Clinical Applications of PCR - Y. M. Dennis Lo

9 Utilization of Multiple Real-Time PCR Assays for the Diagnosis of Bordetella… 143

Table 3
Lower limit of detection of the PCR assay
dual-target on AB7500

B. pertussis

Genomic equivalent a IS481 ptxS1
Ctb values Ct values
5,000 18.4 28.7
500 22.0 31.3
50 25.7 34.9
10 27.0 35.8
5 29.2 36.7
1 31.2 39.2
0.1 35.8 Negative
aB. pertussis isolate A639
bCt = cycle threshold

clinical specimens and human genomic DNA positive controls
should be positive for rnaseP. For the rnaseP assay, negative or
high Ct positive rnaseP in undiluted DNA extracts indicates that
the specimen extraction contains inhibitors to the PCR assay, a low
DNA yield from the DNA extraction process occurred, or the
specimen was not collected correctly. To determine if inhibitors are
present, check the DNA extracts at 1:5 dilution. If the rnaseP
results improve with the diluted extracts, the IS481 and ptxS1
assays must be repeated using the diluted extracts. If the rnaseP
results do not improve, this may indicate that the NP aspirate or
swab was not collected or stored correctly.

DNA extracted from a B. pertussis strain at low DNA concen-
tration should be included as a positive control for the IS481 and
ptxS1 assays (Note 11). The different Ct values obtained for each
genomic equivalent of DNA with IS481 and ptxS1 demonstrate
the multi-copy nature of IS481 (Table 3).

6. Interpretation/results according to algorithm (Table 4) (Note
12): When the above controls are met, any clinical specimen that is
positive for two of the three replicates (two reactions with undi-
luted DNA extract and one reaction with DNA diluted 1:5) in
both the IS481 and ptxS1 assays is considered positive for the pres-
ence of B. pertussis; any specimen that is positive in only one of the
replicates should be repeated. If the repeat results are positive in at
least one of the three replicates for ptxS1, the test is considered
positive. If a specimen is negative in the IS481 assay and positive in

144 K.M. Tatti and M.L. Tondella

Table 4
PCR algorithm for different species

IS481 PCR result ptxS1 PCR resulta Interpretation

Ct < 35 cycles Positive Bordetella pertussis
Ct ³ 35 cycles Positive
Ct ³ 35 cycles Negative Bordetella pertussis

Indeterminate—Requires confirmation by other means
(culture, serology, or epi linkage)

Ct < 35 cycles Negative Bordetella spp.—Possibly B. holmesii or B. bronchisepticab
Negative Positive Bordetella spp.—Possibly B. parapertussis or B. bronchisepticab

aCt < 40 cycles is considered a positive result
bB. bronchiseptica is an animal pathogen, rarely found in humans. B. bronchiseptica cannot be differentiated from other

Bordetella species by this algorithm

the ptxS1 assay the combined result is considered positive for
Bordetella spp., possibly B. parapertussis (Table 4).

Any specimen positive in the IS481 assay before cycle 35 in at
least two of the three replicates and negative in the ptxS1 assay is
suggestive of the presence of Bordetella spp., possibly B. holmesii
(Table 4). Confirmation with a specific PCR target for the presence
of B. holmesii is suggested.

In outbreak settings, when many specimens are handled in a
short period of time, low levels of B. pertussis DNA detected by
high Ct IS481 positive and ptxS1 negative may be due to DNA
contamination during specimen collection, DNA extraction, or
PCR setup. In this case the PCR results should be interpreted as
indeterminate if not confirmed by another laboratory test such as
culture, serology, or immunohistochemistry for FFPET (6).
Epidemiological and clinical relevance of high Ct IS481 positive
PCR tests should be taken into consideration. It is also important
to keep a record of the Ct values of all reactions in a database in
order to facilitate result interpretation (Note 13).

PCR tests are repeated for extracts where the Ct values for the
two undiluted extract reactions are not similar or when only the
diluted extract reaction has a Ct value. If only one duplicate of a
DNA extract has a Ct value after repeated PCR, the result for this
specimen is considered negative. If only the diluted extract has a Ct
value after repeated PCR, the specimen is noted as having an inhib-
itor present. If inhibition of the rnaseP assay is noted for a clinical
specimen, extracted DNA should be tested at two or more dilu-
tions (e.g., 1:5 and 1:10) to verify the result. Results from the
diluted extract reaction are interpreted according to Table 4.

7. Limitations: If inhibitors are present in a DNA extraction,
PCR assays may produce a false negative result.

9 Utilization of Multiple Real-Time PCR Assays for the Diagnosis of Bordetella… 145

Data suggest that clinical specimens collected subsequent to
initiation of antimicrobial treatment may not be positive for
Bordetella spp. due to reduction in the number of organisms.
Whenever possible, specimens collected prior to administration of
antimicrobial agents should be used to determine infection with
Bordetella spp.

4. Notes

1. DNA extraction using silica-based membrane can be performed
with several commercial kits. Here we described the method
using the Qiagen column kit.

2. DNA extraction using MGPs can be performed with several
commercial kits. Here we described the method using the
Roche MagNA Pure LC Total Nucleic Acid Isolation Kit;
however, the MagNA Pure LC DNA Isolation Kit III (Bacterial,
Fungi) and Compact Roche kit for bacterial extraction on the
Compact MagNA Pure work as well as the MagNA Pure LC
Total Nucleic Acid kit for extraction of DNA from Bordetella
spp. The MagNA Pure LC DNA Isolation Kit III (Bacteria,
Fungi) uses 100 ml of specimen with external lysis by protei-
nase K (15–20 mg/ml) and heating for 10 min at 65°C.

3. Specimen collection for pertussis diagnostic testing must be
performed in a separate room far from where pertussis vaccines
are administered (13, 14).

4. The preferred specimen type is an NP aspirate, if it is obtained
correctly, because the overall yield and recovery of organisms
are optimized.

5. Calcium alginate- or cotton-tipped swabs are not acceptable
for specimen collection due to possible inhibition of the PCR
reaction.

6. Throat and anterior nasal swabs have unacceptably low rates of
recovery.

7. Because of the sensitivity of R-PCR, special precautions should
be taken to prevent contamination during DNA extraction.
The following steps are recommended:
Maintain a biological safety cabinet (BSC) and lab dedi-
cated to working with clinical specimens only, not bacterial
isolates.
Maintain separate equipment (pipettes, microcentrifuges,
etc.) and supplies for DNA extraction from clinical specimens.
Extract NP aspirates in batches of no more than 28 aspi-
rates or swabs at one time.

146 K.M. Tatti and M.L. Tondella

Extract sterile water (blank) after every seventh specimen
to ensure that there is no cross-contamination during DNA
extraction.

Change gloves frequently.
Decontaminate BSC, lab bench, centrifuge rotor and lid,
pipettes, scissors, forceps, and tube rack with 10% bleach (pre-
pared weekly), 70% ethanol which inactivates the bleach, DNA
AWAY, and UV light after each DNA extraction batch.
Do not extract isolates when you extract clinical specimens.
If you have used the instrument for extraction of isolates,
decontaminate and perform a run with water only.
Multiple centrifugation steps and extensive hands-on
manipulations during extraction processes can lead to contam-
ination of specimens and equipment; try to minimize these
steps.
Do not extract positive controls with clinical specimens to
reduce the risk of contamination.

8. Maintain separate rooms for PCR and culture. PCR should
never be performed in a room where bacterial cultivation
occurs.

9. Because of the sensitivity of R-PCR, special precautions should
be taken to prevent false positive amplifications. The following
steps are recommended:
Maintain separate rooms for master mix setup and DNA
addition.
Do not bring DNA into the master mix setup room, and
maintain separate equipment (using aerosol barrier pipettes,
microcentrifuges, etc.) and supplies for assay setup and DNA
addition.
Wear a clean lab coat and gloves when setting up assay.
Change gloves frequently.
PCR workstations or BSC should be treated with UV light
for at least 1 h prior to setting up assay.
After setting up assays in the rooms, clean equipment and
bench or cabinet with 10% bleach, 70% ethanol, DNA AWAY,
and UV light.

10. Physically separating the addition of the positive control DNA
from the addition of specimen DNA is an additional step to
prevent contamination. A separate pipette should be main-
tained for use with positive control DNA.

11. Positive control should contain an average Ct value (Ct 25–30)
and a lower limit control (Ct ³ 35), never high concentrations
of DNA with low Ct values.

12. This algorithm is used for laboratory diagnosis in public health
settings during pertussis outbreaks where specificity is needed.
The clinical decisions regarding treatment for pertussis are

9 Utilization of Multiple Real-Time PCR Assays for the Diagnosis of Bordetella… 147

driven not only by the PCR results but also by the clinical and
epidemiological data.

13. Care should be taken when using this algorithm to interpret
high Ct value (35 cycles or greater) IS481 positive/ptxS1 nega-
tive clinical specimens. Since IS481 is present in many copies
and ptxS1 is only present in one copy, a clinical specimen that
is high Ct IS481 positive and ptxS1 negative may indicate the
presence of low levels of B. pertussis due to infection or false
positive due to the multi-copy nature of IS481. Pseudo out-
breaks of pertussis have been described due to the high Ct val-
ues of IS481 from contamination (4).

References

1. Mattoo S, Cherry JD (2005) Molecular patho- 8. Roche Applied Science (2008) MagNA Pure
genesis, epidemiology, and clinical manifesta- LC Total Nucleic Acid Isolation Kit Handbook.
tions of respiratory infections due to Bordetella Roche Applied Science, Mannheim
pertussis and other Bordetella subspecies. Clin
Microbiol Rev 18:326–382 9. Espy MJ, Uhl JR, Sloan LM et al (2006) Real-
time PCR in clinical microbiology: applications
2. Goebel EM, Zhang X, Harvill ET (2009) for routine laboratory testing. Clin Microbiol
Bordetella pertussis infection or vaccination Rev 19:165–256
substantially protects mice against B. bron-
chiseptica infection. PLoS One 4:e6778 10. Prophet EB, Mills B, Arrington JB, Sobin LH
(1992) Laboratory methods in histotechnol-
3. Tatti K, Wu K, Tondella L et al (2008) ogy. American Registry of Pathology,
Development and evaluation of dual-target Washington, DC
real-time polymerase chain reaction assays to
detect Bordetella species. Diagn Microbiol 11. Dundas N, Leos NK, Mitui M et al (2008)
Infect Dis 61:264–272 Comparison of automated nucleic acid extrac-
tion methods with manual extraction. J Mol
4. CDC (2007) Outbreaks of respiratory illness Diagn 10:311–316
mistakenly attributed to pertussis—New
Hampshire, Massachusetts, and Tennessee, 12. Riffelman M, Schmetz J, Bock S et al (2007)
2004–2006. MMWR 56:837–842 Preparation of Bordetella pertussis DNA from
respiratory samples for real-time PCR by com-
5. Tatti KM, Wu KH, Sanden GN et al (2006) mercial kits. Eur J Clin Microbiol Infect Dis
Molecular diagnosis of Bordetella pertussis 27:145–148
infection by evaluation of formalin-fixed tissue
specimens. J Clin Microbiol 44:1074–1076 13. Taranger J, Trollfors B, Lind L et al (1994)
Environmental contamination leading to false-
6. Paddock CD, Sanden GN, Cherry JD et al positive polymerase chain reaction for pertus-
(2008) Pathology and pathogenesis of fatal sis. Pediatr Infect Dis J 13:936–937
Bordetella pertussis infection in infants. Clin
Infect Dis 47:28–38 14. Tatti KM, Slade B, Patel M et al (2008) Real-
time polymerase chain reaction detection of
7. Qiagen (2007) QIAamp®DNA Mini and Blood Bordetella pertussis DNA in acellular pertussis
Mini Handbook. Qiagen, Valencia, CA vaccines. Pediatr Infect Dis J 27:73–74

Chapter 10

Detection of Mycoplasma pneumoniae by Real-Time PCR

Jonas M. Winchell and Stephanie L. Mitchell

Abstract

Mycoplasma pneumoniae is a significant cause of respiratory disease, accounting for approximately 20% of
cases of community-acquired pneumonia. Although several diagnostic methods exist to detect M. pneumo-
niae in respiratory specimens, real-time PCR has emerged as a significant improvement for the rapid diag-
nosis of this pathogen. The method described herein details the procedure for the detection of M.
pneumoniae by real-time PCR (qPCR). The qPCR assay described can be performed with three targets
specific for M. pneumoniae (Mp181, Mp3, and Mp7) and one marker for the detection of the RNaseP
gene found in human nucleic acid as an internal control reaction. Recent studies have demonstrated the
ability of this procedure to reliably identify this agent and facilitate the timely recognition of an outbreak.

