Bardsey's Wildlife 2019

CHOUGH

4.1 NEST DETAILS OF CHOUGHS ON BARDSEY IN 2019

4.1.1 NORTH WEST CORNER

Date Start Finish Nesting activity
No activity
18/04/19 13:15 15:15 No activity
16/5/19 12.:00 1244 No activity
02/06/19 10:00 12:00
summary – no activity

4.1.2 OGOF MORLAS

Bird Ring number Right combination Left combination Wing Weight Tarsus
Female Un-ringed

Male ASH/METAL ORANGE/BROWN

Date Start Finish Nesting activity
09/05/19 13:00 14:00 6 oktas, 17 mph - pair seen at the nest, one in none out at 13:15,
one in and two out at 13:50 and then pair seen feeding
14/06/19 14:00 14:30 together after this
20/07/19 16:00 17:15 4 oktas, 25 mph - nest visited, a single fledged juvenile flew out.
08/07/19 15:00 15:30 Adults present calling nearby.
Adults seen at the north end with a single juvenile

No activity

summary – one young fledged

4.1.3 BLACK ANVIL

Date Start Finish Nesting activity
09/05/19 13:00 15:00 No activity
04/06/19 14:00 14:30 No activity
10/06/19 14:00 15:45 No activity
14/06/19 15:00 15:15 No activity

summary – no activity

4.1.4 THE PINK TRYWN

Date Start Finish Nesting activity
09/05/19 13:00 15:00 No activity
04/16/19 14:00 14:30 No activity
04/06/19 14:00 14:30 No activity
10/06/19 13:00 14:00 No activity
14/06/19 13:00 14:00 No activity

summary – no activity

63: 188-203 193

HOOPER

4.1.5 CARREG LLEWYDION

Date Start Finish Nesting activity
09/05/19 14:00 15:00 No activity
04/06/19 14:00 14:30 No activity
10/06/19 13:00 14:00 No activity
14/06/19 13:00 14:00 No activity

summary – no activity

4.1.6 BAE FELEN

Bird Ring number Right Left Wing Weight Tarsus
combination combination

Female Un-ringed ORANGE/ORANGE
Male
ASH/METAL

Date Start Finish Nesting activity
09/05/19 15:00 17:00 pair seen entering the nest site but also seen entering The Zawn
nest site, but no activity was seen at this site thereafter
04/06/19 14:00 14:30
10/06/19 13:00 14:00 No activity
14/06/19 13:00 14:00 No activity
No activity

summary – no activity

4.1.7 THE ZAWN

Bird Ring Right Left combination Wing Weight Tarsus
number combination ASH/METAL
Female
Male ORANGE/ORANGE

Date Start Finish Nesting activity
02/05/19 14:30 15:20
03/05/19 14:30 15:45 4 oktas, 5 mph - pair seen feeding together and entering the
09/05/19 15:00 17:00 nest together
2 oktas, 20 mph - pair seen entering the nest
10/6/19 14:30 15:00
2 oktas, 17 mph - the pair were seen entering and flying out of
the nest six times in this period and also observed feeding each
other
2 oktas, 10 mph - pair seen on slope above nest site but no rings
seen.

summary – Nesting not proven but site possibly successful

194 REP. BARDSEY BIRD FLD OBS

CHOUGH

4.1.8 SEAL CAVE

Bird Ring number Right combination Left Wing Weight Tarsus
combination
Female EX04701 ORANGE/RED LIME/METAL 174 310 64.8
Male EX04702 #HO/ METAL WHITE/WHITE 169 260 58.2
EX04703 BLUE / LIME ASH/METAL 165 270 62.6
Chick 1 BLUE / GREEN ASH/METAL
Chick 2 BLUE / BLUE ASH/METAL
Chick 3

Date Start Finish Nesting activity
02/05/19 14:40 16:40
09/05/19 15:00 17:00 no activity
09/06/19 13:00 14:00 no activity
2 oktas, 10 mph - three chicks were discovered at the nest site
14/06/19 14:00 17:00 and ringed
2 oktas, 5mph - adults in area all afternoon in and out of nest -
08/07/19 15:00 chicks heard
2 oktas, 11 mph - both adults and all three chicks were seen
together, and all rings were read in the field

summary – three young fledged

4.1.9 OGOF BRAICH Y FWYAF

Bird Ring number Right combination Left Wing Weight Tarsus
BROWN / LIME combination
Female 1
Female 2 METAL

Male Unringed
Unringed

Date Start Finish Nesting activity
06/05/19 15:00 16:30
6 oktas, 10 mph - three Choughs including the female from this
10/05/19 14:15 14:45 site were seen together around the nest site but not noted
entering
09/06/19 13:00 13:30 0 oktas, 5 mph - group of three seen. It was presumed the ringed
14/06/19 12:00 14:00 female from this nest site in previous years has lost her partner
08/07/19 14:00 14:20 and formed a group with the Ogof Barcut pair

No activity

No activity
No activity

summary – no activity

4.1.10 TORNADO LEDGE

Bird Ring number Right combination Left Wing Weight Tarsus
BROWN / LIME combination
Female 1
Female 2 METAL

Male Unringed
Unringed

63: 188-203 195

HOOPER

Date Start Finish Nesting activity
19/04/19 14:45 1645 Three Chough were seen flying around together, one being the
regular female from Tornado Ledge (BROWN / LIME METAL) and
04/06/19 13:00 13:15 two un-ringed birds
10/06/19 12:30 12:35
14/06/19 12:00 12:15 No activity
No activity
No activity

summary – considered to have failed at incubation stage

4.1.11 OGOF BARCUT

Bird Ring number Right combination Left Wing Weight Tarsus
combination
Female Un-ringed
Male Un-ringed

Date Start Finish Nesting activity
19/04/19 14:45 16:45
6 oktas, 5 mph - three Choughs flying around together: the two
22/04/19 11:20 11:30 un-ringed birds and the female from Ogof Braich y Fwyaf
05/05/19 11:00 11:10
7 oktas, 20 mph - pair seen heading towards the nest
06/05/19 15:00 16:30 4 oktas, 12 mph - un-ringed pair seen flying and feeding
together around the nest site
10/05/19 14:00 15:00 5 oktas, 10 mph – three Choughs seen together around the nest
site, un-ringed pair seen entering the nest with nesting material
09/06/19 13:30 14:00 0 oktas, 5 mph – group seen again together, un-ringed pair seen
14/06/19 12:00 14:00 flying into the nest regularly together
08/07/19 14:30 2 oktas, 10 mph - three adults nearby but no activity at the nest

No activity

2 oktas, 11 mph - nest visited, and nest material was found to
have been pulled out of the nest, suggesting a failed attempt

summary – failed at incubation stage

4.1.12 PEN CRISTIN

Bird Ring number Right combination Left Wing Weight Tarsus
combination
Female Un-ringed METAL WHITE/WHITE
Male Un-ringed YELLOW/BLACK
Un-ringed METAL
Chick 1 Un-ringed
Chick 2
Chick 3
Chick 4

196 REP. BARDSEY BIRD FLD OBS

CHOUGH

Date Start Finish Nesting activity
21/04/19 12:45 13:45
1 oktas, 2 mph - pair seen flying together and feeding together.
10/05/19 13:30 13:50 The female was seen entering and leaving the nest twice
0 okas, 5 mph - pair seen entering the nest, female seen to
25/05/19 15:00 15:15 spend longer on the nest than the male.
09/06/19 12:30 12:40
5 oktas, 10 mph - adult seen taking a faecal sac from the nest
08/07/19 15:00 15:30 2 oktas, 10 mph - three juveniles were seen at the nest including
21/04/19 12:45 13:45 one that was flying

2 oktas, 11 mph - two adults were seen with four juveniles
1 oktas, 2 mph - pair seen flying together and feeding together.
The female was seen entering and leaving the nest twice

summary – four young fledged

4.1.13 OGOF DIBAN

Bird Ring Right combination Left combination Wing Weight Tarsus
number
Female ORANGE/# “0F” LIME/METAL
Male METAL GREEN/GREEN

Date Start Finish Nesting activity
17/04/19 14:30 16:30
20/04/19 09:20 09:40 No activity

04/05/19 16:20 16:40 2 oktas, 10 mph - pair seen feeding together and feeding each
other
15/06/19 12:00 13:00 6 oktas, 30 mph - pair seen heading to the nest site carrying nest
material
7 oktas, 15 mph - no around the nest site

summary – failed attempt

4.1.14 OGOF TRWYN-YR-HWCH BACH (WEST COAST)

Bird Ring number Right combination Left Wing Weight Tarsus
combination
Female Un-ringed GREEN/ #“3T”, GREEN/METAL
Male Un-ringed ASH/METAL
Un-ringed BLUE
Chick 1
Chick 2
Chick 3

Date Start Finish Nesting activity
15/04/19 10:00 10:25
12:00 7 oktas, 30 mph - adult male seen alarming outside the nest as
29/04/19 11:00 12:00 well as going in and out
15:10 7 oktas, 13 mph - pair seen bonding at the nest site, calling
16/05/19 11:00 together and touching bills
7 oktas, 5 mph - pair seen entering the nest and only one of the
08/07/19 15:00 pair leaving
2 oktas, 11 mph - pair seen with three juveniles

summary – three young fledged

63: 188-203 197

HOOPER

Fig. 4. Chough on Solfach REP. BARDSEY BIRD FLD OBS
.

198

CHOUGH

5 DISCUSSION

Chough numbers on Bardsey have fluctuated dramatically since monitoring began in 1953. However,
the trend clearly shows an increase in the breeding population, with a minimum of nine pairs attempting
to breed in four of the last ten years. The population trend also suggests that Choughs are responding
positively to the management of the island, where grazing by both sheep and cattle is creating an
abundance of short sward semi-natural vegetation.

The number of Choughs breeding on Bardsey this year falls one pair (13.58%) lower than the ten-year
average (8.10 ±s.d.0.99). However, whilst the number of breeding pairs remained relatively stable,
breeding success fell markedly, with four fewer chicks than 2018 (n = 17) and half that of 2017 (n = 22).
Of the seven active pairs, three failed to rear young and were thought to have failed at the incubation
stage. Whether this was due to predation is unclear, but the death of one adult female Chough can be
attributed to the failure of one breeding attempt.

5.1 MANAGEMENT STATEMENTS AND SPECIES’ TARGETS

Although now quite outdated, the latest management statement for Choughs on Bardsey (2010-2015)
from the 2010 Conservation Management Plan Supplement (Moralee 2010):

To contribute to maintenance of the internationally important population (1%
or more of the Great Britain population) of breeding and non-breeding season
Chough within the Glannau Aberdaron and Ynys Enlli SPA.

The species’ targets as listed in the 2010 Management Plan Supplement are:

• The breeding population of Chough is at least 4 pairs
• The wintering population of Chough is at least 10 individuals
• Sufficient suitable habitat is present to support the populations
• Breeding population is stable or increasing
• Productivity is stable
• Breeding and non-breeding birds use Ynys Enlli for feeding

throughout the year
• Chough feeding habitats are themselves in a favourable conservation

status and that the specified and operational limits and grazing
prescriptions for these habitats incorporate Chough feeding
requirements (i.e. sward height and bare ground)
• Disturbance of breeding and feeding Chough is minimal
• The factors affecting the feature are under control

63: 188-203 199

HOOPER

In the Guide for land managers: Summary of Island Management Plan 2002-2006, Wilkinson
(2004) gives a ‘Vision’ for the Feature:

‘VISION’ FOR THE FEATURE

Size of breeding population is stable or increasing as far as availability of nest
sites will allow (min 1% UK population) and non-breeding individuals are
present and utilising the island for feeding and social interaction.

