Res. 49 (19) (1989) 5294–5298. [49] Consortium, T.U, UniProt: the universal protein knowledgebase in 2021, Nucleic
Acids Res. (2020) 49 (D1): p. D480-D489.
[29] D.W. Lachenmeier, M.C. Przybylski, J. Rehm, Comparative risk assessment of [50] R.K. Saiki, et al., Diagnosis of sickle cell anemia and β-thalassemia with
carcinogens in alcoholic beverages using the margin of exposure approach, Int. J. enzymatically amplified DNA and nonradioactive allele-specific oligonucleotide
Cancer (6) (2012) 131. probes, N. Engl. J. Med. 319 (9) (1988) 537–541.
[51] S.H. Naqvi, S. Wajid, A.B. Mitra, Restriction fragment length polymorphism of L1
[30] T. Pflaum, et al., Carcinogenic compounds in alcoholic beverages: an update, Arch. amplicon using Rsa 1 detects five different human papillomavirus types and their
Toxicol. 90 (10) (2016) 2349–2367. co-infections among women attending a gynaecological outpatient department,
J. Virol Methods 117 (1) (2004) 91–95.
[31] J.L. Schwartz, et al., The Administration of Beta Carotene to Prevent and Regress [52] A. Martínez-Ramírez, et al., The P2RY2 receptor induces carcinoma cell Migration
Oral Carcinoma in the Hamster Cheek Pouch and the Associated Enhancement of and EMT through cross-talk with epidermal growth factor receptor, J. Cell.
the Immune Response, in: Antioxidant Nutrients and Immune Functions, Springer, Biochem. 117 (4) (2016) 1016–1026.
1990, pp. 77–93, p. [53] C.-Y. Wang, et al., Long non-coding RNA CCAT2 is up-regulated in gastric cancer
and associated with poor prognosis, Int. J. Clin. Exp. Pathol. 8 (1) (2015) 779.
[32] B. Wudtiwai, et al., Anticancer activities of hesperidin via suppression of up-
regulated programmed death-ligand 1 expression in oral cancer cells, Molecules 26
(17) (2021) 5345.

[33] D. Szklarczyk, et al., STRING v11: protein-protein association networks with
increased coverage, supporting functional discovery in genome-wide experimental
datasets, Nucleic Acids Res. (2019) 47 (D1): p. D607-d613.

10