Key words: Mycoplasma pneumoniae, Community-acquired pneumonia, Real-time PCR, qPCR

1. Introduction

Mycoplasma pneumoniae is a significant cause of community-
acquired pneumonia (CAP) in both children and adults. Outbreaks
of M. pneumoniae most often occur in closed settings such as
schools, prisons, and hospitals (1–4). Although many infections
result in mild, asymptomatic, and often self-limiting cases, up to
25% of those infected with M. pneumoniae may experience extra-
pulmonary complication and/or require hospitalization due to
severe pneumonia. A comprehensive overview of M. pneumoniae
and its pathogenicity is provided elsewhere (5–7). A reliable and
rapid detection method is needed for an effective public health
response due to the high prevalence and significance of this
pathogen.

Historically, M. pneumoniae infection has been difficult to
diagnose, primarily because of the lack of available standardized

Mark Wilks (ed.), PCR Detection of Microbial Pathogens: Second Edition, Methods in Molecular Biology, vol. 943,
DOI 10.1007/978-1-60327-353-4_10, © Springer Science+Business Media, LLC 2013

149

150 J.M. Winchell and S.L. Mitchell

and specific diagnostic tests. Culture, complement fixation, and
serological tests have been used to identify M. pneumoniae infec-
tions, but each has substantial drawbacks and limitations. These
methods are labor intensive and have questionable sensitivity and
specificity. Serologic tests require paired serum specimens to distin-
guish between active and previous infections and do not provide
timely results. Similarly, isolation of M. pneumoniae is slow and
requires specialized expertise.

The use of real-time polymerase chain reaction (qPCR) greatly
improved the diagnostic capabilities for this agent. This technique
provides greater sensitivity, specificity, and speed to that of tradi-
tional tests. In the past several years, studies have reported the
development of real-time PCR assays for the detection of M. pneu-
moniae (8–10). Recently, it has been shown that real-time PCR
may be more useful during the early stages of infection, probably
due to the presence of a higher pathogen burden and specimen
collection occurring prior to the patient receiving antibiotic treat-
ment (11). Therefore, specimen collection and testing should be
performed as early as possible (see Note 7). Due to the overall
enhanced sensitivity, ease of use, and widespread availability, real-
time PCR is becoming the primary means of detecting M. pneumoniae
infections.

As with any nucleic acid amplification procedure, optimal
laboratory setup, practices, and proper technique are paramount.
Maintaining separate and dedicated procedural rooms, equip-
ment, and consumables is essential for decreasing contamination.
A “clean room” should house primer/probe dilutions, enzyme
reagents, all the necessary consumables, and dedicated equipment
to properly set up a PCR reaction plate. A template or “dirty”
room should only be used for the addition of nucleic acid and
centrifugation of capped plates prior to transfer into the PCR
instrument room. Nucleic acid isolation and any post-PCR analy-
sis that may occur, such as gels or other amplicon analysis, should
be conducted in a separate “Nucleic Acid Isolation” and “Post-
PCR Analysis” rooms, respectively. These practices provide a safe-
guard to prevent contamination of the laboratory and should be
strictly adhered to.

The currently described assay uses hydrolysis-based probes
(Taqman) and primers that are specific for M. pneumoniae. Two
markers (Mp3 and Mp7) target the ATPase gene, whilst the third,
Mp181, targets the newly described CARDS toxin gene (12).
These markers have been previously evaluated and are reported
elsewhere (8). The widely used RNaseP (RP) target is included as
an internal control to ensure template quality and proper PCR
setup and execution. By using all four markers on a 96-well plat-
form, 22 specimens can be tested along with a no-template control
(NTC) and a positive control (PC). If higher throughput is required
for an initial screening of specimens, the Mp181 and RP can be

10 Detection of Mycoplasma pneumoniae by Real-Time PCR 151

used to screen specimens followed by retesting any positive samples
with the full panel. Mp181 is recommended as the primary marker
for screening due to its slightly enhanced sensitivity. This proce-
dure should enhance the detection rates for this agent and provide
a convenient method to rapidly test patients suspected of having an
M. pneumoniae infection.

2. Materials 1. TaqMan (TM) primers/probes (Table 1).
Primers should optimally be synthesized as “sequencing
2.1. Reagents
grade” (see Note 1). Working dilutions of each primer are sug-
gested to be at 50 mM (diluted in nuclease-free molecular-
grade water).

Probes should be made with a 5¢ FAM label and a 3¢ black
hole quencher 1 (BHQ1). Working dilution for the probe is
recommended at 10 mM (diluted in nuclease-free molecular-
grade water). The probe should be protected from light.

Working dilutions of primers and probes should be kept at
4°C. For long-term storage, aliquots may be frozen at −20°C
(see Note 2).

2. Platinum Quantitative PCR SuperMix-UDG and 50 mM
MgCl2 (Invitrogen). Store at −20°C (non-frost-free freezer).

Table 1
M. pneumoniae real-time PCR primer/probe sequences

Primer/probe Sequence 5¢ → 3¢ Target

Mp181-F tttggtagctggttacgggaat CARDS Tx
Mp181-R ggtcggcacgaatttcatataag
Mp181-P tgtaccagagcaccccagaagggct

Mp3-F cgatctatgtgccagctgatga ATPase
Mp3-R agcatccaggtgggtaaaggt
Mp3-P ttgactgaccccgctccggc

Mp7-F actaacaattaccgtgcttacaatgaa ATPase
Mp7-R ccacacctttgtcttggatcac
Mp7-P actctt(t)gccaaccaacaaaacgagtcct

RP-F agatttggacctgcgagcg RNaseP
RP-R gagcggctgtctccacaagt
RP-P ttctgacctgaaggctctgcgcg

Probes are labeled with 5¢ FAM and 3¢ black hole quencher (BHQ) 1. Mp7-P
is internally quenched with BHQ1, represented by “(t).” “CARDS Tx” refers
to community-acquired respiratory distress syndrome toxin. RNaseP (RP) is
used as an internal positive control for the detection of human nucleic acid

152 J.M. Winchell and S.L. Mitchell

3. Platinum Taq DNA Polymerase (5 U/ml) (Invitrogen). Store
at −20°C (non-frost-free freezer).

4. 10 mM PCR Nucleotide Mix (Promega). Store at −20°C
(non-frost-free freezer).

5. Nuclease-free water. Store at room temperature. Separate water
bottles are recommended for master mix use and dilution of
primer/probe working stocks.

2.2. Consumables 1. MicroAmp Optical 96-well reaction plates and MicroAmp
Optical 8-cap strips (Applied Biosystems).

2. Nuclease-free 1.5 mL Eppendorf tubes.

3. Aerosol barrier pipette tips.

4. Pipettes: P20, P100, P200, P1000.

5. Disposable gowns and gloves.

6. RNase Away (Molecular BioProducts, cat # 7005) or freshly
prepared 10% bleach.

2.3. Instruments 1. ABI 7500 (Standard or FAST real-time PCR thermocycler by
Applied Biosytems) or a comparable instrument (i.e., Stratagene
Mx 3000/3005, Rotorgene 6000, iCycler, etc.).

3. Methods The steps outlined below describe the setup, execution, and analy-
sis of the M. pneumoniae real-time PCR assay.
3.1. “Clean” Room
Procedures 1. The PCR master mix should be prepared in a designated “clean
room,” as far away as possible from any areas that may generate
potential nucleic acid contamination. Disposable gown and
gloves should be donned and all surfaces and shafts of each
pipette should be thoroughly wiped clean with RNase Away or
an equivalent decontaminant (i.e., 10% freshly prepared bleach)
after applying with a disposable wipe. The master mix should
be used immediately after preparation and not be stored any
longer than 1 h at 4°C after being formulated. Longer storage
after formulation may result in inferior performance, including
false positives/negatives.

2. The master mix(es) contains the following reagents per reaction:
12.5 ml of Platinum® Quantitative PCR SuperMix-UDG.
1.5 ml of 50 mM MgCl2.
0.5 mM final concentrations of each primer (0.25 ml per

reaction when a 50 mM stock is used).
0.1 mM final concentration of the probe (0.25 ml per reac-

tion when a 10 mM stock is used).

10 Detection of Mycoplasma pneumoniae by Real-Time PCR 153

1 2 3 4 5 6 7 8 9 10 11 12
Mp181 A NTC S2 S4 S6 S8 S10 S12 S14 S16 S18 S20 S22
Mp3 B NTC S2 S4 S6 S8 S10 S12 S14 S16 S18 S20 S22
Mp7 C NTC S2 S4 S6 S8 S10 S12 S14 S16 S18 S20 S22

RP D NTC S2 S4 S6 S8 S10 S12 S14 S16 S18 S20 S22
Mp181 E S1 S3 S5 S7 S9 S11 S13 S15 S17 S19 S21 PC
Mp3 F S1 S3 S5 S7 S9 S11 S13 S15 S17 S19 S21 PC
Mp7 G S1 S3 S5 S7 S9 S11 S13 S15 S17 S19 S21 PC

RP H S1 S3 S5 S7 S9 S11 S13 S15 S17 S19 S21 PC

Fig. 1. Plate setup. For a 96-well plate, individual primer/probe master mixes are added in rows (A–H). For use of all mark-
ers, Mp181 (rows A and E), Mp3 (rows B and F), Mp7 (rows C and G), and RP (rows D and H) are shown. Specimens (S1–
S22) are added in columns. The NTCs (A1–D1) are added first, followed by each specimen, and finally, the Positive Control
(PC, wells E9–H12).

3.2. Template Room 1.25 U Platinum® Taq DNA Polymerase.
Procedures 1 mL of 10 mM PCR Nucleotide Mix.
Nuclease-free, molecular-grade water to 20 ml final
volume.
The total volume of the PCR reaction mixture + 5 ml of
extracted nucleic acid will equal 25 ml.

3. Plate setup and dispensing of master mix are critical to mini-
mize contamination potential. For best results, master mix(es)
should be added in rows, while specimens are added in col-
umns (Fig. 1).