Further to the Wilkinson plan (2004), Moralee (2010) refined the grazing prescriptions for many of the areas
which are managed for, amongst other things, Chough feeding. Most areas within the SPA and SAC
have very similar, if not identical sward height objectives within the plan. The area known as Penryn
Gogor has grazing prescriptions as follows:

PENRYN GOGOR GRAZING PRESCRIPTION

• 75% of grasses between heather patches should be 3-5cm tall
• 10% of the sward between heather patches can be less than 1cm tall
• Some (1-10%) bare ground should be present. No signs of excessive

erosion
• 90% of grasses in maritime grassland should be 1-5 cm tall
• 75% of grasses in maritime grassland should be 1-3 cm tall

5.2 BREEDING AND PRODUCTIVITY

HEALTH OF THE FEATURE WILL BE INDICATED BY

• >2.5 fledglings per breeding pair each year
• All identified feeding areas are managed for Chough (60% grasses

<1.5cm throughout year)
• Breeding and non-breeding birds recorded feeding on the island each

year (summer & winter)
• No deaths or instances of disturbance from avoidable activities,

incorrect procedures or unnecessary structures

The seven pairs that attempted to breed in 2019 is one fewer than last year. The Management Plan for
Ynys Enlli (Wilkinson 2004) stated that the acceptable minimum limit for nesting pairs of Choughs is five

200 REP. BARDSEY BIRD FLD OBS

CHOUGH

pairs in three of any consecutive five-year period. The number of pairs has now been five or more for the
last 19 years and should therefore be seen as being in a favourable condition.

Productivity in 2019 was 1.57 chicks per pair. This is 16.19% lower than the 2018 productivity rate of 1.88
and is 37.14% below the acceptable minimum of 2.5 chicks per pair which is set in the Management
Plan. The supplement to the Management Plan (Moralee, 2010) targets ‘stable productivity’, but this
target has not been met since 2008.

Mean productivity over the last decade is 1.88 ±s.s.0.16 with fluctuations as low as 1.33 in 2010 and
reaching a peak of 3.00 in 2014; the 2019 productivity rate of 1.57 was 16.57% lower than the ten-year
mean. Wilkinson (2004) stated that one of the indicators of the ‘health of the feature’ would be the
production of >2.5 chicks per pair each year, however Fig. 5. shows that productivity of >2.5 chicks per
pair has been achieved in only one out of the past ten years. Based on this alone the feature would not
be in a favourable condition. However, productivity is calculated by dividing the number of young
fledged by the total number of pairs breeding or attempting to breed and does not take into account
the age structure or experience of the birds within that population. A larger population with a high
proportion of young, inexperienced birds, as currently on the island, will inevitably lead to lower
productivity than from a smaller population made up of experienced pairs. Therefore, the productivity
of Bardsey’s Choughs is expected to increase over the coming years as the current young birds gain
experience.

Productivity 5.0
4.5
4.0
3.5
3.0
2.5
2.0
1.5
1.0
0.5
0.0

1953
1955
1957
1959
1961
1963
1965
1967
1969
1971
1973
1975
1977
1979
1981
1983
1985
1987
1989
1991
1993
1995
1997
1999
2001
2003
2005
2007
2009
2011
2013
2015
2017
2019

Year

Productivity Mean 2.66 ±s.e.0.13

Fig. 5. Chough Productivity (chicks per pair) 1953-2019.

4.0

3.5

3.0

Productivity 2.5

2.0

1.5

1.0

0.5

0.0 2011 2012 2013 2014 2015 2016 2017 2018 2019
2010

Year

Productivity Mean 1.88 ±s.e.0.16

Fig. 6 Productivity (chicks per pair) 2010-2019.

63: 188-203 201

HOOPER

Over the past decade 154 young have been produced, with as few as eight in 2010, but as many as 24
in 2014 and an average of 15.40 ±s.d.4.81.

30
25

Number of Young 20

15

10

5

0 2011 2012 2013 2014 2015 2016 2017 2018 2019
2010

Year

Young Mean 15.40 ±s.d.4.81

Fig. 7 Number of young produced per annum 2010-2019.

5.3 WINTERING AND NON-BREEDING CHOUGHS

No staff were present on the island during the winter periods at either end of the year. As a result, only a
single record was made in late February - see Figure 8. During the early part of spring there was once
again a non-breeding flock with up to 22 birds seen in the first few months of the year (although this
includes many of the breeding birds). With the start of breeding activity in March a maximum of 22 birds
was noted. There was a small (10-16 birds) non-breeding flock in April and early May this year (slightly
fewer than last year), a continuation of the non-breeding birds that have lingered into the breeding
season in recent years.

30

25

Daily count of birds 20

15

10

5

0

J FM AM J J A S O ND

Fig. 8 Maximum daily counts for Choughs on Bardsey in 2019.

6 SUMMARY

2019 saw another poor breeding season for Chough on Bardsey, with a decrease of one pair from 2018’s
figure and a 16.19% decrease in productivity. It also proved to be another year that Chough have not
met the proposed productivity rate.

During 2019 there were eight potential pairs of Choughs on Bardsey. The pair that have previously nested
at Tornado Ledge or Little Kitt Colony, however, was only made up of the female bird that created a
’threesome’ with the pair from Ogof Barcut, a typical behaviour shown by Choughs after recently losing
a partner and so this female did not form a new pair this year. The female that previously nested with the

202 REP. BARDSEY BIRD FLD OBS

CHOUGH

male from the South End, another recently formed pair, changed partners and chose to nest with the
male from the West Coast pair of which the ‘usual’ female died last year. This left the South End male to
find a new female which he did, a two-year old female with no previous Bardsey sightings. This new
female was ringed at one of the Aberdaron sites 8km away. The result of this new pair forming was that
no young were raised this year from the South End. The pair from the Zawn were seen entering the Bae
Felen nest site early in the year and this perhaps was thought to have been in use until Storm Hannah hit
in late April. This pair were then seen more frequently using the Zawn site and although they seemed to
be very active no young were noted from this nesting attempt. The pair that nested at Ogof Barcut were
active in early spring, and were seen in the area subsequently, however a visit to the nest site during
early July revealed that the nest had been pulled apart with the lining pulled out, a good indication of
a failed breeding attempt; this again could have been affected by Storm Hannah forcing them to restart
the nesting attempt at a later date as the site is at almost sea level. The remaining four pairs, including
the newly formed West Coast pair, successfully fledged 11 young between them. One pair fledged four
young, two pairs fledged three young and one pair fledged a single chick. The resulting productivity
figure of 1.57 chicks per pair is 16.57% lower than the 2010-2019 mean (1.88±s.e.0.16). The number of
young fledged (11) is 28.57% lower than the ten-year mean (15.40 ±s.d.4.81). These figures are outside
the acceptable limits set out for the management of the NNR, SPA and SAC.

7 REFERENCES

Baillie, S.R. 1990. Integrated population monitoring of breeding birds in Britain and Ireland. Ibis, 132: 151-
166.

Bullock, I., Drewett, D. & Mickleburg, S. 1983. The chough in Britain and Ireland. Br. Birds, 76: 377–401.
Hayhow, D.B., Johnstone, I., Thorpe, R., Moore, A. and Finney, S. 2007. Breeding status of Choughs

Pyrrhocorax pyrrhocorax in the UK and Isle of Man in 2002. Bird Study, 54(1), pp.23-34.
Hewitt, K. & Wilkinson, H. 2003. Ynys Enlli NNR Conservation Management Plan. Countryside Council for

Wales.
Loxton, R.G. and Jones, P.H. 1995. The breeding birds of Bardsey, Skomer, Skokholm and the Calf of

Man.Part1: Introduction and species accounts. Rep. Bardsey Bird Fld Obs. 38: 84-159.
Loxton, R.G., Kittle, T. and Jones, P.H. 1999. Atlas of recoveries of birds ringed by Bardsey Bird and Field

Observatory 1953-1996. BBFO, Bethesda, Gwynedd.
McCanch, N. 2000. The relationship between Chough Pyrrhocorax pyrrhocorax breeding populations

and grazing pressure on the Calf of Man. Bird Study, 47: 295-303.
Moralee, A. 2010. Ynys Enlli Nature Conservation Management Plan drafted on behalf of the Bardsey

Island Trust by RSPB. Unpublished. Natural Resources Wales.
Perfect, E. 2018. Chough breeding studies update. Rep. Bardsey Bird Fld. Obs. 61: 208-219.
Reid, J. M., Bignal, E. M., Bignal, S., McCracken, D. I. and Monaghan, P. 2003. Environmental variability,

life-history covariation and cohort effects in the red-billed chough Pyrrhocorax pyrrhocorax.
Journal of Animal Ecology 72(1): 36-46
Reid, J. M., Bignal, E. M., Bignal, S., Bogdanova, M. I., Monaghan, P. and McCracken, D. I. 2011.
Diagnosing the timing of demographic bottlenecks: sub-adult survival in red-billed choughs.
Journal of Applied Ecology 48(3): 797-805
Roberts, P. 1983. Feeding habitats of Choughs on Bardsey Island. Bird Study, 30: 67-73.
Roberts, P. 1985. The Choughs of Bardsey. British Birds 78: 217-232.
Stansfield, S.D. 1999. Chough breeding success and choice of feeding habitat on Ynys Enlli in 1998. Rep
Bardsey Bird Fld Obs. 42: 59-64
Stansfield, S.D. 2003. Breeding success of the Chough Pyrrhocorax pyrrhocorax on Ynys Enlli in 2002.
Unpublished Report to NRW for Grant-aided work in 2002
Stansfield, S.D. & Carter, M. 2017. Chough breeding studies update. Rep. Bardsey Bird Fld. Obs. 60: 170-
180.
Wilkinson, H. 2004. Guide for Land Managers, Summary of island management plan 2002-2006 Volume
1: background & designated features. Countryside Council for Wales.

63: 188-203 203

BIRD RINGING The purpose of ringing birds is to collect data that are used to monitor
survival rates and birds’ movements, amongst other things. This
Birds ringed on Bardsey in 2019 provides a fundamental contribution to conservation as it helps
Samuel Prettyman scientists to understand the causes of changes in population sizes over
time, and therefore how to prevent and reverse declines. The data
collected from ringing can be analysed and used to inform decision
making by governments, conservation bodies and economic
developers.

All naturally occurring wild birds in the UK are protected from
persecution under the Wildlife and Countryside Act (1981). It is illegal
to kill, injure or ‘take’ any wild bird, or to take or damage the nest of
any wild bird whilst in use or being built. The eggs of all wild birds are
also protected. It is an offence to have in your possession any live wild
birds. As a result, all bird ringing in the UK requires a special licence,
and is done under specific regulations.

The British and Irish Ringing Scheme is run and administered by the

British Trust for Ornithology (BTO*) - www.bto.org,

The BTO issue ringing licences on behalf of the UK and Irish
Governments. A licence to ring birds is issued only after initial approval,
followed by a lengthy training process by an authorised instructor.
Qualified ringers catch birds using mist nets, Heligoland traps, spring
traps and other methods; a small, uniquely numbered metal ring is
then carefully placed around the bird’s leg providing a reliable and
harmless method of identifying the birds as individuals.

Ringing at Bardsey Bird Observatory operates to a high standard and
skilled ringers also offer training in ringing. In line with BTO
regulations, all of the ringing data that Bardsey Bird Observatory has
collected since 1953 has been submitted to the BTO and has been
incorporated into their national database, as well as being held in our
own databases both on and off the island for safekeeping.

*The BTO is one of the world’s leading impartial scientific research organisations

specialising in knowledge about wild birds. BTO are interested in changes to wildlife
populations in relation to their ecology and the habitats on which they depend. Their
information base includes long-term datasets that have been in place for at least 50
years.

204 REP. BARDSEY BIRD FLD OBS

Ringing a Firecrest © Lewis Hooper 205
63: 204-217

PRETTYMAN

1 INTRODUCTION

Each year birds migrate along their flyways all over the world in spring and autumn, many, as can be
seen in the systematic list on page 66 are endangered. One of the ways we can understand more about
them is to collect scientific data to support conservation, ringing forms part of the important research
necessary to help protect species that are declining. Ornithologists around the world have been ringing
for over 100 years and much of our current knowledge about migration and populations that we have
today has come from ringing data.

Bardsey Bird Observatory started ringing when it was established in 1953 and has an ongoing program
of ringing, with data now spanning over 66 years. So far there have been 293,966 birds of 196 species
ringed on the island.

2 METHODS

Birds are trapped by licenced ringers in a variety of ways, such as in mist nets, Helgoland traps, spring
traps, by woosh-netting, dazzling and a number of other methods. A small metal ring is then placed on
the bird’s leg using specialised pliers and rings; data are recorded about each individual bird.

A summary of the ringing that was undertaken during the 2019 season is presented below, broken down
monthly from mid-March when ringing began, to late October, followed by a table showing the totals
of each species ringed during the year.

