Isabelline Wheatear

Isabelline Wheatear, Oenanthe isabellina
Bardsey island, 10th – 16th September 2019

Martin Hosier
Steven Stansfield



British Birds Rarities Committee

Rarity Form

Email to: [email protected]

Species: Isabelline Wheatear

Date first seen: 7 September 2019 Date last seen: 16 September 2019

No. of Birds: 1 Age/Sex: 1st CY

County: Gwynedd Location: Bardsey Island

Please fill in your email address to ensure that you get an acknowledgement

Finder: Martin Hosier Email:

Identifier (if different): Email:

Submitter (if different): Steven Stansfield Email: [email protected]

Other observers: San Prettyman, Alex Starace, Lewis Hooper

Any who disagrees with identification?

Optical aids:
Distance from bird:

Have you enclosed photographs? Was the bird videoed?

If photos are available on public websites (BirdGuides & Surfbirds etc) then please give www address:

Have the photographs been published in magazines? If so, where:

Species present for comparison:
Which species were alongside the bird:
Observer(s) experience of the species:
Observer(s) experience of similar species on the same day or previously:

Weather (general description):
Wind direction and Force:
Light conditions (good, dull, etc & sun behind, side etc):
Visibility (distance):
Rain, mist, etc:
Cloud cover:

Address of submitter:

Phone No:
And finally, is the record 100% certain?

Hit ‘Page Down’ key several times to move to Description section
Isabelline Wheatear, Oenanthe isabellina

Bardsey island, 10th – 16th September 2019

Finder’s Account - Martin Hosier

I was visiting Bardsey Bird Observatory with a group of friends from the 7th to the
14th of September 2019. On the morning of the 10th of September my wife
Heather and I had chosen to walk the southern end of the island. We had walked
past the southern tip and were heading back towards the narrows along the
eastern shore. As we crested a small valley we flushed a wheatear from around 20
meters in front of us. The bird flew directly away from us and landed around 120
meters away on a grassy slope. As soon as the bird flew I knew it was not a
Northern Wheatear, as I was immediately struck by both its pale plumage and
large size. Viewing the bird through my scope confirmed my suspicions that this
was a large, upright, very pale wheatear. My next priority was to try to get some
pictures to help with the identification. Over the course of the next ten minutes I
managed to get some shots of the bird both on the ground and in flight as well as
views from every angle. At this point I decided to let the bird settle at the southern
tip of the island to feed. I watched the bird from a distance while I sent my long-
suffering wife off to the observatory to alert the observatory staff and any other
birders that she could find. I made some notes while waiting for reinforcements.

I waited as the birders converged on the spot from all over the island only to be
frustrated when a Sparrowhawk flew across the southern tip of the island and
flushed all of the birds just as reinforcements arrived.

Despite searching the area extensively, we could not find the bird so returned to
the observatory to check the field guides. We quickly confirmed my suspicions
that it was indeed a first-winter Isabelline Wheatear.

By now It was accepted by everyone that we were searching for an Isabelline
Wheatear. A search party was sent looking for the wheatear. Lewis Hooper
wandered around the southern end of the island and eventually re-discovered it
on the Narrows, where it remained for the nest six days.

On the 14th the bird was trapped and ringed by Steve Stansfield. During the
processing of the bird, it shed two flank feathers, these were sent to Prof Martin
Collinson at Aberdeen University, where he confirmed the bird’s identity from its
MtDNA sequence.

Description.
Martin Hosier and Steve Stansfield

A large pale wheatear with upright stance and long black legs, with long pale feathered
thighs.

Head rounded with a rather plain face, pale supercilium, dark lores, slightly warmer tinge to
the ear coverts.

Upper breast pale sandy slightly warmer toned towards the shoulders, fading to an off-white
belly.

Back greyer with little contrast in the lesser or median coverts. A black alula was noted and
showed well on some pictures. Greater coverts same colour as back. Secondaries mid-
grey/brown wit pale fringing. Primaries, dark, almost black, with black subterminal band and
very wine white tips.

Wing length equal to or just beyond the base of the tail. Rump and base of tail white with a
thick black terminal bar on the tail, at least two thirds of tail was black, showing only the very
slightest a hint of a “T” in flight. In flight the underwing was silvery grey

Behavior.