4. Prior to dispensing into the plate, the master mix(es) should be
mixed by gently pipetting the mix 5–10 times. Dispense 20 ml
of the master mix into the corresponding wells of a MicroAmp
Optical 96-well reaction plate.

5. Add 5 ml of nuclease-free water to wells that will be used as
“NTC”; cap all NTC wells in the clean room before moving to
the template room (see Note 3).

1. Transport the plate to a designated template (“dirty”) room
(see Note 4).

2. Extracted nucleic acid should be maintained on ice or cold
block throughout this procedure and added to the plate within
a dedicated BSC or contained setup/isolation cabinet (see
Note 5).

3. Add 5 ml of extracted nucleic acid from specimens for a final
volume of 25 ml per well. Gloves should be changed if con-
taminated with specimen or defective (see Note 6).

154 J.M. Winchell and S.L. Mitchell

4. A strip of four caps should be placed on each column of wells
after the specimen has been added before proceeding to the
next group of wells.

5. After all specimens have been added and capped, a positive
control of M. pneumoniae with a Ct value between 25 and 30
should be added and capped.

6. The plate should be centrifuged for 1 min at ~500–750 × g to
ensure that all reagents and template are at the bottom of each
well.

7. Prior to leaving the “template” room, all caps should be exam-
ined to ensure that they are flushed with the plate (no uneven
caps). Some manufacturers provide a “capping” tool to assist.
Carefully examine the wells to ensure that no large air bubbles
exist. If so, repeat the centrifugation in step 6.

8. Gowns and gloves should be disposed of before exiting the
“template” room and eventually autoclaved. Gowns should
not be reused.

9. Transport the prepared PCR plate to the designated PCR
instrument room.

3.3. PCR Instrument 1. The ABI 7500 (or an equivalent instrument) should be pro-
Room Procedures grammed using the following cycling conditions and be run in
“standard” mode with the 25 ml reaction volume condition:
95 ºC 2 min, followed by 45 cycles of 95 ºC 10 s and
60 ºC 30 s (data acquisition for FAM)

2. The passive reference dye (if using the ABI 7500) should be
set to “none.”

3. For the ABI 7500 instrument, when the run has completed
(~1.5 h), select “Analyze” to set a threshold value (the thresh-
old line will turn from red to green).

4. The default displays the data in a logarithmic format but it may
be more easily visualized on a linear scale. To change from
logarithmic to linear, double click on the y-axis, check the box
that indicates linear view on the “post-run settings” block,
click “apply,” and view the data as a sigmoidal curve.

5. Adjust the threshold value so that the line crosses the curves at
the beginning of the exponential phase. All controls should be
analyzed first to validate the experiment. Amplification growth
curves that demonstrate an exponential increase and cross the
threshold are considered a “positive” PCR result for that
marker; those that do not possess an exponential growth curve
within 45 cycles are considered a “negative” result for those
specimens for that marker (Fig. 2).

6. A report file may be generated using the software that may be
programmed to suit the investigator’s needs, including well
number, specimen information, threshold data, and Ct value.

10 Detection of Mycoplasma pneumoniae by Real-Time PCR 155

Fig. 2. Real-time PCR Data File. Detail view of data analysis on the ABI 7500 instrument. Typical amplification curves are
shown (in duplicate), for a clinical sample tested with Mp181 and the RNaseP control. Non-template controls (NTC) are also
shown (see Notes 8–12).

4. Notes

1. Primer purity is important. Many manufacturers offer different
“purity grades.” We recommend the use of “sequencing
grade,” as this provides superior performance due to higher
purity. Primers and probes may be synthesized by many repu-
table vendors or may be ordered internally at the Biotechnology
Core Facility at the investigator’s institute.

2. Repeated freeze–thaw cycles for primers/probes are not rec-
ommended for stability purposes. Working dilutions should be
stable for up to 6 months and may be quality control tested
(using known template) after this period to verify performance.
The stocks from which the working dilutions are made should
be stable at 4°C for longer periods (up to a year) but should
also be quality control tested if used past this period.

3. Plate setup in Fig. 1 shows the furthest possible separation of
NTC from the Positive Control wells. This should be standard
practice to ensure the quality of the assay setup and execution.
The NTC should be added in the “clean” room and capped.
The PC should be added last to the plate, after all other speci-
mens have been added and capped. The PC can be a clinical
specimen known to be positive for M. pneumoniae or can be

156 J.M. Winchell and S.L. Mitchell

prepared by using extracted nucleic acid from an M. pneumoniae
culture and supplemented with commercially available (or labo-
ratory isolated) human nucleic acid to ensure a positive RNaseP
reaction.

4. Gowns and gloves used in the “clean room” may be used in
the template “dirty” room by the laboratorian to avoid
de-gowning/re-gloving during this process; however the con-
verse should never occur. Work surfaces, dedicated pipettes,
and any other equipment should be decontaminated with
RNase Away before proceeding with template addition. Once
the template is added to the test plate, all gloves and gowns
should be disposed of and autoclaved in order to avoid con-
tamination and pipette shafts and work surfaces should once
again be decontaminated with RNase away. A UV light source
can be used on all surfaces to aid in decontamination.

5. DNA prepared from Qiagen (e.g., QiaAmp DNA Blood
Minikit), MagNA Pure, or other commercially available kits is
acceptable. Both DNA and total nucleic acid (TNA) are
acceptable.
Specimens should be extracted and tested as soon as pos-
sible after receipt to ensure optimal results.

6. Use 5 ml of sample to ensure accurate pipetting and specimen
addition. If the sample volume is limited, less than 5 ml may
be added and the volume of water should be adjusted to
total 25 ml.

7. Specimens should be taken from patients during the early phase
of infection or first onset of symptoms of respiratory infection.
Acceptable specimens include oropharyngeal and/or nasopha-
ryngeal swabs, transported and stored in ~2 ml of universal
viral transport media (VTM, Becton Dickinson or equivalent)
in a screw-top sterile falcon tube. Specimens transported within
72 h can be shipped at 4°C. If over 72 h, specimens should be
stored between −20 and −70ºC and shipped on dry ice. BAL
specimens are acceptable.

8. Positive specimens should show an exponential curve when
crossing the threshold value. Depending on the specimen qual-
ity, time of acquisition, and other factors (i.e., antibiotic use),
Ct values may range dramatically (i.e., from ~20 to 40 or
greater). In our experience, late positive Ct values have yielded
culture isolates. Specimens resulting in a late curve (Ct value of
40–45) or displaying a curve that is not exponential should be
retested again by either qPCR or a traditional method. It is
critical to note the shape of the curves, especially for those
which have late Ct values. It should be emphasized that speci-
mens that result in a Ct value >40 need to be examined closely.
These curves may, in fact, be accurate in detecting a true posi-

10 Detection of Mycoplasma pneumoniae by Real-Time PCR 157

tive specimen. They also may be an artifact. It is critical to
examine the suspect curve(s) in the context of the NTCs, note
the shape of the curve(s), and inspect the “Spectra” and
“Component” tabs (if using the ABI 7500) to help with analy-
sis. Ultimately, the specimen may require concentration to be
retested.

9. Since different specific markers (i.e., Mp181, Mp3, and Mp7)
can be used on the same specimen, they each may contain dif-
ferent background fluorescent levels and require separate anal-
ysis in order to properly assess the specimen’s status. The three
markers can also serve to increase the confidence in interpreta-
tion of results (8).

10. The RNaseP value can be helpful in assessing the quality of
the extracted nucleic acid. A nonexistent or poor (i.e., non-
exponential) amplification curve signifies poor-quality template
and the specimen should be re-extracted. Lack of amplification
on any specimen, including the positive control, may indicate
improper master mix preparation.

11. Because the RNaseP marker detects human DNA, it is quite
easy to contaminate stocks, PCR consumables, and common
equipment if strict PCR and proper laboratory practices are
not followed. If stocks become contaminated, they must be
discarded and reordered. Occasionally, one may observe a
“positive” curve in an RNaseP NTC. These should be inter-
preted with care and indicate that contamination has occurred
within the laboratory. These “positives” underscore the sensi-
tivity of the procedure and the constant need for routine
decontamination of surfaces and equipment with RNase Away
or equivalent.

12. If post-PCR analysis of the reaction mixture is needed but can-
not be performed immediately, plates should be stored at
−20ºC to ensure DNA amplicon stability.

References Identification of risk factors for infection in an
outbreak of Mycoplasma pneumoniae respira-
1. Walter ND, Grant GB, Bandy U, Alexander tory tract disease. Clin Infect Dis 43:
NE, Winchell JM, Jordan HT, Sejvar JJ, Hicks 1239–1245
LA, Gifford DR, Alexander NT, Thurman KA,
Schwartz SB, Dennehy PH, Nino K, Fields BS, 3. Mezarina KB, Huffmire A, Downing J, Core
Dillon MT, Erdman DD, Whitney CG, Moore N, Gershman K, Hoffman R (2001) Outbreak
MR (2008) Community outbreak of of community-acquired pneumonia caused by
Mycoplasma pneumoniae: school-based cluster Mycoplasma pneumoniae—Colorado 2000.
of neurologic disease associated with house- MMWR 50:227–230
hold transmission of respiratory illness. J Infect
Dis 198:1365–1374 4. Waring AL, Halse TA, Csiza CK, Carlyn CJ,
Musser KA, Limberger RJ (2001) Development
2. Klement E, Talkington DF, Wasserzug O, of a genomics-based PCR assay for detection
Kayouf R, Davidovitch N, Dumke R, Bar-Zeev of Mycoplasma pneumoniae in a large outbreak
Y, Merav R, Boxman J, Thacker WL, Wolf D, in New York State. J Clin Microbiol 39:
Lazarovich T, Shemer-Avni Y, Glikman D, 1385–1390
Jacobs E, Grotto I, Block C, Nir-Paz R (2006)

158 J.M. Winchell and S.L. Mitchell

5. Waites KB, Talkington DF (2004) Mycoplasma using an inhibition control. J Microbiol
pneumoniae and its role as a human pathogen. Methods 55:149–153
Clin Microbiol Rev 17:697–728
10. Loens K, Leven M, Ursi D, Beck T, Overdijk
6. Waites KB, Balish MF, Atkinson TP (2008) M, Sillekens P, Goossens H (2003) Detection
New insights into the pathogenesis and detec- of Mycoplasma pneumoniae by real-time nucleic
tion of Mycoplasma pneumoniae infections. acid sequence-based amplification. J Clin
Future Microbiol 3:635–648 Microbiol 41:4448–4450

7. Hammerschlag MR (2001) Mycoplasma pneu- 11. Thurman KA, Walter ND, Schwartz SB,
moniae infections. Curr Opin Infect Dis Mitchell SL, Dillon MT, Deutscher M, Fulton
14:181–186 JP, Tongren JE, Hicks LA, Winchell JM (2008)
Comparison of laboratory diagnostic proce-
8. Winchell JM, Thurman KA, Mitchell SL, dures for detection of Mycoplasma pneumoniae
Thacker WL, Fields BS (2008) Evaluation of in community outbreaks. Clin Infect Dis
three real-time PCR assays for the detection 48:1244–1249
of Mycoplasma pneumoniae in an outbreak
investigation. J Clin Microbiol 46: 12. Kannan TR, Baseman JB (2006) ADP-
3116–3118 ribosylating and vacuolating cytotoxin of
Mycoplasma pneumoniae represents unique vir-
9. Ursi D, Dirven K, Loens K, Ieven M, Goossens ulence determinant among bacterial pathogens.
H (2003) Detection of Mycoplasma pneumo- Proc Natl Acad Sci USA 103:6724–6729
niae in respiratory samples by real-time PCR

Chapter 11

Real-Time PCR Assay for the Diagnosis
of Pneumocystis jirovecii Pneumonia

Judith Fillaux and Antoine Berry

Abstract

Pneumocystis jirovecii is a common cause of life-threatening pneumonia among immunocompromised
patients. Since P. jirovecii cannot be cultured, specific identification of it depends on examining respiratory
specimens. In the last decade, PCR has been developed which allows the detection of very low levels of
P. jirovecii not detectable by routine histochemical staining. We have shown that the direct
immunofluorescence assay can be replaced by a real-time PCR assay given its feasibility, sensitivity, and
specificity, for the detection of P. jirovecii. A negative PCR, performed on a LightCycler System®, enables
a diagnosis of Pneumocystis jirovecii pneumonia (PjP) to be excluded, and the semiquantitative result with
the application of some cutoff values can have a role in distinguishing between colonized or subclinically
infected patients and PjP patients.