3 RESULTS

A total of 3738 birds was ringed in 2019, 42 birds fewer than last year’s total of 3780, a reduction of 1.11%
and 17.65% below the 1953-2019 mean (4537.84±s.d.1938.49). Full-grown birds made up 76.84% of this
total, which equates to 2871 birds, a decrease of 8.74% compared to the total in 2018 of 3146. However,
the total number of pulli ringed in 2019 was 867, which is an increase of 36.75% compared to 2018; as
usual, seabirds made up the vast majority of this total. The decrease in the number of full-grown birds
caught was due to a noticeable lack of passage migrants in both spring and autumn, for example in
April just 63 Willow Warblers were caught. Afro-Palearctic migrants were thought to be held up early in
the migration period by weather systems in southern Europe during spring, and persistent south-westerly
winds during autumn appeared to hinder migrants. There were some glaring omissions from this year’s
species tally; no Fieldfares or Water Rails were trapped for the second consecutive year, also Moorhens
were another notable omission, despite being a constant feature in Cristin Garden. As well as these,
species like Wood Warbler, Tree Pipit, Blue Tit, Coal Tit, and Starling all avoided capture in 2019.

Three visits were made to Ynys Gwylan Fawr to monitor and ring seabirds. Unfortunately, due to a
combination of weather and tides, a visit to Ynys Gwylan Bach was not possible, as a result no Cormorant
chicks were ringed. A total of 101 Shag chicks was ringed, some of which had both metal and Darvic
rings this year; these were predominantly ringed on Ynys Gwylan Fawr, but several broods were also
ringed on Bardsey. This total was 13 more than the 88 ringed last year. A total of 37 Great Black-backed
Gulls was ringed this year, all of which were pulli and most of which were also fitted with Darvic rings.
There was a total of 173 Herring Gull pulli and eight Lesser Black-backed Gull pulli ringed. Razorbill
numbers increased dramatically from last year’s total of 88, with 243 ringed in 2019. Guillemots also saw
a good increase, with 76 ringed, compared with 12 ringed in 2018.

206 REP. BARDSEY BIRD FLD OBS

BIRD RINGING

Shag © Steven Stansfield

Manx Shearwater was once again the most numerous bird to be ringed in 2019 by a huge margin, more
than doubling the next highest total. A total of 1005 birds was ringed, this comprised 787 full-grown birds
and 218 pulli. This total is significantly lower than 2018’s total of 1288, which was the highest since 2005.

A total of 62 species was ringed this year. 2019 was a poor year for diversity, not only was there a low
number of expected migrants, but it went without the good fortune that brought rarer birds in 2018;
scarce species such as Subalpine Warbler, Blyth’s Reed Warbler and Marsh Warbler were not recorded
this year. Despite this, the island species ringing list increased by two in 2019, with the addition of Isabelline
Wheatear and Western Orphean Warbler. Furthermore, a Greenish Warbler was ringed in June and the
first Grey Wagtail to be ringed in over 20 years was captured at Cristin in September.

3.1 MONTHLY SUMMARIES

Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Total

Number 0 0 92 290 348 867 562 584 771 224 0 0 3738
Ringed
Number 0 0 4 15 24 28 23 30 30 19 0 0 62
Species

MARCH

Ringing began on 23rd when nets were erected at Cristin; the first birds to be caught were Chiffchaffs,
most of which had pollen horns indicating they had wintered south of the UK, and Goldcrests with a
catch that took place in the late afternoon. The first Willow Warblers were trapped on 29th. The total for
the end of the month was quite low due to a shortage of staff and good weather, with totals of three
Wrens, 43 Chiffchaffs, 11 Willow Warblers, and 35 Goldcrests.

63: 204-217 207

PRETTYMAN

APRIL

The first full month of ringing resulted in a total of 290 birds of 15 species, 64.29% lower than last April. There
was a dramatic decrease in the number of birds both ringed and recorded this spring. One factor
responsible for this decline was a lack of trans-Saharan migrants, this could be due to the adverse
weather that took place in southern Europe and storms in Northern Africa which hindered the movement
of birds coming north. However, the first Swallow of the year was caught and ringed after flying into the
ringing hut, the only Swallow to be ringed this month. April is the month for peak spring Willow Warbler
passage on Bardsey, but just 62 were ringed this April, 64.97% fewer than 2018 when 177 were ringed.
Blackcaps were, in fact, the most numerously ringed species with 97 during the month, but still 121 fewer
than April 2018’s total of 218. The year’s first Sedge Warblers were caught, six in total; last April saw a total
of two so this was a pleasant increase. 73 Chiffchaffs were ringed, a 35.40% decrease from last April’s
total of 113. One Pied Flycatcher was a welcome addition to the year’s ringing list, one of five to be
ringed in 2019, one more than last year, but 69.11% below the 1953-2019 mean (16.18±s.d.15.23). Another
scarcely caught bird that was added to the year list this month was the year’s only Great Tit, which found
its way into a net at Cristin, as did the year’s first Stonechat. Due to the adverse weather back in 2018,
namely ‘the Beast from the East’, a whopping total of 100 Goldcrests was ringed in April 2018; this year
did not compare well and just five were caught, a drop of 95%.

April saw a range of finches, 23 Goldfinches were caught during the month which is 60.87% of the year’s
total of 37, a decline of 60.64% from 2018’s impressive total of 97, but still above the 1953-2019 mean
(27.05±s.d.45.14). Other finches to be ringed include four Lesser Redpolls, seven Chaffinches, and one
Linnet. Two Whimbrels were dazzled on the Narrows and colour-ringed; this was the total for the year,
equal to last year’s total, and slightly above the 1953-2019 mean (1.85±s.d.3.83).

MAY

The weather was generally settled, with most days experiencing nothing more than a gentle breeze;
many days started with drizzle and fog and later became clear and sunny. The month’s tally decreased
by 6.50% compared to last year, 348 birds of 24 species were ringed which is equal in diversity when
compared to May 2018. However, 170 Manx Shearwaters made up for 48.85% of this month’s total;
excluding this species, a more modest total of 178 birds was ringed. A Storm Petrel net was erected at
the bottom of Nant Valley late in the month and an evening session produced one bird.

As in April, Willow Warblers, saw further declines in May; a total of 39 is a 39.06% decrease from last May
and 51.52% less than May 2017. A total of 29 Chiffchaffs was ringed, 61.84% less than the total of 76 ringed
in May 2018. Phylloscopus warblers were recorded in far fewer numbers this year, as reflected in the
ringing totals. On good days they mainly favoured the spruce trees in the Plantation and at Cristin where
they fed on aphids during spring, but even so, day counts seldom reached triple figures.

May was the most productive month of the year for Sedge Warblers, nine were trapped which made up
33.33% of the year’s total of 27, well below the 1953-2019 mean (172.65±s.d.132.94). Other warbler totals
include two Lesser Whitethroats, four Whitethroats, 32 Blackcaps and the first Garden Warbler ringed, a
species that went un-ringed in 2018. Finch passage included three Siskins, six Lesser Redpolls, six
Chaffinches, and seven Goldfinches. As with last year, May was once again the best month for Spotted
Flycatchers; 25 were ringed throughout the month, 67.57% of the year’s total of 37, this year’s total is
22.92% lower than 2018 and 36.83% lower than the 1953-2019 mean (58.57±s.d.47.57). A Purple Sandpiper
was a welcome addition to the year list, after being dazzled on Henllwyn; 2019 is now the sixth year in a
row in which this species has been trapped. Dazzling successes also included four Dunlins caught around
the Narrows, 33.36% of the year’s total of 11, well above the total of three in 2018 and slightly above the
1953-2019 mean (8.80±s.d.8.84).

208 REP. BARDSEY BIRD FLD OBS

BIRD RINGING

Disappointingly, this May did not see many scarce species make their way onto the ringing list, but a
Firecrest caught at Nant was a nice addition nonetheless. One House Martin and one Collared Dove
were other scarcely ringed birds added to the totals this year, each caught at Cristin by chance.
Historically, only 37 House Martins and 56 Collared Doves have been ringed on Bardsey. However, the
undeniable rarity highlight of the month and year, was a rather fine male Western Orphean Warbler
trapped and ringed at Cristin on 19th, a first for Bardsey and only the second to be ringed in Britain.

JUNE

Migration had slowed down by the time June arrived. Two Robins, one Whitethroat, three Blackcaps,
eight Chiffchaffs, four Willow Warblers, six Spotted Flycatchers and seven Goldfinches constituted some
of the more predictable captures. However, a Greenish Warbler that was caught in the Heligoland trap
after it was heard singing at Cristin was the twelfth to be ringed in the Observatory’s history. House
Sparrow was back on the ringing list after being absent last year; historically, up to 75 have been ringed
in a single year, but as the species has declined across the country, they have become increasingly rare
on Bardsey.

Seabirds made up the bulk of the ringing totals in June. Visits to the Gwylan Islands and the East Side
were made which resulted in 98 Shags, eight Lesser Black-backed Gulls, 166 Herring Gulls, 36 Great Black-
backed Gulls, 78 Guillemots, 229 Razorbills and 14 Puffins being captured. This year Shags, Lesser Black-
backed Gulls, Herring Gulls, and Greater Black-backed Gulls were ringed with Darvic rings if they were
of a suitable size. The 98 Shags ringed made up almost the entire year’s total of 101, an increase of 23.17%
compared to last year. Herring Gull, as usual, was the most numerous pullus species ringed this month,
and a total of 173 ringed during the year, seven fewer than last year. This year saw a 236.36% rise in the
number of Great Black-backed Gulls ringed when compared to the 11 ringed in 2018, and a stark
increase compared to the 1953-2019 mean (16.94±s.d.21.83). All of the 37 Great Black-backed Gulls
ringed throughout the year were ringed on Ynys Gwylan Fawr most of which were fitted with green and
white alpha-numerically engraved Darvic rings.

Greater Black-backed Gull © Steven Stansfield

63: 204-217 209

PRETTYMAN

The majority of auks were caught in the boulder scree on the East Side, and thanks to several trips with
multiple ringers a total of 216 Razorbills was ringed this month; 243 caught in 2019 is a 185.23% increase
on the 88 caught in 2018, and 176.10% above the 1953-2019 mean (93.75±s.d.81.55). 78 Guillemots were
ringed this month, the entire year’s total. Puffin totals saw only 19 ringed, 14 of which were in this month,
26.92% lower than the 2018 total of 26. This was simply due to the weather not being ideal to mist net
during visits to the Gwylans.

June was the most fruitful month for Storm Petrels, a total of 18 were ringed which contributed heavily to
the year’s total of 55, although this is 27.63% below last year’s total, it is still 243.42% above the 1953-2019
mean (16.02±s.d.25.58).

Dazzling sessions did not produce any wader numbers, though whilst ringing Manx Shearwaters at night
it was possible to dazzle juvenile Wheatears that were roosting near Cafn. This month five were ringed,
which proved to be the most productive month for the species; a total of 22 were ringed this year, the
vast majority were first-year birds. A Cuckoo was the scarcest bird to be trapped this month, a male
caught at Cristin on 14th was the only one of the year; 88 have now been ringed at BBFO.

JULY and AUGUST

Despite some occasional stormy weather, July and August were mostly hot and dry; some areas of the
UK experienced some of the hottest days on record; on 25 July on Bardsey, the thermometer just about
reached 27 degrees Celsius as a maximum for this period. Rainy weather was rarely a problem for ringing,
but the wind was on many occasions, and this made catching Manx Shearwaters a little trickier than it
otherwise could have been. However, it was by far the most ringed species for these two months, 653 of
the 1146 birds ringed in these months were Manx Shearwaters, that’s 56.98%. This total of 1146 is
practically equal to last year’s total of 1163, just a 1.46% decline. July and August were good months for
Storm Petrels, and 37 were trapped and ringed using voice playback lures at the bottom of Nant Valley
during any calm nights available. Another visit to the East Side in early July brought the auk ringing to a
close with a final 27 Razorbills and five Puffins.

The first returning waders arrived by early July, but not in any great numbers, meaning that it wasn’t until
August before the first were captured on the Narrows. Two Ringed Plovers were ringed which, added to
the five ringed in September, made up the year’s total of seven; nine were caught last year, meaning a
slight reduction of two. The rarest wader catch of the year was a Sanderling, rather surprisingly the 20th
ringing record of the species in BBFO history. Dunlin was the most commonly caught wader species in
2019 and six of the 11 ringed during the year were caught in August; this total seven higher than 2018
when a total of three were ringed. Finally, the fourth wader species to be ringed in August was Turnstone;
only one was caught this month, but considering this species was absent from the 2018 ringing list
altogether, this year’s total of three is fairly respectable, although still 36.48% below the 1953-2019 mean
(4.72±s.d.6.27).