Typical wheatear feeding action with fast bounding hops after prey and occasional fly
catching from low perches. Sat very erect most of the time with frequent pumps of the tail
and tail pumping. Often perched on exposed rocks for long periods. No call was heard at any
point during observations.

When seen on more than one occasion alongside Northern Wheatear the bird was noticeably
larger and paler, even larger than Greenland Wheatears nearby.

DNA testing results from Aberdeen University I can confirm that your Isabelline Wheatear
from 14/9/19 was carrying Isabelline Wheatear DNA (our ref: OIS01).

- taCtggGcaTCTGCCTAATAACACAAATTATCACCGGTCTGTTACTAGCCACCCACTACACAGCAGACACCTCCCTAGCCTTCACCTCCGTCGCCCACATATGCCGAA
ACGTACAATTCGGCTGACTAATCCGAAACCTTCACGCAAACGGAGCTTCATTCTTCTTCATCTGCATCTACCTACACATCGGCCGAGGATTCTACTACGGCTCCTACC
TAAACAAAGAAACCTGAAATGTAGGAGTCATCCTCCTCCTAATCCTCATAGCAACTGCCTTCGTAGGCTATGTCCTCCCCTGAGGCCAAATATCCTTCTGAGGGGCTA
CAGTAATCACCAACCTATTCTCAGCAATCCCCTATATCGGCCAAACCCTAGTAGAATGAGCCTGAGGAGGATTTTCAGTAGACAACCCAACACTAACCCGATTCTTC
GCCCTTCACTTCCTACTTCCATTCCTCATCGTAGGCCTTACATTAGTCCACCTCACATTCCTCCACGAAACAGGCTCAAACAACCCACTAGGCATCCCCTCAGACTGT
GACAAAATCCCATTCCACCCATACTACTCCACAAAAGACATCCTAGGGTTCGCACTCATACTCATCCCCCTCATCGCCCTAGCCCTATTCTCCCCCAACCTACTAGGC
GACCCAGAAAATTTCACGCCAGCCAACCCACTAGCTACACCTCCCCACATCAAACCCGAATGATACTTCCTATTTGCATACGCCATCCTACGCTCCATCCCAAACAA
ACTAGGCGGAGTCCTAGCCCTAGCTGCATCCGTACTAGTCCTATTCCTAACCCCACTGCTACATACATCCAAACTACGCTCACTAACCTTCCGACCTATTTCACAAGT
CCTATTCTGAGCCCTAGTAGCCAACCTATTCATTCTAACCTGAGTAGGAAGCCAACCAGTAGAACACCCATTCATCATCATCGGCCAACTAGCCTCCCTATCCTACTT
CACAATCATTCTAGTCCTATTCCCACTTGCAGCCGTGCTAGAGAACAAAATACTAAACCTCTAATCCACTCTAATAGTTTATAAAAACATTGGTCTTGTAAACCAAAAA
CTGAAGACTCCAAG

Round head with plain face

White eyering Pale supercilium extending to to just behind eye
Dark lores Slightly warmer tinge to the ear coverts.
Black Bill
Dusky surround to rear of ear coverts,

White chin and throat

Forehead and center of Crown, nape and mantle
crown slightly darker greyer with little contrast
between scapulars and the
fringes of lesser or median
coverts.

Upper breast

pale sandy Greater coverts dark
centered with fringes same
slightly warmer colour as lower back.

toned towards Secondaries mid-grey/brown
fringed at tipped pale with
the shoulders, darker primaries.

fading to an off- Wing length equal to or just
beyond the base of the tail.
white belly.
Pale vent.
Upright
stance, like
Greenland
Wheatear.
Very full
chested
with heavy
sternum

off-white belly.

Black legs with long
feathered tibia

Primaries, dark, almost black,
with black subterminal band
and very fine white tips.

Primary coverts had dark
centers and vert pale
fringing.

Dark grey centres to broadly
pale fringed coverts

Very plain and uniform
mantle with slightly warmer
lower back

Secondaries mid-
grey/brown wit pale
buff fringing and
silvery tips.

Rump white

Tail white with a thick black terminal
bar on the tail; at least half to two
thirds of tail was black, showing only
the very slightest a hint of a “T” in
flight.

Primary coverts had dark Very plain and uniform
centers and vert pale mantle with slightly warmer
fringing. lower back

Black alula

Black Beady eye and plain face

Very plain and uniform looking at a distance

Very pale underside

Steven Stansfield - 2020