Key words: Pneumocystis jirovecii, Bronchoalveolar lavage, Diagnosis, Real-time PCR

1. Introduction

Pneumocystis jirovecii, an opportunistic fungus, causes pneumonia
(Pneumocystis jirovecii pneumonia (PjP)) that is an important cause
of morbidity and mortality among immunocompromised patients
(1–4). In HIV-infected individuals, PjP presents with fever, cough,
and dyspnea on exertion, and upon radiology, symmetric intersti-
tial or granular opacities are observed (5, 6). The presentation of
PjP in other immunocompromised patients differs from this classi-
cal acute presentation, causing diagnostic difficulties (7, 8). Since
P. jirovecii cannot be cultured, specific identification of it depends
on examining respiratory specimens. Bronchoscopy with broncho-
alveolar lavage (BAL) is the preferred diagnostic procedure with
reported sensitivities ranging from 89% to greater than 98%, using

Mark Wilks (ed.), PCR Detection of Microbial Pathogens: Second Edition, Methods in Molecular Biology, vol. 943,
DOI 10.1007/978-1-60327-353-4_11, © Springer Science+Business Media, LLC 2013

159

160 J. Fillaux and A. Berry

any microscopy-based diagnostic technique (9, 10). In the last
decade, PCR has been developed which allows the detection of
very low levels of P. jirovecii not detectable by routine histochemi-
cal staining. These approaches have shown that P. jirovecii is also
carried in asymptomatic individuals with only mild immunosup-
pression (long-term glucocorticoid therapy), in immunocompe-
tent individuals with chronic pulmonary diseases, and in
immunocompetent health-care workers (11–15).

The direct immunofluorescence assay (DFA), our “gold stan-
dard” method, can be replaced by the real-time PCR assay, given
its feasibility, sensitivity, and specificity (16). A negative PCR
enables a diagnosis of PjP to be excluded, and the semiquantitative
result with the application of some cutoff values can have a role in
distinguishing between colonized or subclinically infected patients
and PjP patients.

2. Materials The real-time PCR assay is performed according to a modification
of the Larsen et al. (17) protocol. Patient samples should be tested,
2.1. Nonspecific once, in duplicate.
Materials
2.2. Patients’ 1. Nuclease-free, aerosol-resistant pipette tips.
Specimens 2. Absolute ethanol.
2.3. Controls 3. Isopropanol.

2.4. DNA Extraction 1. Fresh BAL (see Note 1).
and Amplification 2. Mucolytic agent such as Digest-EUR® (Eurobio, Les Ulis,

France).

1. External control: P. jirovecii-positive and -negative BAL sam-
ples, as determined by previous DFA and PCR, are included in
each PCR run.

2. Contamination control: PCR-grade water.
3. Human internal control: Human beta-globin. From each

extract, amplification of the human beta-globin gene is per-
formed to assess the correct progress of DNA extraction and to
underline the absence of PCR inhibitors.

1. High Pure PCR Template Preparation Kit (Roche Diagnostics).
2. LightCycler® 2.0 System (Roche Diagnostics).
3. LightCycler® capillaries (Roche Diagnostics).

11 Real-Time PCR Assay for the Diagnosis of Pneumocystis jirovecii Pneumonia 161

4. P. jirovecii: Primers and probes (17) are derived from the
P. jirovecii major surface glycoprotein (MSG) gene (GenBank
accession number: AF372980).

– LightCycler® FastStart DNA Master HybProbe (Roche
Diagnostics).

– Primers: JKK14/15 (5¢-GAA TGC AAA TCY TTA CAG
ACA ACA G-3¢) and JKK17 (5¢-AAA TCA TGA ACG
AAA TAA CCA TTG C-3¢) (Eurogentec, Angers, France)
amplify a 250-bp segment of the multicopy MSG gene
family. Primers are used at a final concentration of 0.5 mM.

– Probes labeled with fluorescein and Red 640:
PCMSGFRET1U (5¢-CAA AAA TAA CAY TSA CAT
CAA CRA GGC G-fluorescein-3¢) and PCMSGFRET1D
(5¢-Red 640-TGC AAA CCA ACC AAG TGT ACG ACA
GG-3¢) (Tib Molbiol, Berlin, Germany). The final concen-
trations of the fluorescein-labeled probes and LC-Red
640-labeled probes are 0.1 mM and 0.5 mM, respectively.

5. Human beta-globin: This PCR assay is performed separately.

– LightCycler® FastStart DNA Master SYBR Green (Roche
Diagnostics).

– Primers: BG07 (5¢-GGT TGG CCA ATC TAC TCC CAG
G-3¢) and BG08 (5¢-TGG TCT CCT TAA ACC TGT CTT
G-3¢) (18). Primers are used at a final concentration of
0.1 mM.

3. Methods

3.1. Processing These should be handled under the laminar flow hood of the
of Patients’ Specimens extraction room (see Note 2).

1. Vortex the patient’s sample.

2. To a 2 ml sterile screw microcentrifuge tube, add 1.5 ml of the
patient’s sample. If the sample is too slimy, pretreat it with a
mucolytic agent at a 1:1 v/v ratio. Leave at room temperature,
mixing occasionally until it becomes liquified.

3. Centrifuge for 20 min at 900 × g.

4. Remove the supernatant, retain a 200-ml pellet, and perform
the DNA extraction as described below.

3.2. DNA Extraction This step should be performed in the DNA extraction room.

1. Turn on the incubator to 72°C.
2. Take 40 ml of proteinase K per patient sample from the

freezer.

162 J. Fillaux and A. Berry

3.3. P. jirovecii 3. Fill a microcentrifuge tube with 200 ml elution buffer per
amplification patient sample and incubate at 72°C. The next three (4–6)
(see Note 3) steps are carried out under the laminar flow hood.

3.3.1. Preparation 4. To the 200-ml pellet of the sample material, add 200 ml Binding
of the Master Mix Buffer and vortex.

5. Add 40 ml proteinase K and vortex.

6. Incubate at 72°C for 10 min. The next 18 steps (7–24) are
carried out on the laboratory bench.

7. Mix briefly to avoid aerosol creation.

8. Add 100 ml isopropanol in order to inactivate Proteinase K and
vortex.

9. Mix briefly to avoid aerosol creation.

10. Insert one filter tube in one collection tube.

11. Pipette the sample into the upper buffer reservoir and close.

12. Centrifuge for 90 s at 8,000 × g.

13. Remove the filter tube from the collection tube, and combine
the filter tube with a new collection tube.

14. Add 500 ml “Inhibitor Removal Buffer” to the upper reservoir
and close.

15. Centrifuge for 90 s at 8,000 × g.

16. Remove the filter tube from the collection tube, and combine
the filter tube with a new collection tube.

17. Add 500 ml “Wash Buffer” to the upper reservoir and close.

18. Centrifuge for 90 s at 8,000 × g, and then 90 s at 13,000 × g.

19. Remove the filter tube from the collection tube, and combine
the filter tube with a new collection tube.

20. Add 500 ml prewarmed “Elution Buffer” (see step 3 above) to
the upper reservoir and close.

21. Centrifuge for 90 s at 8,000 × g.

22. Remove the filter tube from the collection tube, and combine
the filter tube with a new collection tube.

23. The collection tube now contains eluted DNA. Remove the
filter tube. Transfer the eluted DNA in a 2 ml microcentrifuge
tube.

24. Store the microcentrifuge tube at +4°C until amplification.

These steps should take place in the DNA-free room; work on a
small sheet of aluminum foil.

1. Thaw one vial of “Reaction Mix.”

2. Briefly centrifuge one vial “Enzyme” and the thawed vial of
“Reaction Mix.”

11 Real-Time PCR Assay for the Diagnosis of Pneumocystis jirovecii Pneumonia 163

3. Pipette 60 ml from the “Reaction Mix” vial into the “Enzyme”
vial.

4. Mix by pipetting up and down.

5. Label the “Enzyme” vial, “Pneumocystis Taq Mix,” and keep
refrigerated for a maximum of 1 week. Do not freeze.

3.3.2. Preparation This step should take place in the DNA-free room; work on a small
of the PCR Mix sheet of aluminum foil:

1. Thaw the solutions of primers and probes. Do not vortex or
refreeze. Keep refrigerated until 10 days after thawing and then
discard the remaining reagent.

2. Prepare a 10× conc. solution of v/v pooled primers and a 1×
conc. solution of probes.

3. Mix the MgCl2 stock solution.
4. In a 2 ml reaction tube, prepare the PCR mix by adding the

following components in the order shown in Table 1.

5. Check no residue remains in the tip after each pipetting step.

6. Do not vortex the PCR mix.

7. Take a new box of LightCycler capillary tubes and remove the
top.

8. Transfer the capillaries to an empty sterilized box.

9. Carefully mix the components of the PCR mix by pipetting up
and down.

Table 1
Preparation and final concentration of components
of the test PCR

Component Volume (ml) Final concentration

Water 3

MgCl2 1.2 4 mMa
JKK 14/15, JKK 17 Primer mix 2 1 mM/primer

Red Probe mix 0.25 0.5 mM

Fluo Probe mix 0.05 0.1 mM

Pneumocystis Taq Mix 1 1×

Total volume 7.5

aThe MgCl2 final concentration takes into account the MgCl2 contained in the
Pneumocystis Taq Mix

164 J. Fillaux and A. Berry

3.3.3. Addition of the DNA 10. Pipette 7.5 ml PCR mix into each precooled capillary with the
Template same tip without sealing (see Note 4).

3.3.4. Program the 11. Close the sterilized box and store the PCR mix at −20°C (max
LightCycler® 1 month).

This is performed in the DNA extraction room on the bench.

1. Take the required number of capillaries, prepared with the
PCR mix, from the freezer and place them in precooled centri-
fuge adapters wrapped up in aluminum foil.

2. Take the DNA samples from the fridge and thaw the
controls.

3. Mix and then briefly centrifuge the DNA samples and the con-
trols in a standard benchtop microcentrifuge.

4. Add 2.5 ml of the DNA templates and seal with a stopper after
filling each capillary (see Note 4).

5. Transfer the capillaries into the sample carousel of the
LightCycler®.

Use the conditions shown in Table 2

3.4. Human Beta- These steps should take place in the DNA-free room; work on a
Globin Amplification small sheet of aluminum foil.
3.4.1. Preparation
of the Master Mix 1. Thaw three vials of “Reaction Mix” and shield from light.