In late August, the portable Heligoland trap was erected on Solfach in an attempt to capture Rock Pipits.
Along with three Meadow Pipits, 15 Rock Pipits were ringed in August by this method, and a total of 31
was ringed in 2019, 210% higher than 2018 and 31.70% above the 1953-2019 mean (23.54±s.d.23.71). This
year Rock Pipit was another species that received Darvic rings; due to complications with the former
colour ring combinations, three-letter coded Darvic rings were fitted to each Rock Pipit ringed this year.

Passerine ringing improved in August after the expected lull in July. Over the two months, 104 Willow
Warblers were ringed, this contributed year’s total of 240, which was considerably lower than the 1953-
2019 mean (828±s.d.569.11). Chiffchaffs were yet to arrive in big numbers, however, 15 were ringed,
150.00% more than July and August last year, signalling slightly earlier passage for the species.

210 REP. BARDSEY BIRD FLD OBS

BIRD RINGING

Pied Flycatcher © Steven Stansfield

Other warbler species to be ringed included 14 Whitethroats, a Garden Warbler, the only Grasshopper
Warbler of 2019 (equal to the total in 2018), ten Sedge Warblers and four Blackcaps. The first Goldcrests
began to trickle through in July, and by the end of August 19 had been ringed, a small contribution to
the total of 423 that were ringed in 2019, 120.31% higher than 2018’s total of 192, but still falling 12.76%
short of the 1953-2019 mean (484.86±s.d.491.28).

Returning flycatchers for these months included four Spotted Flycatchers and four Pied Flycatchers which
was 75% of the year’s total for the latter. Only a handful of finches were ringed during this period,
including six Chaffinches and six Linnets. In total 35 Swallow chicks were ringed, making up 72.92% of the
48 to be ringed in 2019.

SEPTEMBER

Following the very quiet September in 2018, numbers increased this year by 367.27%, a jump from 165
birds in September 2018 to 771 in 2019. The most numerously ringed species this month by quite a
significant margin was Goldcrest with 302 trapped. Goldcrest totals are usually highest in September,
although 302 is a 694.74% increase on September 2018 when just 38 were ringed. The second most
numerous species for this month was Meadow Pipit, 111 were ringed; some were caught in the portable
Heligoland trap on Solfach, but the majority were trapped in the field in front of Cristin using a large
triangle of nets and a voice playback lure. Unfortunately, the weather only allowed this on two mornings,
nonetheless 116 were ringed this year in total, 300.00% more than 2018 and 243.82% above the 1953-2019
mean (33.74±32.89). Manx Shearwater ringing came to an end in September with 19 chicks ringed
throughout the month; the species had an early breeding season this year on Bardsey, so by this point
the majority had already fledged. The third species to bulk out the totals was Chiffchaff, 93 were ringed
making up 35.36% of the 263 ringed in 2019; this year’s total is 13.36% higher than last year, but slightly
lower than the 1953-2019 mean (288.54±s.d.159.04). As in August, the portable Heligoland produced 15

63: 204-217 211

PRETTYMAN

more Rock Pipits, making up nearly half the year’s total of 31, and rounding off a good year for the
species.

Warbler species included three Reed Warblers and the third and final Garden Warbler of the year,
(despite none being ringed in 2018). 2019 still falls well short of the 1953-2019 mean (24.12±s.d.23.70) for
Garden Warbler. The third and final Lesser Whitethroat of the year was ringed along with two
Whitethroats, bringing the 2019 total to 23. There were 64 Blackcaps and the final 23 Willow Warblers of
the year ringed, along with the second Firecrest of the year.

Dazzling was fairly successful and three Mallards added some variety to the totals, especially as only 42
have been ringed previously in BBFO’s history. Five Ringed Plovers and one Dunlin were also caught
around the Narrows, bringing their totals for 2019 to seven and 11 respectively. This Ringed Plover total is
two lower than 2018, but considerably higher than the 1953-2019 mean (3.09±s.d.3.43). For Dunlin, this
year was more productive than 2018 when just three were ringed, giving an increase of 266.67%. 2019
was a good year for Turnstones the one ringed this month added to the total of three caught throughout
the year,

The rarest birds to be ringed this month included a Grey Wagtail, the first to be ringed on Bardsey since
1996, but topping that was an Isabelline Wheatear that was caught on the Narrows, a new addition to
the Bardsey ringing list. The year’s only Woodpigeon was ringed this month, a juvenile that made its way
into the Heligoland trap at Cristin. Other species include 64 Robins, 29 Wrens and eight Blackbirds. This
was easily the most productive month for Robins, with 69.57% of the year’s total being caught. The 2019
total of 92 is 27.04% higher than the 1953-2019 mean (72.42±s.d.39.89) and 17.95% higher than last year’s
total of 78. Finch passage was yet to get into full swing, however a total of seven Chaffinches and one
Goldfinch were trapped.

OCTOBER

A total of 223 birds of 19 species were ringed. Some highlights for the month include two Yellow-browed
Warblers, two Bramblings and one Ring Ouzel. The Yellow-browed Warblers were heard in Cristin garden
one evening and were later caught. The Bramblings were the only two to be caught all year. Historically,
a staggering 326 have been caught in a single year and the 1953-2019 mean is therefore held quite high
at 10.75±s.d.41.38. Ring Ouzel was a nice addition to the 2019 totals, and is a seldom ringed species;
none were caught last year and only 116 have been caught since BBFO was founded. Other thrushes
include 16 Song Thrushes, 13 Redwings and 11 Blackbirds. Due to the numbers this month, Song Thrushes
finished the year with a total of 20, four more than 2018. Blackbirds also had a better year than last with
a total of 50. Goldcrest numbers were lower this month compared to September, a total of 59 were
ringed, which is respectable when compared to 45 caught in October 2018. This leaves the year’s total
at 423. Six Blackcaps were trapped in October, bringing the year’s total to 204, almost double the 1953-
2019 mean (110.66±s.d.118.48).

Finch passage increased in October, Chaffinch, Greenfinch, Goldfinch, Siskin, Brambling and Lesser
Redpoll were amongst the species ringed. 73 Chaffinches were ringed and contributed towards the 2019
total of 94, this total is however 56.75% below the 1953-2019 mean (217.32±s.d.208.23). Lesser Redpoll
numbers saw a total of 11 ringed. The last bird to be ringed in 2019 was a female Blackbird, but the last
bird to be caught was a re-trapped Barn Owl on 27th at Nant, which had been ringed on Bardsey back
in September 2015.

212 REP. BARDSEY BIRD FLD OBS

BIRD RINGING

3.2 TOTALS TABLE

Table 1. Number of birds ringed in 2019, a comparison with the 2018 totals and with the 1953-2019
mean, number of birds ringed from 1953-2019, the annual maxima, and the 1953-2019 mean

∑ compares 2019 total with 2018 total, x̄ compares 2019 total with 1953-2019 mean, ↑ = Up on, = = Equal to, ↓ = Down on, FG = Full Grown

Species 2019 2019 2019 ∑ x̄ 53-2019 53-2019 53-2019 Annual 53-2019
Pullus FG Total Pullus FG Total Maxima Mean
Quail
Shelduck 3 1 ↓= 2 5 5 1 0.08
Mallard 1 ↓= 28 8 10 3 0.15
Teal 1 3 ↑↑ 17 45 6 0.69
Nightjar 37 ↓↓ 1 9 9 2 0.14
Swift 173 7 ↓= 1 3 3 1 0.05
Cuckoo 2 ↓= 44 29 29 6 0.45
Rock Dove 8 3 1 ↓↑ 87 88 8 1.35
Stock Dove 1 ↓= 53 1 2 2 0.03
Woodpigeon 11 ↓= 700 1 1 0.02
Turtle Dove 1 1 ↓= 149 135 1 12 2.75
Collared Dove ↓= 37 179 9 0.57
Water Rail 1 ↑↑ 26 57 37 6 0.88
Corncrake ↓= 2 221 57 17 3.42
Sora ↓= 3 15 221 5 0.23
Moorhen ↓= 1 1 0.02
Little Grebe ↓↓ 1,037 398 15 37 6.94
Oystercatcher ↓= 1,088 3 1 2 0.05
Lapwing ↓↓ 10,124 159 54 13.22
Golden Plover ↓↓ 2,555 10 451 26 2.45
Grey Plover ↓= 4 3 1 0.06
Ringed Plover ↓= 3 1 0.05
Dotterel 7 ↑↓ 175 859 16 3.09
Whimbrel ↓= 2 159 1 0.03
Curlew 2 ↑= 118 26 1.85
Bar-tailed Godwit ↓= 112 4 22 1.77
Turnstone ↓= 43 3 6 0.66
Knot 3 ↓↑ 307 201 31 4.72
Curlew Sandpiper ↓= 75 2 18 1.15
Sanderling ↓= 6 120 3 0.09
Dunlin 1 ↑↑ 20 115 4 0.31
Purple Sandpiper 11 ↑ ↑ 572 43 45 8.80
Baird's Sandpiper 1 ↓↓ 66 307 17 1.02
Little Stint ↓= 1 75 1 0.02
Pectoral Sandpiper ↓= 8 6 1 0.12
Woodcock ↓= 2 20 1 0.03
Jack Snipe ↓↓ 58 572 12 0.89
Snipe ↓= 39 66 6 0.63
Grey Phalarope ↓↓ 55 1 8 0.85
Common Sandpiper ↓= 4 8 1 0.06
Spotted Sandpiper ↓= 64 2 9 0.98
Redshank ↓= 1 58 1 0.02
Greenshank ↓↓ 131 39 11 2.02
Kittiwake ↓= 3 55 1 0.05
Sabine's Gull ↓= 189 4 144 18.86
Black-headed Gull ↓= 2 64 1 0.03
Great Black-backed Gull ↓= 1 1 1 0.02
Herring Gull 37 ↑ ↑ 13 131 88 16.94
Lesser Black-backed Gull 173 ↑ ↓ 129 3 768 157.74
Little Tern 8 ↓= 211 1,226 237 42.55
↓= 1 2 1 0.02
1
1,101
10,253
2,766
1

63: 204-217 213

PRETTYMAN

Species 2019 2019 2019 ∑ x̄ 53-2019 53-2019 53-2019 Annual 53-2019
Pullus FG Total Pullus FG Total Maxima Mean
Common Guillemot
Razorbill 52 24 76 ↑↑ 1,827 254 2,081 272 32.02
Black Guillemot 218 25 243 ↑↑ 4,803 1,289 6,092 325 93.75
Puffin ↓= 0.03
Storm Petrel 14 5 19 ↓↓ 2 755 2 2 21.62
Leach's Petrel 218 55 55 ↑↓ 650 1,023 1,405 85 16.02
Fulmar 101 787 1,005 ↓= 1,041 126 0.54
Manx Shearwater 101 ↓= 18 35 2.40
Gannet 3 3 ↑↓ 105 51 35 4 687.54
Shag 3 ↓= 7,671 36,923 156 21 0.05
Cormorant 35 1 ↑↑ 4,609 3 44,594 2243 72.17
Bittern 13 3 ↓= 1,319 82 20.48
Grey Heron ↓= 12 3 1 0.02
Sparrowhawk 1 1 ↓= 11 4,691 243 0.08
Hen Harrier 2 48 ↑↑ 1 1,331 128
Barn Owl 240 ↓= 45 5 1.83
Little Owl 263 1 ↓= 1 108 1 1 0.02
Long-eared Owl 2 ↓= 1 5 1
Hoopoe 240 ↓= 24 7 119 9 0.11
Kingfisher 263 ↓= 56 51 1 1 1.48
Wryneck ↓= 23 7 1 0.37
Gr’t Spotted Woodpecker ↓= 270 3 96 8 0.05
Green Woodpecker ↓↓ 511 1 24 4 0.02
Kestrel ↓= 156 35 3 1 0.54
Merlin ↓= 335 34 1 1 0.52
Peregrine ↓= 66 1 35 4 0.02
Ring-necked Parakeet ↓= 18 34 5 0.65
Red-backed Shrike ↓= 2 9 1 1 0.14
Isabelline Shrike ↓= 24 42 4 0.86
Great Grey Shrike ↓= 1 9 2 0.02
Woodchat Shrike ↓= 15 9 56 4 0.14
Red-eyed Vireo ↓= 1,229 1 1 1 0.02
Golden Oriole ↓= 1 9 2 0.02
Jay ↓= 3 12 1 1 0.18
Magpie ↓= 1 1 1 0.02
Chough ↓↓ 6 21 12 2 0.32
Jackdaw ↓↓ 1 4 1 1 0.06
Carrion Crow ↓↓ 129 21 4 6.14
Raven ↓= 49 4 2 8.62
Coal Tit ↓= 182 399 29 5.20
Willow Tit ↓↓ 9 560 31 5.29
Blue Tit ↓= 338 67 1.02
Great Tit ↓↓ 389 344 16 5.98
Penduline Tit ↓↓ 1 66 8 0.02
Woodlark ↓= 389 57 15.71
Skylark ↓= 1,019 1 1 9.60
Sand Martin ↓= 600 1,021 266 0.02
Swallow ↓= 624 62 0.02
House Martin ↑= 1 1 1 8.98
Cetti's Warbler ↑↓ 1 1 1 0.34
Long-tailed Tit ↓↓ 569 584 119 31.43
Wood Warbler ↓= 22 22 6 0.58
Western Bonelli's Warbler ↓↓ 814 2,043 137 0.02
Yellow-browed Warbler ↓= 35 38 6 5.40
Pallas's Warbler ↑↑ 1 1 1 1.66
Radde's Warbler ↓= 351 351 53 0.12
Dusky Warbler ↓= 108 108 7 1.62
Willow Warbler ↓= 8 8 2 0.26
Chiffchaff ↓↓ 105 105 14 0.06
↓↑ 17 17 3 0.03
4 4 1 828.89
2 2 1 288.54
53,872 53,878 2789
18,754 18,755 859

214 REP. BARDSEY BIRD FLD OBS

BIRD RINGING

Species 2019 2019 2019 ∑ x̄ 53-2019 53-2019 53-2019 Annual 53-2019
Pullus FG Total Pullus FG Total Maxima Mean
Greenish Warbler
Arctic Warbler 4 1 1 ↑= 5 12 12 3 0.18
Great Reed Warbler ↓= 1 1 1 0.02
Sedge Warbler 27 ↓= 1 2 2 1 0.03
Paddyfield Warbler 1 644 172.65
Blyth's Reed Warbler 3 27 ↓ ↓ 11,217 11,222 1 0.02
Reed Warbler ↓= 19 1 1 2 0.06
Marsh Warbler 1 ↓↓ 48 4 4 10 2.66
Booted Warbler 204 36 1 0.12
Melodious Warbler 3 ↑↓ 284 173 173 1 0.03
Icterine Warbler 3 ↓↓ 15 8 8 9 1.32
Lanceolated Warbler 3 ↓= 73 2 2 3 0.57
Grasshopper Warbler 1 ↓= 1 0.03
Blackcap 20 ↓= 104 86 86 197 27.15
Garden Warbler 2 ↓= 589 37 37 728 110.66
Barred Warbler 423 112 24.12
Lesser Whitethroat 145 1 ↓= 2 2 2 3 0.28
Western Orphean Warbler 204 ↑ ↓ 60 1,764 1,765 19 2.80
Whitethroat 1 250 7,192 7,193 0.02
Subalpine Warbler 50 3 ↓↑ 341 1,568 1,568 489 100.00
Firecrest ↓= 146 2 0.31
Goldcrest 13 18 18 4.29
Wren 20 3 ↑↑ 182 182 20 484.86
Nuthatch 37 1 ↑↑ 2566 69.58
Treecreeper 92 20 ↓ ↑ 1 1 0.05
Rose-coloured Starling 6,481 6,500 166 0.80
Starling 5 ↓↓ 1 0.02
Grey-cheeked Thrush 2 ↓= 20 20 3 85.28
Ring Ouzel 10 423 ↓ ↑ 279 279 1 0.03
Blackbird 22 145 ↑ ↑ 31,515 31,515 1.80
Eyebrowed Thrush 4,474 4,522 812 154.28
Fieldfare 1 ↓= 1 0.02
Redwing 1 ↓↓ 3 3 2.83
Song Thrush 28 ↓= 52 52 13 81.11
Mistle Thrush 1 ↓↓ 550 51.71
Spotted Flycatcher 3 ↓= 1 1 0.20
Robin 116 1 ↓↑ 5,501 5,537 1 58.57
Bluethroat 50 ↓ ↓ 16 72.42
Nightingale 31 ↓= 2 2 554 0.03
Red-flanked Bluetail ↓= 117 117 156 0.45
Pied Flycatcher 13 ↓ ↑ 9,717 10,001 2 0.02
Red-breasted Flycatcher 20 ↓ ↑ 264 16.18
Black Redstart ↓= 1 1 167 0.74
Redstart 37 ↓ ↓ 183 183 1.22
Whinchat 92 ↑ ↑ 5,247 5,247 1 10.11
Stonechat ↓↓ 3,336 3,351 5 2.05
Wheatear ↓= 1 14.09
Isabelline Wheatear ↓= 13 13 84 30.54
House Sparrow 5 ↓↑ 3,807 3,807 4 0.02
Tree Sparrow ↓= 4,630 4,703 6 7.45
Dunnock ↓= 55 0.17
Yellow Wagtail ↓↓ 2 2 15 28.77
Grey Wagtail ↓= 29 29 54 0.22
Pied/White Wagtail 10 ↓ ↑ 197 0.23
Richard's Pipit 22 ↓ ↑ 1 1 12.95
Meadow Pipit 1 ↑↑ 1,052 1,052 75 0.02
Tree Pipit 1 ↓↑ 3 33.74
Water Pipit ↓= 48 48 2.06
Rock Pipit 32 ↑ ↓ 79 79 93 0.02
↓= 657 657 8 23.54
1 ↑↑ 133 133 3
3 ↓↓ 808 912
↓= 1,396 1,985 48
116 ↑ ↑ 1
↓↓ 1 1
↓= 482 484 168
31 ↑ ↑ 12
11 11 1
1,807 1,867 95

14 14
15 15
592 842

1 1
1,851 2,192

134 134
1 1

1,384 1,530

63: 204-217 215

PRETTYMAN

Species 2019 2019 2019 ∑ x̄ 53-2019 53-2019 53-2019 Annual 53-2019
Pullus FG Total Pullus FG Total Maxima Mean
Chaffinch
Brambling 867 94 94 ↓ ↓ 25 14,099 14,124 957 217.32
Hawfinch 13 2 2 ↓↓ 699 699 326 10.75
Bullfinch 4 ↓= 51 6 6 0.09
Common Rosefinch 7 ↓↓ 1 68 68 1
Greenfinch 11 ↓↓ 29 29 7 1.05
Twite 4 ↓↑ 15 3 0.45
Linnet 37 ↓= 2,566 2,566 233 39.52
Common Redpoll 6 7 ↓↑ 3 1 1 1 0.02
Lesser Redpoll ↓↓ 105 26.28
Redpoll Sp. (Common/Lesser) 2,871 11 ↓ ↓ 9 1,656 1,707 3 0.26
Crossbill 55 ↓= 17 17 88 15.95
Goldfinch ↓= 45 1.62
Siskin 1,034 1,035 1 0.03
Lapland Bunting 37 ↑ ↓ 105 105 230 27.05
Snow Bunting 6 ↑↓ 2 2 26 5.46
Yellowhammer ↓= 2 0.14
Ortolan Bunting ↓= 1,743 1,758 1 0.02
Little Bunting ↓↓ 355 355 11 1.25
Yellow-breasted Bunting ↓= 9 9 2 0.06
Black-headed Bunting ↓= 1 1 2
Reed Bunting ↓= 78 81 1 0.11
Song Sparrow ↓= 4 4 1 0.02
White-throated Sparrow ↓= 7 7 27 0.05
Dark-eyed Junco ↓= 1 1 1 4.09
Blackpoll Warbler ↓= 3 3 1 0.02
Summer Tanager ↓= 257 266 1 0.02
Rose-breasted Grosbeak ↓= 1 1 1 0.02
Red-headed Bunting ↓= 1 1 1 0.03
↓= 1 1 1 0.02
↓= 2 2 1 0.02
1 1 0.02
1 1
1 1

3,738 41,650 252,317 293,967

62 63 192 196

Isabelline Wheatear – The first to be ringed on Bardsey © Steven Stansfield

216 REP. BARDSEY BIRD FLD OBS

BIRD RINGING

Greenish Warbler – the 12th to be ringed on Bardsey Grey wagtail – The 15th to be ringed on Bardsey
© Steven Stansfield © George Dunbar

Western Orphean Warbler – The first to be ringed on Bardsey © Lewis Hooper

63: 204-217 217

RECOVERIES, RETRAPS & CONTROLS
George Dunbar

1 INTRODUCTION

Capturing birds which already have rings on, or finding a dead bird wearing a ring enables the collection
of data about birds’ movements around the world, as well as knowing how long they live. When a bird
with a ring on is re-captured, the number on the ring can be matched up to its original ringing details,
along with any subsequent information collected, thus helping build up a picture of the bird’s travels,
history and lifecycle. The more information that is collected, the more of an understanding of species’
behaviour and longevity can be made.

2 METHODS

Bird rings are made to fit different species of birds and are therefore produced in various sizes; each ring
size is assigned to a species according to the diameter of their tarsus (leg bone) and each ring is stamped
with a unique number. When a bird is caught, the appropriate ring size is carefully fitted by licenced
ringers, and details are recorded about the bird such as the length of the wing, its weight, the name of
the ringer, time, date etc. before releasing the bird back into its natural habitat. When birds are
subsequently trapped or found dead, they fall into one of the following three categories:

Re-trap - a bird that has been both ringed and re-captured at the
same site - in this case Bardsey

Recovery - a bird that was ringed on Bardsey and subsequently
found either at a different site (i.e. away from Bardsey) or dead at
the same site; in this case Bardsey

Control - a bird found to be wearing a ring which was fitted at a
different site - i.e. away from Bardsey

Data from controls are collected by Observatory staff and sent to the British Trust for Ornithology
(BTO) who process them and send back details of the history of the bird with its original ringing details.
They also send back information about recoveries of birds that were ringed on Bardsey and re-captured
elsewhere.

3 RESULTS

This season we received 53 recovery/control reports from the BTO with details relating to birds either
ringed on Bardsey and recovered elsewhere, or birds that were ringed elsewhere and controlled on
Bardsey. In addition to these we had a further control from the Norwegian Bar-tailed Godwit ringing
scheme. We were also notified about a number of our own colour-ringed birds directly from the
observers.

218 REP. BARDSEY BIRD FLD OBS

RINGING RECOVERIES

Below are a selection of some of the most interesting retraps, recoveries and controls from the year.

Age/ Sex codes
1 pullus (nestling or chick)
2 fully grown, year of hatching quite unknown
3 hatched during calendar year of ringing
4 hatched prior to calendar year of ringing, exact year unknown
5 hatched during previous calendar year
6 hatched prior to previous calendar year, exact year unknown
7 definitely hatched two calendar years before ringing
8 hatched more than two calendar years before year of ringing
M male
F female

Condition at recovery
+ intentionally killed by man
X found dead
XF found freshly dead or dying
XL found long dead
V alive, probably healthy; caught and released but not by a ringer
VV alive, probably healthy; ring/colour mark read in field but not by a ringer
R caught and released by a ringer
B caught and released by a ringer – nesting
RR alive, probably healthy; ring or colour mark read in field by a ringer
S found injured, not known to have been released
Sx found moribund (sick or injured, eventually died)
Sr found sick or injured, released after rehabilitation with ring
A alive, probably healthy - fate unknown
AC alive, probably healthy – now captive
/ / condition on finding wholly unknown

O Y S T E R C A T C H E R Haematopus ostralegus Pioden y Môr
164˚SSE
FB38058 3 07.07.2016 Bardsey

R 28.10.2018 Whiteford Sands, Gower, Swansea

843 days 132 km

Very few of the Bardsey-ringed Oystercatchers get recovered elsewhere, so it is good to see that some
do. This non-breeder was probably going to winter off the island, maybe in south Wales. The oldest known
Oystercatcher from the BTO ringing scheme was found dead 36 years and 11 months after being ringed,
with the oldest in Europe being killed by a bird of prey 43 years and 4 months after ringing!