3.4.2. Preparation 2. Briefly centrifuge one vial “Enzyme” and the thawed vials of
of the PCR mix “Reaction Mix.”

3. Pipette 10 ml from “Enzyme” vial into each “Reaction Mix”
vial, keep one in the fridge (for a maximum of 1 week), and
freeze the other two.

4. Mix by pipetting up and down.

5. Label the “Reaction Mix” vial, “beta-globin Taq mix.” Always
keep it away from light.

These steps should take place in the DNA-free room; work on a
small sheet of aluminum foil.

1. Thaw the primer solutions. Do not vortex or refreeze thawed
primers.

2. Prepare a 10× conc. solution of pooled primers.

3. Mix the MgCl2 stock solution.
4. In a 2 ml reaction tube, prepare the PCR mix by adding the

following components in the order shown in the table (see
Table 3).

Table 2
Program conditions for the Pneumocystis PCR

Program Denaturation Analysis mode None Step size (°C) Step delay (cycles) Acquisition mode 11 Real-Time PCR Assay for the Diagnosis of Pneumocystis jirovecii Pneumonia
1 Slope (°C/s) Sec target (°C) 0 0 None
Program name Hold (hh:mm:ss) 20 0 165
Cycles 00:10:00 Step size (°C) Step delay (cycles) Acquisition mode
Target (°C) Amplification 1 Analysis mode None 0 0 None
95 6 Slope (°C/s) Sec target (°C) 1 0 Single
Program name Hold (hh:mm:ss) 20 0 0 0 None
Cycles 00:00:05 20 60
Target (°C) 00:00:10 20 0 Step size (°C) Step delay (cycles) Acquisition mode
95 00:00:20 0 0 None
65 Amplification 2 Analysis mode Quantification 2 0 Single
72 40 Slope (°C/s) Sec target (°C) 0 0 None
Program name Hold (hh:mm:ss) 20 0
Cycles 00:00:05 20 50 Step size (°C) Step delay (cycles) Acquisition mode
Target (°C) 00:00:10 20 0 0 0 None
95 00:00:20
60 Refroidissement Analysis mode None
72 1 Slope (°C/s) Sec target (°C)
Program name Hold (hh:mm:ss) 20 0
Cycles 00:01:00
Target (°C)
40

166 J. Fillaux and A. Berry

Table 3
Preparation and final concentration of components
of the beta-globin control PCR

Component Volume (ml) Final concentration

Water 5.1

MgCl2 1.2 4 mMa
B07/08 Primer mix 0.2 0.1 mM/primer

Beta-globin Taq mix 1 1×

Total volume 7.5

aThe MgCl2 final concentration takes into account the MgCl2 contained
in the beta-globin Taq Mix

3.4.3. Distribution 5. Check no residue remains in the tip after each pipetting step.
of the PCR Mix and DNA 6. Do not vortex the PCR Mix.
(see Note 4) 7. Store the PCR Mix at 4°C.

3.4.4. Program the These steps should take place in the DNA-free room; work on a
LightCycler® small sheet of aluminum foil.
3.5. Interpretation
(see Note 5) 1. Place the required number of capillaries in precooled centri-
fuged adapters wrapped up in an aluminum foil.

2. Mix carefully the PCR mix by pipeting up and down.
3. Pipette 7.5 ml PCR mix into each precooled capillary with the

same tip.
4. Take the DNA samples from the fridge and thaw the

controls.
5. Mix and then briefly centrifuge the DNA samples and the con-

trols in a standard benchtop microcentrifuge.
6. Add 2.5 ml of the DNA templates and seal with a stopper after

each capillary.
7. Transfer the capillaries into the sample carousel of the

LightCycler®.

Using the Conditions Shown in Table 4

1. The sensitivity and specificity of the real-time PCR assay depend
on Ct of detection. If the Ct chosen is 22, the specificity of the
real-time PCR assay is 100% and if the Ct is 28, the sensitivity is
100%. Between these two cutoff points, there is a grey zone in
which the PCR value and the DFA result can be discrepant.

Table 4
Program conditions for the beta-globin PCR

Program Denaturation Analysis mode None Step size (°C) Step delay (cycles) Acquisition mode 11 Real-Time PCR Assay for the Diagnosis of Pneumocystis jirovecii Pneumonia
1 Slope (°C/s) Sec target (°C) 0 0 None
Program name Hold (hh:mm:ss) 20 0 167
Cycles 00:08:00 Step size (°C) Step delay (cycles) Acquisition mode
Target (°C) Amplification Analysis mode Quantification 0 0 None
95 40 Slope (°C/s) Sec target (°C) 0 0 None
Program name Hold (hh:mm:ss) 20 0 0 0 Single
Cycles 00:00:15 20 0
Target (°C) 00:00:10 20 0 Step size (°C) Step delay (cycles) Acquisition mode
95 00:00:20 0 0 None
70 Fusion Analysis mode Melting curves 0 0 None
72 1 Slope (°C/s) Sec target (°C) 0 0 Continuous
Program name Hold (hh:mm:ss) 20 0
Cycles 00:00:05 20 0 Step size (°C) Step delay (cycles) Acquisition mode
Target (°C) 00:00:20 0,05 0 0 0 None
95 00:00:00
62 Refroidissement Analysis mode None
95 1 Slope (°C/s) Sec target (°C)
Program name Hold (hh:mm:ss) 20 0
Cycles 00:00:00
Target (°C)
40

168 J. Fillaux and A. Berry

2. Four interpretations can be proposed to clinicians (16):

– Negative PCR results: “Absence of Pneumocystis jirovecii.
PjP diagnosis excluded.”

– Positive PCR with Ct ³ 28: “Low fungal burden:
Pneumocystis pneumonia improbable. Prophylactic treat-
ment could be necessary in case of an immunocompro-
mised patient.”

– Positive PCR with 22 £ Ct < 28: “Moderate fungal burden:
possible Pneumocystis pneumonia, interpretation depends
on anamnesis, clinical and radiological signs. Specific treat-
ment (curative or prophylactic) is necessary in case of an
immunocompromised patient.”

– Positive PCR with Ct < 22: “High fungal burden:
Pneumocystis pneumonia. To be treated.”

4. Notes

1. Collection of BAL fluid: In brief, BAL is performed by instill-
ing three 50-ml aliquots of warm pyrogen-free normal saline
(0.9%), followed by gentle suction after each aliquot is infused.
The first aliquot is separated from the subsequent two, which
are pooled before being dispatched between the different labo-
ratories. This technique optimizes the separation of bronchial
epithelial cells from truly alveolar material (19). The final vol-
ume recovered ranges from 75 to 100 ml.

2. In order to avoid contamination, it is of crucial importance to
maintain strict physical separation (different rooms) of the var-
ious steps involved in the PCR, and to respect specific cleaning
and manipulation procedures. For example, organize your
bench to avoid the need for the pipette to pass above the capil-
laries when distributing the DNA samples.

3. In order not to waste a run, when preparing the PCR mix, do
not provide for one additional reaction. This will allow you to
verify that you have not made a mistake during the preparation
of the PCR mix.

4. In order to improve the reproducibility, when distributing the
PCR Mix into the capillaries, put the tip on the edge of the
capillary without touching inside, and do not press until the
second step of the pipette. Loosen the pressure only when the
pipette is in the PCR mix again. When distributing the DNA
sample, press until the second step of the pipette.

11 Real-Time PCR Assay for the Diagnosis of Pneumocystis jirovecii Pneumonia 169

Amplification CurvesFluorescence(640/530)

0,8
0,7
0,6
0,5 LBA: Ct = 11.5
0,4
0,3 Control:Ct = 27.3
0,2

H2O
0,1

0

2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Cycles

Fig. 1. Amplification curves of real-time PCR for the diagnosis of Pneumocystis jirovecii pneumonia.

5. All acquired fluorescence data are analyzed and the quantification
of the P. jirovecii DNA is represented by the cycle threshold
(Ct) measured by the LightCyler® software (see Fig. 1).

– A Ct value is reported for each positive sample (20).
A sample is regarded as positive if the two tubes are posi-
tive by this assay.

– A positive result in only one tube warrants a re-amplification
of the DNA previously extracted, following the same pro-
cedure. If the retest has at least one of the two tubes posi-
tive, the sample is considered positive for P. jirovecii.

– A negative MSG result has to have a positive result for the
human beta-globin PCR to be considered valid, to ensure
the correct progress of extraction and the absence of inhib-
itors in the specimen. A negative result for the human
beta-globin PCR requires retesting (re-extraction and
re-amplification performed following the previously
described procedure) of an additional aliquot of the origi-
nal sample (pure and 1/10 diluted). If the human beta-
globin PCR remains negative with the pure sample but is
positive with the diluted sample, the patient’s specimen
has to be reanalyzed for the quantification of the P. jirovecii
DNA on the diluted sample.

170 J. Fillaux and A. Berry

Acknowledgments

We acknowledge S. Chalmeton, E. Duthu, and S. Gisquet for their
technical support.

References

1. Cisneros JM, Munoz P, Torre-Cisneros J, infection in patients with chronic bronchial
Gurgui M, Rodriguez-Hernandez MJ, Aguado disease. Lancet 347:977
JM et al (1998) Pneumonia after heart trans-
plantation: a multi-institutional study. Spanish 12. Helweg-Larsen J, Jensen JS, Dohn B, Benfield
Transplantation Infection Study Group. Clin TL, Lundgren B (2002) Detection of
Infect Dis 27:324–331 Pneumocystis DNA in samples from patients
suspected of bacterial pneumonia-a case-control
2. Huang L, Morris A, Limper AH, Beck JM study. BMC Infect Dis 2:28
(2006) An Official ATS Workshop Summary:
Recent advances and future directions in 13. Maskell NA, Waine DJ, Lindley A, Pepperell
Pneumocystis pneumonia (PCP). Proc Am JC, Wakefield AE, Miller RF et al (2003)
Thorac Soc 3:655–664 Asymptomatic carriage of Pneumocystis jiroveci
in subjects undergoing bronchoscopy: a pro-
3. Sepkowitz KA (2002) Opportunistic infections spective study. Thorax 58:594–597
in patients with and patients without Acquired
Immunodeficiency Syndrome. Clin Infect Dis 14. Miller RF, Ambrose HE, Wakefield AE (2001)
34:1098–1107 Pneumocystis carinii f. sp. hominis DNA in
immunocompetent health care workers in
4. Wakefield AE (2002) Pneumocystis carinii. Br contact with patients with P. carinii pneumonia.
Med Bull 61:175–188 J Clin Microbiol 39:3877–3882