61: 218-223 219

DUNBAR

Bar-tailed Godwits © Lewis Hooper

B A R - T A I L E D G O D W I T Limosa lapponica Rhostog Gynffonfraith

7218227 3 09.09.2018 Revtangen, Klepp, Rogaland, Norway 924 km 164˚SW
Yellow flag VV 30.04.2019 Bardsey

NLC VV 240 days Lady’s Island, Wexford, Ireland
VV 05.05.2019 Lady’s Island, Wexford, Ireland
24.05.2019
1039 km 164˚SW
265 days

K I T T I W A K E Rissa tridactyla Gwylan Goesddu

FX22819 1 12.07.2011 Plogoff, Finistère, Brittany, France

R- O B M VV Summer 13 Plogoff, Finistère, Brittany, France

L- B P Y VV Summer 14 Plogoff, Finistère, Brittany, France

VV Summer 15 Plogoff, Finistère, Brittany, France

VV Summer 16 Plogoff, Finistère, Brittany, France

VV Summer 17 Plogoff, Finistère, Brittany, France

VV Summer 18 Plogoff, Finistère, Brittany, France

VV 12.08.2019 Bardsey Island, Gwynedd

2953 days 520km 350˚N

A number of colour-ringed Kittiwakes from the colony at logoff have now been recorded on Bardsey

Kittiwakes © Lewis Hooper

220 REP. BARDSEY BIRD FLD OBS

RINGING RECOVERIES

G R E A T B L A C K - B A C K E D G U L L Larus marinus Gwylan Gefnddu Fwyaf

MA24969 1 19.06.2019 Ynys Gwylan Fawr, Gwynedd

B:160 VV 09.10.2019 Gann Estuary, Dale , Pembrokeshire"

VV 14.10.2019 Skomer Island, Pembrokeshire 203˚SW 118.9 km
240 days

MA24963 1 19.06.2019 Ynys Gwylan Fawr, Gwynedd

B:153 VV 07.09.2019 Skerries, Dublin

80 days 128.9 km 302˚NW

MA24987 1 19.06.2019 Ynys Gwylan Fawr, Gwynedd

B:174 VV 05.09.2019 Skomer Island, Pembrokeshire

VV 20.09.2019 Dale Airfield, Pembrokeshire

93 days 123.8 km 203˚SW

MA24980 1 19.06.2019 Ynys Gwylan Fawr, Gwynedd

B:170 VV 17.08.2019 Bangor, Gwynedd

59 days 63.1 km 41˚NE

From a total of 33 Great Black Backed Gulls that were fitted with darvic rings four were re-sighted by
the end of the year, with two birds being seen at multiple sites in Pembrokeshire.

H E R R I N G G U L L Larus argentatus Gwylan y Penwaig

GV85085 1 19.06.2019 Ynys Gwylan Fawr, Gwynedd

B:032 VV 24.12.2019 Arklow, Co. Wicklow - Ireland

186 days 97 km 270˚W

GA43125 1 09.06.2001 Lower Compton Landfill Site, Calne, Wiltshire

VV 26.11.2018 Lower Compton Landfill Site, Calne, Wiltshire

VV 30.11.2018 Lower Compton Landfill Site, Calne, Wiltshire

VV 24.12.2018 Lower Compton Landfill Site, Calne, Wiltshire

6407 days 241 km 128˚SE

In total 28 Herring Gulls were fitted with darvic rings, one of which was re-sighted across the Irish Sea.

G U I L L E M O T Uria aalge Gwylog

T73190 1 22.05.1989 Bardsey
X 27.10.2019 Llanbedrog, near Pwhelli, Gwynedd

11115 days 17km 64˚E

The typical lifespan of a Guillemot is 23 years, with breeding typically starting at 5 years old, so this bird
at over 30 years old is a good age, but still some time off the European record for Guillemot longevity at
42 years and 10 months from a Swedish bird.

R A Z O R B I L L Alca torda Llurs

M64179 1 05.06.1988 Bardsey Island, Gwynedd
R 14.06.2019 Bardsey Island, Gwynedd

11331 days

The typical lifespan of a Razorbill is about 14 years. This bird at over 31 years old was still breeding on the
east side of Bardsey in 2019, it was not handled in the preceding 30 years until 2018 when it was re-
trapped twice and re-ringed, then handled again in 2019. The world’s oldest known Razorbill was almost
42 years old when it was last handled, It was ringed on Bardsey on 02.07.1962 and last re-trapped on
here 25.06.2004 some 41 years 11 months and 23 days.

61: 218-223 221

DUNBAR

S T O R M P E T R E L Hydrobates pelagicus Pedryn Drycin

2662632 6 25.06.2016 Great Skellig, Kerry, Ireland 406 km 75˚ENE
2723642 R 05.07.2018 Bardsey 375 km 104˚ESE
2498613 172 km 67˚ENE
2578404 4 740 days High Island, Galway, Ireland 355 km 250˚WSW
2647854 R 30.08.2016 Bardsey 145 km
2647900 05.06.2018 311 km 360˚N
2515417 4 Brownstown Head, Waterford, Ireland 186˚S
R 674 days Bardsey
22.07.2017
4 23.07.2018 Cape Clear Bird Observatory, Cork, Ireland
R Bardsey
366 days
4 13.08.2017 Bardsey
R 05.07.2018 Calf of Man, Isle of Man

4 326 days Bardsey
R 06.07.2018 Hot Point, The Lizard, Cornwall
22.07.2018
4 Bardsey Island, Gwynedd
R 16 days Bardsey Island, Gwynedd
11.08.2018 Bardsey Island, Gwynedd
07.05.2019

300 days
24.07.2004
08.08.2008
24.08.2019
5509 days

M A N X S H E A R W A T E R Puffinus puffinus Aderyn-Drycin Manaw

FB10396 3 19.09.2002 Bardsey
FB52760
FB16287 XF 13.10.2018 Near Barra del Chuy, Brazil
FB34222
FB54028 5868 days 10725 km 207˚SSW
FB54378
FR23128 4 24.07.2003 Bardsey

FC23744 X 20.10.2019 Praia do Pinho, Balneário Camboriú, Brazil

5932 days 9847 km 206˚SSW

4 23.07.2003 Bardsey

X 09.10.2019 São Simão, Mostardas, Rio Grande do Sul, Brazil

5922 days 10456 km 238˚WSW

1 26.08.2009 Bardsey

X 15.10.2018 Ilha Comprida, São Paulo, Brazil

3337 days 9599 km 207˚SSW

4 18.07.2018 Bardsey

Sx 30.08.2018 Armação, Penha, Brazil

43 days 9826 km 206˚SSW

1 07.08.2018 Bardsey

XF 12.10.2018 Itanhaém, São Paulo, Brazil

66 days 9485 km 206˚SSW

4 30.06.1981 Bardsey Island, Gwynedd

28.08.1998 Bardsey Island, Gwynedd

24.05.2019 Bardsey Island, Gwynedd

13842 days

4 12.08.1987 Bardsey Island, Gwynedd

14.06.2007 Bardsey Island, Gwynedd

27.05.2019 Bardsey Island, Gwynedd

11611 days

222 REP. BARDSEY BIRD FLD OBS

RINGING RECOVERIES

FR23098 4 27.06.1981 Bardsey Island, Gwynedd

30.03.1994 Bardsey Island, Gwynedd

26.06.2019 Bardsey Island, Gwynedd

13878 days

FR17425 4 09.09.1980 Bardsey Island, Gwynedd

20.06.1984 Bardsey Island, Gwynedd

29.06.2019 Bardsey Island, Gwynedd

14172 days

Bardsey is home to 25,000 pairs of breeding Manx Shearwaters which begin to arrive in mid-March and
leave the island from mid-August, heading for Brazil. This year, six of our Manx Shearwaters were
recovered in Brazil, all of which were picked up after stormy weather. With increasing incidences of
storms, it will be interesting to see whether the number of recoveries of these birds increases. It is known
through ringing that these birds make the long migration between Bardsey and Brazil, and it is also
informative to see the time difference from when the first adults are recovered there (30.08.2018)
compared to the arrival of the first pulli (12.10.2018).

S H A G Phalacrocorax aristotelis Mulfran Werdd

1469718 1 19.06.2019 Ynys Gwylan Fawr, Gwynedd
DABV X 31.12.2019 Newlyn, Penzance, Cornwall

195 days 299km 210˚SW

C H I F F C H A F F Phylloscopus collybita Siff-saff
32˚NNE
KEE094 3J 09.07.2017 Cors Ddyga, Llangefni, Anglesey 59 km 18˚ NNE
JYE948 R 17.05.2018 Bardsey 535 km

312 days
3 01.09.2017 Deer Park Forest Croft, Highland, Scotland
R 15.10.2018 Bardsey

409 days

S E D G E W A R B L E R Acrocephalus schoenobaenus Telor penddu

S943368 3J 25.07.2017 Cors Ddyga, Llangefni, Anglesey 60 km 213˚SSW
S251089 R 13.07.2018 Bardsey

353 days 261 km 141˚SE
3 05.08.2018 Bardsey
R 17.08.2018 Squire’s Down, Dorset

12 days

A relatively quick recovery of Sedge Warbler S251089 which was ringed on Bardsey and recovered 12
days later in Dorset on this bird’s passage south for the winter.

G O L D C R E S T Regulus regulus Dryw Eurben

JCD373 3M 20.09.2016 Bardsey 429 km 102˚ESE
S251089 R 17.10.2019 Bawdey Manor, Suffolk

1122 days 310 km 97˚E
3 05.04.2018 Bardsey
R 04.10.2018 Abbey Farm, Cambridgeshire
R 16.10.2018 Abbey Farm, Cambridgeshire

194 days

Three years is a good age for a Goldcrest, with the oldest British recovery being a bird at five years and
two months.

61: 218-223 223

PRETTYMAN AND STANSFIELD

RARE BIRD REPORTS The following set of accounts
Accounts of rarities in 2019 are taken from the descriptions
Steven Stansfield, Samuel Prettyman and Martin Hosier as submitted to the British
Birds Rarities Committee
(BBRC). All were accepted by
BBRC and will be published as
such in their report for 2019 in
the journal British Birds.

Isabelline Wheatear REP. BARDSEY BIRD FLD OBS

© Lewis Hooper

224

BUFF-BELLIED PIPIT

61: 218-223 225

STANSFIELD

WESTERN ORPHEAN WARBLER Sylvia hortensis
A new species for Bardsey
Samuel Prettyman

226 REP. BARDSEY BIRD FLD OBS

WESTERN ORPHEAN WARBLER

FINDING ACCOUNT

Sunday is usually a half day for the Assistants at Bardsey Bird and Field Observatory, and I had been up
later than usual the night before, so I planned to lie in until 0800 hrs or 0830 hrs on Sunday 19th May 2019,
before doing some ringing and monitoring work. The weather hadn’t looked promising, just gentle
northerlies for the previous couple of days, and clear skies with no strong winds for over a week, so I
wasn’t too fussed about going all out birding around the island. However, my plan to wake up at 0800
hrs was thwarted when Lewis Hooper, my colleague and contemporary Assistant Warden knocked on
my door at 0720 hrs and said, “You ought to get the nets open, there’s a few birds around”. I, somewhat
reluctantly, got up and had the nets open in Cristin Garden by 0735 hrs and waited for the birds.

I was quite happy with the few birds that were caught, including a very red male Lesser Redpoll, and the
occasional Sedge Warbler, Whitethroat, etc… At around 1030 hrs, Lewis had returned from his morning
census walk and asked if he could join me with ringing; of course, I said “Yes, mate!”, and that I was
doing a net round in about ten minutes. I find it funny now, how I had no idea that this would be a net
round that would probably stick in my memory for years to come, and the story of it will be boring my
friends for possibly even longer, when a lot of the details have faded away.

At Cristin the nets are set up in numbered order, one to four being to the north of the garden, five in the
middle, and six to nine at the south end of the garden. I hadn’t opened one to three so I walked straight
to net five. At 1040 hrs I approached the net and saw from a distance a Dunnock, and a warbler that I
assumed to be a Lesser Whitethroat; I took a few steps and picked up the pace as some confusion set
in. As I got closer, the size of the warbler in the net struck me, it looked massive, “what is that?!” I got to
the bird and I imagine I went a bit pale, staring at me was a characteristic pale eye. I got the bird out of
the net and said to myself, “What is going on? Have I gone mad, or is this an Orphean Warbler?!” Sheer
disbelief was the leading emotion. I quietly but urgently called Lewis, “Lewis… Lewis!”, I heard him say
“uh oh” before appearing around the corner. Then I said to him “What’s this?”, and credit to him, without
hesitation he shouted, “mate, that’s a f*ckin’ Orphean Warbler! Check under the tail!” after a brief look
we decided we had better move on. We got the bird in a bag and just laughed at what was happening!
Absolute madness! I have never felt quite like that before! We hurried round the rest of the nets.

Some visitors had come to the Observatory to have a look through the moth trap; we told them we were
going to ring some birds first and then we’d be right out! We also added that they may want to see the
bird, for general interest and also because they may well never see one of these birds in Britain again!

We processed the Chiffchaffs, re-trap Dunnock, etc, and moved onto ‘the beasty’. Out of the bag, the
black head, contrasting with the white throat made up quite a distinctive male bird, and that eye!

The pale iris and the black pupil… Brilliant! The undertail coverts were now wet, but even back at the
nets, the general impression was of a Western Orphean Warbler Sylvia hortensis, generally buff-coloured
underparts and no visible chevron markings to the undertail coverts. Indeed, after a closer look back at
the ringing lab, this did appear to be the case, plus it was the more likely of the two Orphean Warblers
after all. After identifying it, I ringed the bird with a B sized ring and took a series of photographs and
proceded to consult the ‘Demongin ringers’ guide’. The bird was in its second calendar year (Euring age
code 5), based on the amount of wear on the tail and greater coverts. However, we initially thought
that the tail pattern was an indicator to distinguish between ‘Eastern’ and ‘Western’. This proved not to
be the case as ‘Eastern’ have a notch in the white marking on T6 only on adult tail feathers, and not on
first-generation feathers as in our bird, so we retrospectively took that factor out of the identification
process, especially as a diagnostic feature.

This was a very steep learning curve, and with the warden, Steve Stansfield, a very experienced ringer,
being away, Lewis and I had to muddle together our knowledge and do what we could in a very exciting

63: 226-229 227

STANSFIELD

situation! In all honesty, I was happy I remembered to ring it, and that I didn’t have a butter fingers
moment, as my hands were genuinely shaking!

After the bird was released it was unfortunately not relocated; a couple of birders came over to the
island to try and see it, but to no avail.

This species breeds around the Western Mediterranean, latitudinally as far north as Southern France, and
about as far east as Italy. It then winters south of the Sahara, so not a hugely long-distance migrant
compared to some other warbler species. This was the sixth record for Britain, second for Wales and first
for Bardsey.

DESCRIPTION

Immediately after getting the bird out of the net it was noticeably buff-coloured on its underparts, hinting
towards a Western Orphean Warbler. There was never a question about its identity as an Orphean
Warbler, they are large and characteristic warblers with pale iris’ and patterned almost like a giant Lesser
Whitethroat.

The only question was whether it was Eastern or Western. We took it back to the ringing room to closer
inspect it and check through literature and compare it with guides. The warbler we had totally lacked
chevron markings on its under-tail coverts and had much warmer colouration than the descriptions for
Eastern Orphean Warbler.

We never heard the bird sing or call, unfortunately, but a feather which dislodged during processing was
sent to Prof. Martin Collinson at Aberdeen University to be analysed for a DNA match with their database.
Martin replied to Steven Stansfield with the following message regarding the sample:

Hi Steve

Thom did the Orphean Warbler feathers you sent from Bardsey, 19/05/2019, and as you
might expect, it confirms it was a Western Orphean Warbler. There’s not a lot of comparison
material in Genbank but it matches a single S. hortensis from Spain and very divergent (6-
7%) from 4 S.crassirostris from Israel and Greece.

WOW01 hortensis had the following DNA coding

CTCTGCCTAATCATACAAATCGTCACAGGCCTATTCCTAGCAATACATTACACAGCAGATACCTCAC
TAGCTTTCGCCTCCGTAGCCCATACATGCCGAGACGTCCAATTCGGATGACTCATCCGCAACCTA
CACGCAAACGGAGCCTCTTTCTTCTTCATCTGCATCTACCTACACATCGGCCGAGGAATCTATTACG
GATCCTACCTAAACAAAGAAACCTGAAACGTAGGGGTCCTCCTCCTCCTAGCACTCATAGCCAC
CGCCTTCGTAGGCTACGTCCTCCCCTGAGGCCAAATATCATTCTGAGGCGCTACCGTAATTACAAA
CCTGCTCTCAGCCATCCCCTACATTGGACAGACACTAGTAGAGTGAGCCTGAGGAGGCTTTTCAG
TAGACAATCCTACACTCAC

Any questions let us know.
Best wishes
Martin

BIOMETRICS

WEIGHT 19.4G WING LENGTH 73MM
WING POINT P3/4 P2=6/7

228 REP. BARDSEY BIRD FLD OBS

WESTERN ORPHEAN WARBLER

Upper image shows the robust
structure and large size, the pale iris
and the dark hood that gradually
diffuses into the mantle. It also shows
the dark brown wings and back and
the buff flanks and belly, along with
the paler throat and breast feathers.

Lower image shows the bird looked
like a giant Lesser Whitethroat. The bill
can be seen well and is large and
bluish black, with quite a deeply
curved culmen and pale grey base to
the lower mandible.

Western Orphean Warbler © Lewis Hooper

63: 226-229 229

STANSFIELD

FEA’S PETREL Pterodroma feae
The 3rd record for Bardsey
Steven Stansfield

230 REP. BARDSEY BIRD FLD OBS

FEA’S PETREL

FINDING ACCOUNT

The weekend of the 17th/18th of August 2019 was very windy. Seawatching from Bardsey had been
quite productive with many thousands of Manx Shearwaters passing over the previous couple of days,
as well as a few Sooty Shearwaters and then a Great Shearwater on the morning of 19th. On the
afternoon of 19th the wind eased and it was calm enough for the visitors that had been trying to cross
to Bardsey since Saturday to actually get there; these included 12 young birders who were to be
spending the week at the Observatory on our ‘Young Birders Training Week’.

In the early hours of the 20th the wind increased and was blowing fairly strong (force 6 westerly at dawn).
I began seawatching at 0645 hrs along with George Dunbar, and was later joined by Lewis Hooper and
Alex Starce, and quite a few of the young birders including Angus Jennings and Luke Nash.

At 0825 hrs I saw a bird heading south fly into the field of view of my telescope some 1500-1800m offshore
to the north of the island. The bird was fairly distant at this point, but I was able to see that it had dark
almost blackish under-wings and a wholly white body; the white underside contrasting markedly with the
dark under-wings; it towered high before plummeting towards the sea; this left me in no doubt that the
bird was a Pteradroma petrel - I immediately knew that the bird was a Fea’s/Zino’s/Desertas type petrel.

My language exploded into a machine-gun style outburst of Tourette’s-like expletives, with the odd
‘Fea’s Petrel heading south!’ mixed in…

I began to give directions and get all the birders present onto the bird. Its high arching banks and shears
were very distinctive, making it easy for everyone to get on to. All but two people who were there
managed to see the bird (neither of those had telescopes). The bird, although moving at a fair rate
zigged and zagged, moving south, but regularly glided back in a northerly direction, in a sort of ‘two
steps forward, one step back’ manner. The bird had very shallow flaps and only flapped on 2-3
occasions, just gliding and shearing in big wild arcs.

Once everyone had managed to see the bird, I began to calm down a little and enjoy the moment and
what I was watching. There was a huge buzz in the air… The bird seemed to take an age to pass and
was lost from view some ten minutes after I first discovered it. As it made its way south along the West
Side of the island it came quite close in, coming to within 400m from the shore at its closest (800m from
our position) and then headed out further past Carreg Yr Honwy.

As soon as the bird disappeared from view, I messaged Rare Bird Alert with the news and then began to
scribble notes in my notebook, still shaking from the event!

As an avid seawatcher I spend hundreds of hours seawatching each year and having discovered one
Fea’s Petrel I always imagined that when I found another, I would remain calm and collected. I was as
wrong this time as I was the first! It took some time for me to stop shaking after the event, one of the best
adrenaline buzzes I have ever had, even better than finding the likes of Great Snipe, Yellow-rumped
Warbler, Booted Warbler, Blyth's Pipit etc! It was such a great opening morning for our Young Birders
Training Week!

DESCRIPTION

I initially picked the bird up using 30x magnification on a Swarovski ATX 95 and was then able to zoom in
to 60x and then 70x when the bird was closest, giving a good view of the shape and plumage.

63: 230-233 231

STANSFIELD

By the time the bird was lost to view to our south-west I had seen all the features needed to identify it as
a Fea’s/Desertas-type petrel’, including a pale grey upper-side, with darker wing tips (primaries) and a
dark bar along the bird’s coverts giving it a dark ‘W’ effect on its back.

FLIGHT

The bird was about 1500-1800m away initially (passing a marker that we know is 1500m from our viewing
point) and was flying in the most distinctive, yet bizarre way I have ever seen any seabird other than the
previous Fea’s I had seen. it was very distinctive; quite high shears and loops, then dropping quite
suddenly, regularly looping back on itself, switching direction. The travelling flight was more reminiscent
of a Cory's than a Manx Shearwater, with a few quick languid flaps at the bottom of the shear and then
looping high, much higher than the Manxies. The Manxies were flapping with their usual regular stiff wing
beats and fairly regular flap-flap-shear…, even though the wind was still strong. Initially, the most
distinctive thing about the bird was its flight. A few quick wing beats with its wings held sort of forward of
the head, and the ability to use the wind to climb higher than any of the other seabirds nearby was quite
amazing, it did this almost without flapping sometimes and moved quite some distance without flapping
at all on occasions.

JIZZ, SIZE AND SHAPE

The bird was similar in size to a Manx Shearwater but had a very slightly bulkier and longer appearance
in the body and looked longer, more slender and pointier-winged than Manxies. The wings were held
forward when shearing, and also slightly bowed a bit like a Cory's Shearwater sometimes does. The tail
looked quite long and was clearly attenuated and pointed compared to the short stubbiness of a
Manxie or almost square ended of a Fulmar. The wings had the arm and hand appearing the same sort
of length, but this feature was difficult to judge. When shearing or flapping the wings were rakishly long
looking and regularly held forward in the arm to the carpel and then quite swept back in the hand, so
the primary tips were in line with the armpits. This gave the bird a quite distinctive shape, especially when
gliding and swooping back on itself.

UPPERPARTS

Head - the bird’s head was grey, with a dark mask behind the eye and white in front and above the bill.
The upper-side was steely-grey along the back, with a contrasting darker smudged-looking dark-grey
elongated and inverted ‘W’ mark along the upper wings (along the coverts) and across the bottom of
the back. The hand of the wing - the primaries, were all dark. The secondaries were paler than the coverts
and the primaries. They were similar in tone, but maybe a touch darker, than the colour of the forewing.
The upper-side of the tail was noticeably paler grey than the back.

UNDER-PARTS

The underside of the body was clean pure white from the bird’s chin to the end of the tail, with a narrow
smudge on the sides of the neck. The under-wings were all dark and sooty (almost black looking), with a
triangular pale area at the base of the leading edge of the underwing. The dark looking under-wings
contrasted markedly with the glistening white body.

BARE PARTS

The bird’s bill was shorter and stubbier than a Manx Shearwater and could be seen well when the bird
was closest. Legs and feet were not seen.