5. DeLorenzo LJ, Huang CT, Maguire GP, Stone 15. Nevez G, Raccurt C, Jounieaux V, Dei-Cas E,
DJ (1987) Roentgenographic patterns of Mazars E (1999) Pneumocystosis versus pul-
Pneumocystis carinii pneumonia in 104 patients monary Pneumocystis carinii colonization in
with AIDS. Chest 91:323–327 HIV-negative and HIV-positive patients. AIDS
13:535–536
6. Huang L, Stansell J, Osmond D, Turner J,
Shafer KP, Fulkerson W et al (1999) 16. Fillaux J, Malvy S, Alvarez M, Fabre R, Cassaing
Performance of an algorithm to detect S, Marchou B et al (2008) Accuracy of a rou-
Pneumocystis carinii pneumonia in symptom- tine real-time PCR assay for the diagnosis of
atic HIV-infected persons. Pulmonary Pneumocystis jirovecii pneumonia. J Microbiol
Complications of HIV Infection Study Group. Methods 75:258–261
Chest 115:1025–1032
17. Larsen HH, Masur H, Kovacs JA, Gill VJ, Silcott
7. Dei-Cas E (2000) Pneumocystis infections: the VA, Kogulan P et al (2002) Development and
iceberg? Med Mycol 38(Suppl 1):23–32 evaluation of a quantitative, touch-down, real-
time PCR assay for diagnosing Pneumocystis car-
8. Thomas CF, Limper AH (2004) Pneumocystis inii pneumonia. J Clin Microbiol 40:490–494
pneumonia. N Engl J Med 350:2487–2498
18. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn
9. Broaddus C, Dake MD, Stulbarg MS, GT, Erlich HA et al (1985) (1992) Enzymatic
Blumenfeld W, Hadley WK, Golden JA et al amplification of beta-globin genomic sequences
(1985) Bronchoalveolar lavage and transbron- and restriction site analysis for diagnosis of
chial biopsy for the diagnosis of pulmonary sickle cell anemia. Biotechnology 24:476–480
infections in the acquired immunodeficiency
syndrome. Ann Intern Med 102:747–752 19. Rennard SI, Ghafouri M, Thompson AB,
Linder J, Vaughan W, Jones K et al (1990)
10. Huang L, Hecht FM, Stansell JD, Montanti R, Fractional processing of sequential bronchoal-
Hadley WK, Hopewell PC (1995) Suspected veolar lavage to separate bronchial and alveolar
Pneumocystis carinii pneumonia with a nega- samples. Am Rev Respir Dis 141:208–217
tive induced sputum examination. Is early
bronchoscopy useful? Am J Respir Crit Care 20. Bustin SA (2000) Absolute quantification of
Med 151:1866–1871 mRNA using real-time reverse transcription
polymerase chain reaction assays. J Mol
11. Calderon EJ, Regordan C, Medrano FJ, Ollero Endocrinol 25:169–193
M, Varela JM (1996) Pneumocystis carinii

Chapter 12

Rapid Identification of Mycobacteria and Rapid Detection
of Drug Resistance in Mycobacterium tuberculosis
in Cultured Isolates and in Respiratory Specimens

Wing-Cheong Yam and Kit-Hang Gilman Siu

Abstract

Recent advances in molecular biology and better understanding of the genetic basis of drug resistance have
allowed rapid identification of mycobacteria and rapid detection of drug resistance of Mycobacterium tuber-
culosis present in cultured isolates or in respiratory specimens. In this chapter, several simple nucleic acid
amplification-based techniques are introduced as molecular approach for clinical diagnosis of tuberculosis.
A one-tube nested IS6110-based polymerase chain reaction (PCR) is used for M. tuberculosis complex
identification; the use of a multiplex allele-specific PCR is demonstrated to detect the isoniazid resistance;
PCR-sequencing assays are applied for rifampicin and ofloxacin resistance detection and 16S rDNA
sequencing is utilized for identification of mycobacterial species from cultures of acid fast bacilli (AFB).
Despite the high specificity and sensitivity of the molecular techniques, mycobacterial culture remains the
“Gold Standard” for tuberculosis diagnosis. Negative results of molecular tests never preclude the infec-
tion or the presence of drug resistance. These technological advancements are, therefore, not intended to
replace the conventional tests, but rather have major complementary roles in tuberculosis diagnosis.

Key words: Mycobacterium tuberculosis, IS6110 PCR, COBAS® TaqMan® MTB Test, PCR sequencing,
Rifampicin resistance, Isoniazid resistance, Multiplex allele-specific PCR, Ofloxacin resistance, 16S
rDNA sequencing

1. Introduction

Tuberculosis (TB) is a contagious disease caused by mycobacteria,
mainly Mycobacterium tuberculosis. Overall, one-third of the world’s
population is currently infected with the TB bacillus. According to
a WHO report, there were 9.2 million new cases and 1.7 million
deaths resulting from TB in 2006 (1). Due to the risk of spread of
the disease, the potential for the emergence of drug-resistant

Mark Wilks (ed.), PCR Detection of Microbial Pathogens: Second Edition, Methods in Molecular Biology, vol. 943,
DOI 10.1007/978-1-60327-353-4_12, © Springer Science+Business Media, LLC 2013

171

172 W.-C. Yam and K.-H.G. Siu

strains, and the severity of the disease in patients infected with
HIV-1, rapid diagnosis of M. tuberculosis is extremely important to
allow clinical decisions on the initiation and type of antituberculo-
sis treatment to be made, with or without isolation of the patient
to prevent secondary transmission to susceptible contacts (2).

1.1. Identification The isolation of an organism of the M. tuberculosis complex is
of M. tuberculosis required for the definitive diagnosis of tuberculosis. Routine cul-
in Clinical Specimens tures are time-consuming and can take up to 8 weeks. Examination
of a direct smear for acid-fast bacilli (AFBs) in respiratory speci-
mens provides a rapid diagnosis for tuberculosis, but the detec-
tion limit is about 5 × 103 bacilli per milliliter of specimen, and
M. tuberculosis cannot be distinguished from other AFBs (3).
Immunological and serological techniques are of limited use, since
they are invariably confounded by previous BCG vaccination,
exposure to environmental mycobacteria and also conditions
which results in immunosuppression (4, 5). Nucleic acid
amplification assays have been extensively evaluated and confirmed
to be a reliable and rapid strategy for identification and drug sus-
ceptibility testing of M. tuberculosis. Recent studies have shown
that turnaround times can be further shortened by allowing the
detection of mycobacteria directly from clinical specimens before
the culture result is available (6–9).

In this chapter, two PCR-based approaches for rapid
identification of M. tuberculosis are described in detail. The first
approach is an in-house single-tube nested PCR targeting the M.
tuberculosis complex-specific insertion sequence IS6110. The assay
utilizes two sets of primers with different melting temperatures
(Tm), 88°C for external primers, 70°C for internal primers, and
two amplification cycles with different annealing temperature, to
augment sensitivity and specificity (7, 10, 11). Compared to a two
tube nested protocol, this single-tube nested PCR format also
reduces the risk of cross-contamination. The coupled use of dUTP
and uracil-N-glycosylase also prevents carryover of amplicons from
previous experiments (see Fig. 1a). A recent study reported that
the assays were 100% specific and had overall diagnostic sensitivities

Fig. 1. (a) Graphical description of the principle of one-tube nested IS6110 PCR. At initial 37°C, UNG is activated and it
destructs uracil-containing previous amplicon. At 94°C, 12 min, the UNG is denatured with simultaneously activation of the
AmpliTaq Gold. On the first amplification cycles with annealing temperature of 72°C, external primers bind with template
with high stringency and produce amplicon for next cycles. On the second amplification cycles, a much lower annealing
temperature would be used for the internal primers to perform amplification with greater efficiency rather than stringency.
(b) Gel photo showing the results of IS6110 PCR identification of M. tuberculosis complex. M: 100-bp DNA ladder; lane 1
and 2: respiratory specimen s positive for M. tuberculosis complex; lane 3, 5, 6, 7, 8, 10: respiratory specimen s negative
for M. tuberculosis complex; lane 4: strong positive control DNA from H37Rv; lane 9: weak positive control DNA prepared
by tenfold dilution of strong positive control; lane 10:mQ water as a negative control.

12 Rapid Identification of Mycobacteria and Rapid Detection of Drug Resistance… 173

a UUU
UU U
UUUUUU

Amplicon from External primer
previous assays internal primer

UNG DNA template
active UNG AmpliTaq

Gold Inactive AmpliTaq Gold

U
U

UNG

37ЊC, 10 min

AmpliTaq
Gold

Denatured UNG
UNG

AmpliTaq 94ЊC, 12 min
Gold

Activated AmpliTaq Gold

AmpliTaq
Gold

UUU 15 cycles:
UU
94 ЊC, 45s;
72 ЊC, 1.5min

UUU UUU
UU UU

UUU
UU

AmpliTaq 45 cycles:
Gold
94 ЊC, 45s;
UUU 55 ЊC, 45s;
72 ЊC, 1min
UU

UUU
U

UU UUU

UUU UUUUUU UUUUUU
UU U UUU
UU U

UUUUUU UUU UUUUUU
UU U

Uracil-containing amplicon

174 W.-C. Yam and K.-H.G. Siu

Fig. 1. (continued)

1.2. Detection of Drug of ca. 90% for culture positive respiratory specimens, although
Resistance in their sensitivities for smear-negative specimens are still limited at
M. tuberculosis 60–70% (7, 10, 11).

The second approach is the use of the COBAS® TaqMan®
MTB Test, which is a commercial assay that integrates PCR
amplification and fluorescent detection of M. tuberculosis 16S
rRNA gene by using the homogeneous 5¢ nuclease assays. The test
is performed inside the COBAS® TaqMan® 48 Analyzer with the
turnaround time of around 2.5 h.

Conventional drug susceptibility test requires sufficient growth of
mycobacterial colonies to allow standardization of inocula used in
the agar proportional method (12), which takes another 2 weeks
after a positive culture is first obtained. Recent developments in
molecular biology and elucidation of the genetic basis of antituber-
culous drug resistance have provided new tools for the rapid detec-
tion of drug resistance in M. tuberculosis present in culture or even
in clinical specimens.

PCR followed by DNA sequencing has been the most widely
used method for detecting resistance-associated mutations. The
technique is especially efficient when the mutations are confined
within a small region of genes. Rifampicin (RIF), in combination
with isoniazid (INH), forms the backbone of short-course chemo-
therapy. Rifampicin binds to the b-subunit of DNA-dependent
RNA polymerase to hinder transcription and thereby kill the
microorganism (13). More than 95% of rifampicin resistance was
shown to be caused by missense mutations, in-frame deletions or

12 Rapid Identification of Mycobacteria and Rapid Detection of Drug Resistance… 175

a

Gly Thr Ser Gin Leu Ser Gin Phe Met Asp Gln Asn Asn Pro Leu Ser Gly Leu Thr His Lys Arg Arg Leu Ser Ala Leu
GGC ACC AGC CAG CTG AGC CAA TTC ATG GAC CAG AAC AAC CCG CTG GGC GGG TTG ACC CAC AAG CGC CGA CTG TCG GCG CTG
Leu
Pro Thr Leu Val 517 518 519 520 521 TTC 525 Tyr 528 529 530 Leu Pro
CCG ACC CTA CTC 436 437 438 439 440 0.5% 444 TAC 447 448 449 TTG CCG
Tyr Asp
Arg Arg Lys TAC 522 523 524 GAC Gin 1%
CGG CGC AAA Glu 441 442 443 Gln CAG
GTC CAG
Pro 9% Asn Trp
3% 1% CCA AAC TGG
515 516 Leu
Mutations 2% 434 435 CTC
associated
with RIF-R Glu Tyr
CAA TAC
Arg
CGC Cys
Pro TCT
CCC
34% 44%
526 527
Codon numbering in E. Coli 514 445 446 531 532 533
507 508 509 510 511 512 513 433 450 451 452
426 427 428 429 430 431 432

Codon numbering in MTB

b

i

ii iii iv

Fig. 2. (a) Diagram showing the regions and the frequencies of mutations associated with RIF resistance in M. tuberculosis.
(b) Alignment file of ClustalW displaying the alignment results of 7 RIF-R M. tuberculosis clinical strains against susceptible
reference strain H37Rv. Region i: GAC→GTC resulted in D516V in rpoB-B49; Region ii: CAC→CGC, CAC→AGC, CAC→TAC,
and CAC→ GAC resulted in H526R in rpoB-B69, H526S in rpoB-B70, H526Y in rpoB-B16, and H526D in rpoB-B17, respec-
tively; region iii: TCG→TTG resulted in S531L in rpoB-B3; region iv: CTG→CCG resulted in L533P in rpoB-B2.

insertions in the rpoB gene encoding the b-subunit. In the great
majority of RIF resistant strains, mutations occurs within a 81-bp
hotspot region, named as rifampicin resistance determining region
(RRDR) encoding 27 amino acids and corresponding to codons
507–533 or cluster I according to Escherichia coli numbering.
These occur in the center of the rpoB gene with the most common
changes in codons Ser531Leu, His526Tyr, and Asp516Val (see
Fig. 2a) (13). A previous study reported a molecular assay mainly
based on PCR sequencing, to detect RIF-resistant M. tuberculosis
in culture (14) by assessing the presence of resistance-associated
mutations inside the RRDR. The assay was subsequently modified
by Yam et al. for direct application in clinical samples, shortening
the turnaround time for drug resistance detection from a month
to a couple of days (15).