Fea’s Petrel and Manx Shearwater sketches © Steven Stansfield

232 REP. BARDSEY BIRD FLD OBS

Dark under-wings with white triangular FEA’S PETREL
wedges at the base of forewing along the
marginal under-wing coverts Wings long and slim and sharply
pointed (never looking blunt or
Dark blackish smudge behind eye rounded) and very contrasting black
with greyish white forehead under-wings with white body.
Quite flat faced big
chunky headed Quite a chunky looking body, more
appearance thick-set than Manx Shearwater
Underparts clean white
Grey neck sides
Long attenuated rear end with
Primaries and primary coverts Black pointed tail
looking, giving the whole wing tip a dark
appearance Arm and hand length very similar – 50/50
split

Flight quite erratic and more jumpy than
the steady shearing of nearby Manx
Shearwaters

Larger headed looking than Manx Steely-grey looking
Shearwater with dark mask on mantle and back
grey head contrasting with white
forehead Upper-tail very pale
looking, paler than
Short and chunky all black mantle making the
bill held pointing diagonally rear end look long
downwards
Long tapering tail with
Upper-wings greyish with pointed tip, contrastingly
pale secondaries and paler than rest of upper-
greater coverts side

Upper ‘arm’ pale with a Wings held forward
dark diagonal bar running and bowed down
along the wing from the
carpel to the tertials Similar Size to Manx Shearwater
contrasted with the wholly
dark primaries and ‘hand’ 233
part of the wing forming a
distinctive dark W on the
upper-side

63: 230-233

STANSFIELD

Isabelline Wheatear Oenanthe isabellina
The 3rd record for Bardsey
Martin Hosier and Steven Stansfield

234 REP. BARDSEY BIRD FLD OBS

ISABELLINE WHEATEAR

FINDING ACCOUNT (Martin Hosier)

I was visiting Bardsey Bird Observatory with a group of friends, from 7 to 14 September 2019. On the
morning of the 10th my wife Heather and I had chosen to walk the southern end of the island. We had
walked past the southern tip and were heading back towards the Narrows along the eastern shore. As
we crested a small valley, we flushed a wheatear from around 20 meters in front of us. The bird flew
directly away from us and landed around 120 meters away on a grassy slope. As soon as the bird flew I
knew it was not a Northern Wheatear Oenanthe Oenanthe, as I was immediately struck by both its pale
plumage and large size. Viewing the bird through my scope confirmed my suspicions that this was a
large, upright, very pale wheatear. My next priority was to try to get some pictures to help with the
identification. Over the course of the next ten minutes I managed to get some shots of the bird, both on
the ground and in flight, as well as views from every angle. At this point I decided to let the bird settle at
the southern tip of the island to feed. I watched the bird from a distance while I sent my long-suffering
wife off to the observatory to alert the observatory staff and any other birders that she could find. I made
some notes while waiting for reinforcements.

I waited as the birders converged on the spot from all over the island only to be frustrated when a
Sparrowhawk flew across the southern tip of the island and flushed all of the birds just as reinforcements
arrived. Despite searching the area extensively, we could not find the bird, so returned to the observatory
to check the field guides. We quickly confirmed my suspicions that it was indeed a first-winter Isabelline
Wheatear.

By now, it was accepted by everyone that we were searching for an Isabelline Wheatear. A search party
was sent looking for the wheatear. Lewis Hooper wandered around the southern end of the island and
eventually re-discovered it on the Narrows, where it remained for the next six days.

On the 14th, the bird was trapped and ringed by Steve Stansfield.

DESCRIPTION (Martin Hosier & Steven Stansfield)

SHAPE. SIZE, JIZZ AND BEHAVIOUR

A large pale wheatear, larger and chunkier than nearby Greenland Wheatears Oenanthe Oenanthe
leucorhoa, with a very upright stance. Often perched on exposed rocks for long periods. Typical
wheatear feeding action with fast bounding hops after prey and occasional fly-catching from low
perches on ground. Sat very erect most of the time with frequent habitual tail pumping. Wing length
equal to or just beyond the base of the tail.

HEAD AND FACE

Head rounded with a rather plain face, pale supercilium, dark lores, slightly warmer tinge to the ear
coverts.

UPPERPARTS AND WINGS

Back greyer with little contrast in the lesser or median coverts. A black alula was noted and showed well
on some pictures. Greater coverts same colour as back. Secondaries mid-grey/brown with pale fringing.
Primaries, dark, almost black, with black subterminal band and very fine white tips. In flight the underwing
was silvery grey.

63: 238-241 235

STANSFIELD

TAIL

Rump and base of tail white with a thick black terminal bar on the tail, at least two thirds of the tail was
black, showing only the very slightest hint of a “T” in flight.

UNDERPARTS

Upper breast pale sandy slightly warmer toned towards the shoulders, fading to an off-white belly.

BARE PARTS

The wheatear had long black legs, with long pale feathered thighs. Its bill was all dark, and quite strong
looking

CALL.

No call was heard at any point during our observations.

DNA SEQUENCING

During the processing of the bird on 14th, two flank feathers were shed, these were collected and sent
to Professor Martin Collinson at Aberdeen University, where he and his team confirmed the bird’s identity
from its Mt DNA sequence.

Primary coverts had dark Secondaries mid- Very plain and uniform
centres and very pale grey/brown with mantle with slightly
fringing pale buff fringing warmer lower back
and silvery tips
Very plain and
uniform mantle with
slightly warmer lower
back

Black alula

Rump white

Tail white with a thick black Primaries dark, almost
terminal bar; at least half to two- black, with black
thirds of tail was black, showing subterminal band and
only the very slightest hint of a “T” very fine white tips
in flight

236 Isabelline Wheatear © Steven Stansfield

REP. BARDSEY BIRD FLD OBS

ISABELLINE WHEATEAR

Forehead and centre of crown slightly Crown, nape and mantle
darker greyer with little contrast
between scapulars and the
Upper breast pale fringes of lesser or median
sandy slightly warmer coverts
toned towards the
shoulders, fading to an Greater coverts dark
off-white belly. centered with fringes
same colour as lower
Upright stance, back
like Greenland
Wheatear. Very Secondaries mid-
full chested with
heavy sternum grey/brown fringed

Off-white belly and tipped pale

Black legs with long feathered tibia with darker

primaries

Wing length equal
to or just beyond
the base of the tail

Pale vent.

63: 238-241 237

STANSFIELD

Buff-bellied Pipit Anthus rubescens
A new species for Bardsey and Wales
Samuel Prettyman and Steven Stansfield

238 REP. BARDSEY BIRD FLD OBS

BUFF-BELLIED PIPIT

FINDING ACCOUNT (Sam Prettyman)

Just after lunch on 29 September, Lewis Hooper and I decided to go birding together, little did I know,
that I would be very glad of this decision in the coming hours.

We walked up to Nant and checked the Plantation, quietly hoping a Barred Warbler or some such thing
would hop out. However, it was blowing a gale and after 20 or 30 minutes we came to the conclusion
that there wasn't much there, so we headed down to the coast. We walked along the North End, Lewis
was sticking a bit further inland than me. We saw a Golden Plover, so we were fairly happy with that
small something. Lewis then got onto some Kittiwakes on the West Coast, circling erratically 100m or so
out to sea, but one of them was just a bit further away and acting a bit more erratically than the others,
almost looking like a Sabine's Gull. It was frustrating, the wind made it hard to stay fixed on the bird and
the light kept catching its back in a way that made it look distinctly dark. It then flew upwards, turned its
back towards us, perfectly displaying just how much of a Kittiwake it actually was!

After that disappointment (not to knock Kittiwakes too much), Lewis said he would go further inland
again. He disappeared, and I wandered along the coast. I took a look inside each ogof as I came to it,
the first had nothing, the second, though, had a pipit at the bottom, right next to the sea. Even from 30
metres away without binoculars, it was different looking. The borders to the tertials and greater coverts
were so much paler than the Rock Pipit I was expecting to see. I watched the bird for 30 seconds and
by the time it hopped out of sight I had successfully forgotten what on earth a Rock Pipit/Water
Pipit/Meadow Pipit/every kind of pipit looked like, and I was just about losing my mind!

Lewis must have seen me scratching my head and crying into my binoculars from across the field
because he had started to walk over to me. When he arrived, I asked him what he thought of this pipit;
he looked with his bare eyes and said "Probably just a 'rockit', isn't it?" (paraphrasing slightly). I said "Yeah,
but it's weird...", he took a quick photo of it from across the ogof and zoomed in, then he looked up at
me, back to his camera screen, then back at me and exclaimed "Mate, what is going on, you’re making
me forget everything I know!". I was happy to hear this because now he was in my world! It flew back at
us and he got a picture of its face, thank goodness! It was NOT a Rock Pipit and NOT a Water Pipit, no
way on earth, I simply refused to believe it!

After a couple more minutes he asked; "Are we both thinking the same thing? What are you thinking it
is?"; I said " a B...", he nodded along, and I finished "… a Buff-bellied Pipit". He was happy about this and
we spent about ten- or 15-minutes thinking of reasons why it wasn't a Buff-bellied Pipit Anthus rubescens.
Lewis had the Collins Bird Guide app on his phone, and everything was adding up! Dark legs that have
a dark red tint when viewed closely, less streaked mantle and crown, pale lores, buff underparts etc...
This was getting exciting!

I radioed Steve Stansfield; "Steve Obs, Steve Obs, this is Sam", "Go ahead Sam", "Hi, I'm down on the West
Coast opposite Carreg with Lewis and we've got a really dodgy looking pipit; I don't want to get too
excited but it looks pretty good for Buff-bellied..!". The next thing I heard was Steve radioing George
Dunbar saying "George, grab my 'scope!!"

They arrived ten minutes later, Lewis showed Steve his photos, and he was pretty happy with them. We
all saw the bird again, me, Lewis, Steve, George and Kevin Clements. Steve then said the very satisfying
words: "That's a first for Wales! ". What a brilliant moment, the second 'rare moment' I've shared with Lewis,
and although not as 'mega' or as good looking as the Western Orphean Warbler in May, this felt much
better than 'finding' the bird in a net!

The bird remained faithful to the small area where we first found it at Ogof Trwyn ŷr Hwch Bach and was
present until dusk. The following morning the bird was seen a little further north along the coast by William
Earp, however, it was not seen subsequently.

63: 238-241 239

PRETTYMAN & STANSFIELD

DESCRIPTION & PHOTOGRAPHS (Steve Stansfield)

GENERAL APPEARANCE

Superficially like a Rock Pipit Anthus petrosus, but with very bold white outer tail feathers and a small
amount of white on T5.

HEAD AND FACE

The bird had big pale lores giving it a very soft open-faced look, and obvious white eye ring. There was
a short pale tapering supercilium behind the eye, but not as marked as in Meadow Pipit Anthus pratensis
or Water Pipit Anthus spinoletta and extended just to the rear of the ear coverts but not beyond. The
malar and the olive brown ear coverts (and slightly darker sub-moustachial stripe) bordered a very pale
and obvious moustachial stripe, which curled round under and just behind the ear coverts.

UPPERPARTS

The bird had a very plain back and mantle and was not streaked like a Meadow Pipit, or even as marked
as a nominate petrosus Rock Pipit.

WINGS

The bird had two broad buff wing bars, the median coverts were dark centred and tipped evenly pale
off white. The greater coverts were dark centred with a slightly paler olive fringe on the outer webs and
tipped narrower on the outer feathers with a warmer buff colour, becoming broader and paler towards
the inner feathers.

The most obvious feature of the tail was the gleaming white outer tail feathers, with a small amount of
white on the tip of the second outermost feather (T5). The rest of the tail was dark brownish-olive with no
real fringing or pale tips.

UNDERPARTS

The bird was generally buff below with narrow and distinct dark streaks on the breast and flanks. There
was a dark malar which became quite an obvious triangular mark on the throat sides before becoming
admixed with the streaking on the bird’s breast.

BARE PARTS

The bird had quite dark legs, with just a hint of pinkish to them, a dark fine bill, with a very obvious pale
orange base.

CALL.

Very unlike Rock Pipit or Water Pipit, a somewhat softer ‘tseepp’ or ‘tsipp’, more Meadow Pipit-like, but
more a bit more forceful.

240 REP. BARDSEY BIRD FLD OBS

BUFF-BELLIED PIPIT

Superficially similar to Rock Small supercilium Very ‘open’
Pipit in shape and size, with behind the eye looking face
finer bill

Dark clear streaks on
Underside along flanks to vent

Buff underparts and belly Pale fringes
to tertials
Orangey base to Poorly marked Crown Pale lores
otherwise dark bill Plain mantle Gleaming white
outer tail feathers

White eye-ring

Dark legs Very plain looking mantle lacking
Very ‘open’ looking face any real streaking like Meadow Pipit

Broad pale off
white/buff wing-bars

63: 238-241 241

GALLERY

GALLERY
Images from 2019

Peregrine REP. BARDSEY BIRD FLD OBS

© Jeff Wragg

242