INH enters M. tuberculosis as a prodrug and requires activation
via the mycobacterial catalase-peroxidase enzyme encoded by the
katG gene (16). The activated INH appears to disrupt the biosyn-
thetic pathway of mycolic acid, an essential component of myco-

176 W.-C. Yam and K.-H.G. Siu

bacterial cell wall, through the inhibition of the NADH-dependent
enoyl-ACP reductase enzyme (InhA) (17). Unlike rifampicin, INH
resistance is likely to be mediated by several molecular mechanisms
and involve numerous genes, namely KatG, mabA-inhA operon,
ahpC, kasA, and ndh (18). The predominant mechanism is associ-
ated with mutations in katG, particularly in codon 315.
Approximately 50% of INH-resistant M. tuberculosis strains were
found to harbor mutations in katG315 (18, 19). One particular
base substitution at codon 315, Ser→Thr (AGC→ACC), was
reported to be the most frequently mutated allele. The second
most common resistance mechanism is that about 8–30% of isoni-
azid resistant M. tuberculosis isolates carry a mutation located at the
15th nucleotide preceding the mabA-inhA operon (19–21). This
mutation infers the overexpression of the INH drug target, inhA,
and produces INH resistance via a titration mechanism (13). To
detect genetic determinants for INH resistance, the PCR sequenc-
ing can be expensive and elaborate as multiple genes are involved
in resistance and resistance mutations are not clustered in a small
genetic region. The multiplex allele-specific PCR (MAS-PCR)
assay is a molecular strategy that utilizes three primers, with two
outer primers flanking a region of interest and which invariably
anneal to the conserved region of the target. The 3¢ end base of the
wildtype allele-specific inner primer is complementary to the wild-
type targeted codon to amplify a wildtype allele-specific fragment
in cases where there is no mutation present. An alteration of the
targeted codon would cause a mismatch between the inner primer
and the target DNA and result in no amplification of the wildtype
allele-specific fragment. Because of the ease and low running cost,
the assay facilitates the high-throughput analysis of multiple gene
polymorphisms. The application of MAS-PCRs in detecting
katG315 and mabA-15 mutations in M. tuberculosis clinical isolates
were reported previously (21, 22). By combining the two MAS-
PCR assays, a total of 77.5% of INH-resistant M. tuberculosis iso-
lates were identified in a study performed in Hong Kong (21).
Recently, our laboratory also extended the application of MAS-
PCR assays in the detection of INH resistance in M. tuberculosis
present in clinical specimens, providing a rapid and cost-effective
measure for INH resistance detection (23).

Ofloxacin (OFX) is the common fluoroquinolone often used
as a second-line drug in the treatment of multidrug resistant M.
tuberculosis (which is defined as resistance to RIF and INH). The
OFX targets and inactivate DNA gyrase, a type II DNA topoi-
somerase (24, 25). The DNA gyrase is encoded by two genes, gyrA
and gyrB. Like RIF, resistance-associated mutations are tend to be
confined within a small gene region, known as quinolone resis-
tance-determining region (QRDR). The 120 bp-QRDR located
inside the gyrA gene is a conserved region that corresponds to the
point of interaction between the drug and the gyrase. Missense

12 Rapid Identification of Mycobacteria and Rapid Detection of Drug Resistance… 177

Codon 90 Codon 94

Ala/Val Gly/Asp
(Mixed) (Mixed)

a Clinical specimens

A C G C+T G T C G A T C T A C G A+G C A
266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283

Ala Gly
(wildtype) (mutated)

AC G CG T C G A T C T A C G G C A

266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283

b Val Asp Subcultured isolates
(wildtype)
(mutated)

AC G T G T C G A T C T A C G A C A
266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283

Fig. 3. (a) In a clinical respiratory specimen, GyrA PCR-sequencing assay identified a M. tuberculosis strain carrying mixed
bases at nucleotides 269 and 281 that corresponding to codon 90 and 94 in gyrA gene. (b) In corresponding AFB culture,
two subpopulation of OFX-R M. tuberculosis were identified. The PCR-sequencing assay identified one subpopulation
harboring A90V mutation and wildtype codon 94, whereas another subpopulation harboring wildtype codon 90 and G94D
mutation. Both isolates have OFX MIC of 16 mg/mL.

1.3. Genotypic mutations in codon 90, 91, and 94 in the QRDR were shown to
Identification of be highly associated with resistance to OFX. PCR-sequencing
Non-tuberculous assays have also been developed to detect OFX-resistant M. tuber-
Mycobacteria from culosis in both culture and specimens (26) (see Fig. 3).
Culture
Identification of mycobacteria by growth characteristics and con-
ventional biochemical tests takes 3–5 weeks to obtain sufficient
cells for analysis. Various molecular methods have been developed
to facilitate the rapid and reliable identification of many mycobac-
terial species (27–32). Previous study characterized hypervariable
regions within the 16S rDNA molecule that exhibit species-specific
characteristics in mycobacteria and suggested that direct sequenc-
ing analysis of these regions could be a reliable genotypic method
for identification of mycobacterial species (32). In our experience,
16S rDNA sequencing is an excellent tool for mycobacterial spe-
cies identification (33). Nevertheless, the blind use of DNA
sequencing would be too expensive for routine diagnosis for all
samples, although this may change in the near future. Previous
studies indicated that M. tuberculosis complex and M. avium

178 W.-C. Yam and K.-H.G. Siu

complex account for a great majority of slow growers in laboratory
(32, 33). If the cultured isolates were screened by specific PCR for
the two complexes, a large proportion of isolates could be readily
identified and the few remaining isolates submitted for sequencing
(see Fig 2). Single-tube nested PCR targeting the IS6110 insertion
sequence has been evaluated and found to be a highly specific tool
for identification of M. tuberculosis complex (7, 10, 11). For
M. avium complex, a study reported an in-house PCR assay to
identify the 16S rDNA gene of the complex by using two different
forward primers, one specific for M. avium, while another is specific
for M. intracellulare, and one common reverse primer (31). Slow
growing isolates with negative results on both complex-specific
PCRs, together with the rapid growers, should be subjected to 16S
rRNA sequencing for identification (33). A sequence match of
м 99% with that of the prototype strain sequence in a repository
was used as the criterion for species, group or complex level
identification (34). Although sequencing has high resolving power
to discriminate between mycobacterial species, certain phenotypic
tests, such as chromogenicity and photoreactivity, have to be
retained to resolve the closely related species or members of the
complex with highly similarity of 16S rDNA sequences. The over-
view of molecular diagnosis of tuberculosis from either respiratory
specimens or cultured isolates is summarized in Fig. 4.

2. Materials

2.1. Specimen 1. 4% (w/v) NaOH–sputasol mixture: Aseptically add the whole
Decontamination by contents (7.5 mL) of a vial of Sputasol (Oxoid, Hampshire,
Sputasol-Sodium UK) to 50 mL 8% (w/v) NaOH. Top up the volume to 100 mL
Hydroxide using sterile distilled water. Stable for 48 h at 4°C.

2.2. DNA Extraction 2. Sodium phosphate buffer: 0.067 M sodium phosphate, pH5.3.
Stored at room temperature for up to 3 months.
2.2.1. DNA Extraction by
In-House Alkaline Lysis 1. Washing buffer: 0.1 M Tris/HCl, pH7.5. Stored at 4°C.
Method (for All Purposes 2. Lysis buffer: 1% (w/v) sodium hydroxide, 0.025% (w/v)
Except Use in the COBAS®
TaqMan® MTB Test) sodium dodecyl sulfate. Stored at 4°C.
3. Neutralization buffer: 0.1 M Tris/HCl, pH7.5. Stored at 4°C.
2.2.2. DNA Extraction by
AMPLICOR® Respiratory This kit consists of a Respiratory Specimen Wash Solution (RW),
Specimen Preparation Kit Respiratory Specimen Lysis Reagent RL), and Respiratory Specimen
(for All Purpose) (Roche Neutralization Reagent (RN). All reagents are stored at 4°C.
Diagnostics, Basel,
Schweiz)

12 Rapid Identification of Mycobacteria and Rapid Detection of Drug Resistance… 179

Fig. 4. Flowchart showing the strategy for molecular diagnosis of tuberculosis from respiratory specimens and identification
of Mycobacteria from cultured isolates. (a) PCR for M. tuberculosis complex: Negative. (b) PCR for M. tuberculosis complex:
Positive. (c) (i) Known mutation of MTB rpoB gene associated with rifampicin resistant NOT detected/(ii). Mutation, (e.g.,)
S531L, of MTB rpoB gene associated with rifampicin resistance detected. (d) (i) Known mutation of MTB katG/mabA gene
associated with isoniazid resistant NOT detected/(ii). Mutation, (e.g.,) S315T, of MTB katG gene associated with isonazid
resistance detected. (e) (i) Known mutation of MTB gyrA gene associated with ofloxacin resistant NOT detected/(ii).
Mutation, (e.g.,) G94D, of MTB gyrA gene associated with ofloxacin resistance detected. (f) No growth of AFB. (g) Culture
positive for M. tuberculosis complex. (h) Culture positive for M. avium complex.

180 W.-C. Yam and K.-H.G. Siu

2.3. Identification 1. 10× PCR buffer (Applied Biosystems, Foster City, CA, USA):
of M. tuberculosis 100 mM Tris–HCl, pH 8.3, 500 mM KCl. Stored at −20°C.
Complex
2. 25 mM MgCl2 solution (Applied Biosystems). Stored at
2.3.1. Identification of −20°C.
M. tuberculosis Complex by
Single Tube Nested IS6110 3. 100 mM dGTP, 100 mM dATP, 100 mM dUTP, and 100 mM
Polymerase Chain Reaction dCTP (Fermentas, Burlington, Ontario, Canada). Stored at
−20°C.

4. Primers chosen from the insertion sequence, IS6110. External
primers were derived from position 367 to 392 and positions
746 to 769, and internal primers were derived from posi-
tions 455 to 472 and positions 670 to 652 (see Table 1).
Stored at −20°C.

5. AmpliTaq Gold DNA Polymerase (Applied Biosystems), con-
centration 5 U/mL. Store at −20°C.

6. Uracil-DNA-glycosylase 5 U/mL (UNG) (Roche). Keep at
−20°C.

7. 1× Tris–Borate–EDTA solution: Keep at room temperature.

8. 6× Sample Loading Dye (Fermentas). Store at −20°C.

9. Molecular size marker. GeneRuler 100 bp DNA Ladder plus
(Fermentas). Keep at −20°C.

10. Ethidium bromide solution, 0.5 mg/mL. Add 1 drops of
10 mg/mL ethidium bromide solution to 1 L water. Store at
room temperature.

2.3.2. Identification of This kit consists of a COBAS® TaqMan® MTB Master Mix (MTB
M. tuberculosis Complex by MMX), a Mycobacterium Magnesium Reagent (MYCO Mg2+), a
the COBAS® TaqMan® MTB Mycobacterium internal control (MYCO IC), a M. tuberculosis low
Test (Roche Diagnostics) positive control (MTB (+)C), and a Mycobacterium Negative
Control (MYCO (−)C).

2.4. DNA Concentration The kit consists of a Buffer PB, a Buffer PE, and a Buffer EB. All
and Purification by reagents are stored at room temperature.
QIAquick PCR
Purification Kit (Qiagen, 1. Buffer PB
Venlo, Netherlands) 2. Buffer PE
3. Buffer EB

2.5. Detection 1. 10× PCR buffer (Applied Biosystems): 100 mM Tris–HCl, pH
of Drug-Resistant 8.3, 500 mM KCl. Stored at −20°C.
M. tuberculosis in
Respiratory Specimen 2. 25mM MgCl2 solution (Applied Biosystems). Stored at
−20°C.

3. 10 mM dNTP Mixes (Fermentas). Stored at −20°C.

4. PCR and sequencing primer.

(a) PCR and sequencing primers for RIF-resistant M. tuberculosis
detection: forward Primer TR8x, reverse primer TR9x cho-

Table 1 12 Rapid Identification of Mycobacteria and Rapid Detection of Drug Resistance…
Primers used for molecular diagnosis of mycobacteria

Primer name Type Temperatures (°C) Sequence References
IS6110 PCR
External forward primer PCR 74 (7, 10, 11)
External reverse primer PCR 76 5¢-CCGGCCAGCACGCTAATTAACGGTTC-3¢
Internal forward primer PCR 56 5¢-TGTGGCCGGATCAGCGATCGTGGT-3¢
Internal reverse primer PCR 58 5¢-CTGCACACAGCTGACCGA-3¢
rpoB PCR 5¢-CGTTCGACGGTGCATCTG-3¢
TR8x PCR and sequencing 78
TR9x PCR and sequencing 87 (14, 15)
katG315 MAS-PCR 5¢-TCGCCGCGATCAAGGAGTTCTTCGGC-3¢
PCR 71 5¢-TGCACGTCGCGGACCTCCAGCCCGGCAC-3¢
katG315_0Fx PCR 68
katg315_5Rx PCR 70 (21, 22),
katG315_4Rx this chapter
mabA MAS-PCR PCR 70
PCR 66 5¢-GCAGATGGGGCTGATCTACGTGAACC-3¢
MabA-115Fx PCR 70 5¢-TCCATACGACCTCGATGCCGC-3¢
MabA + 4Rx 5¢-AACGGGTCCGGGATGGTGCC-3¢
MabA + 366Rx
(21, 22),
this chapter

5¢-ACAAACGTCACGAGCGTAACCCCAG-3¢
5¢-GCAGTCACCCCGACAHCCTATCG-3¢¢
5¢-GAGGTTGGCGTTGATGACCTTCTCG-3¢

181

Table 1 (continued) Type Temperatures (°C) Sequence References 182 W.-C. Yam and K.-H.G. Siu
(25)
Primer name (29, 31)

GyrA PCR (31)

GyrA1 PCR and sequencing 55 5¢-CAGCTACATCGACTATGCGA-3¢
55 5¢-GGGCTICGGTGTACCTCAT-3¢
GyrA2 PCR and sequencing
65 5¢-GGACCTCAAGACGCATGTCTTCTG-3¢
M. aviumcomplex specific-PCR 64 5¢-GGACCTTTAGGCGCATGTCTTTAG-3¢
67 5¢-GCTCTTTACGCCCAGTAATTCCGG-3¢
MAC1 (M. avium-specific PCR
forward primer) 56 5¢-GAGAGTTTGATCCTGGCTCAG-3¢
65 5¢-TGCACACAGGCCACAAGGGA-3¢
MAC2 (M. intracellulare-specific PCR 61 5¢-TTTCACGAACAACGCGACAA-3¢
forward primer)

MACR (common reverse primer) PCR

16S rRNA gene sequencing

Broad-range primer-285 PCR & sequencing

The mycobacteria-specific primer- PCR
264

Sequencing-specific primer-259 Sequencing

12 Rapid Identification of Mycobacteria and Rapid Detection of Drug Resistance… 183

sen from rpoB gene sequence, region 759807–763325 under
accession no. NC_000962 (see Table 1). Stored at −20°C.

(b) KatG MAS-PCR primers for INH-resistant M. tuberculosis
detection: Outer forward primer katG315_0Fx, inner
reverse primer katg315_5Rx, outer reverse primer
katG315_4Rx chosen from katG gene sequence, region
2153889–2156111 under accession no. NC_000962 (see
Table 1). Stored at −20°C.

(c) MabA MAS-PCR primers for INH-resistant M. tuberculosis
detection: Outer forward primer MabA-115Fx, inner reverse
primer MabA+4Rx, outer reverse primer MabA+366Rx
chosen from region 1673325 to 1673778 under accession
no. NC_000962 (see Table 1). Stored at −20°C.

(d) PCR and sequencing primers for OFX-resistant M. tuber-
culosis detection: Forward primer GyrA1 and reverse primer
GyrA2 chosen from the reference gyrA sequence with
accession no. L27512 (see Table 1). Stored at −20°C.

(e) AmpliTaq Gold DNA Polymerase (5 U/mL) (Applied
Biosystems). Stored at −20°C.

(f) 1× Tris–Borate–EDTA solution: Dilute 10× Tris–Borate–
EDTA solution (Bio-rad, Hercules, CA, USA) tenfold in
mQH2O for working solution 1× TBE. Keep at room
temperature.

(g) 6× Sample Loading Dye (Fermentas). Keep at −20°C.

(h) Molecular size marker. GeneRuler 100 bp DNA Ladder
plus (Fermentas). Keep at −20°C.

(i) Ethidium bromide solution, 0.5 mg/mL. Store at room
temperature: Add 1 drop of 10 mg/mL Ethidium bro-
mide solution to 1 L water.

(j) BigDye® Terminator v 1.1 Mix (Applied Biosystems).
Stored at −20°C.

(k) BigDye® Terminator v3.1, v1.1 Sequencing Buffer (5×).
(Applied Biosystems). Stored at 4°C.

(l) DyeEx™ 2.0 Spin Kit (Qiagen, Venlo, Netherlands).
Stored at room temperature.

(m) Hi-Di™ Formamide. (Applied Biosystems). Stored at −20°C.

2.6. Genotypic 1. 10× PCR buffer (Applied Biosystems): 100 mM Tris–HCl, pH
Identification of 8.3, 500 mM KCl. Stored at −20°C.
Non-tuberculous
Mycobacteria from 2. 25 mM MgCl2 solution (Applied Biosystems). Stored at −20°C.
Culture 3. 10 mM dNTP mix (Fermentas). Stored at −20°C.

2.6.1. In-House PCR 4. PCR primers for M. avium complex identification: M. avium-
for M. avium Complex specific forward primer MAC1 chosen from M. avium 16S
Identification rDNA, region 1487542–1489058 under accession no.
NC_008595, M. intracellulare-specific forward primer MAC2

184 W.-C. Yam and K.-H.G. Siu

chosen from M. intracellulare 16S rRNA, region 53942–
55231 under accession no. ABIN01000139, and common
reverse primer MACR chosen from the conserved region of
both 16S rDNA gene (see Table 1).

5. AmpliTaq Gold DNA Polymerase 5 U/mL (Applied Biosystems.
GeneRuler 100 bp DNA Ladder plus (keep at −20°C.

6. Ethidium bromide solution (0.5 mg/m). Store at room tem-
perature: add ~100 mL of 10 mg/mL ethidium bromide solu-
tion to 1 L water.

2.6.2. 16S rDNA PCR 1. 10× PCR buffer (Applied Biosystem): 100 mM Tris–HCl, pH
Sequencing for Identification 8.3, 500 mM KCl. Stored at −20°C.
of Mycobacteria
2. 25mM MgCl2 solution (Applied Biosystem). Stored at −20°C.
3. 10mM dNTP mix (Fermentas). Stored at −20°C.

4. The broad-range primer 285 and the mycobacteria-specific
primer 264 were used for amplification, corresponding to
E. coli 16S rDNA positions 9–30 and 1,027–1,046, respec-
tively. Primer 285 and reverse primer 259 corresponding to
E. coli 16S rDNA position 590–609 were used as the sequenc-
ing primers (see Table 1).

5. AmpliTaq Gold DNA Polymerase 5 U/mL (Applied Biosystems)
Stored at −20°C.

6. 1× Tris–Borate–EDTA solution, store at room temperature.

7. 6× Sample Loading Dye (Fermentas). Keep at −20°C.

8. Molecular size marker. GeneRuler 100 bp DNA Ladder plus
(Fermentas). Keep at −20°C.

9. Ethidium bromide solution, 0.5 mg/mL. Store at room tem-
perature. Add 1 drop of 10 mg/mL ethidium bromide solu-
tion to 1 L water.

10. BigDye® Terminator v 1.1 Mix (Applied Biosystems). Stored
at −20°C.

11. BigDye® Terminator v3.1, v1.1 Sequencing Buffer (5×).
(Applied Biosystems). Stored at 4°C.

12. DyeEx™ 2.0 Spin Kit (Qiagen, Venlo, Netherlands). Stored at
room temperature.

13. Hi-Di™ Formamide. (Applied Biosystem). Stored at −20°C.

3. Methods 1. Equal parts (usually 3–5 mL) of a 4% NaOH–sputasol mixture
are added to a respiratory specimen. The mixture is then mixed
3.1. Specimen well by shaking.
Decontamination by
Sputasol-Sodium
Hydroxide

12 Rapid Identification of Mycobacteria and Rapid Detection of Drug Resistance… 185

2. The mixture is kept for 30 min at room temperature during
which time the bottle is agitated every 10 min on a mechanical
mixer (see Note 1).

3. The mixture is then topped up with 0.067 M sodium phos-
phate buffer, pH5.3, to a final volume around 20 mL, and
then it is centrifuged at 3,000 × g for 30 min.

4. The supernatant is decanted and the sediment is resuspended
in 0.5 mL 0.067 M sodium phosphate buffer, pH5.3. 200 mL
of the sediment is transferred to a 1.5 mL microtube and stored
at 20°C before DNA extraction.

3.2. DNA Extraction by 1. The digested specimen (approx. 200 mL) is thawed at room
In-House Alkaline Lysis temperature and is spun at 18,600 × g in a microcentrifuge for
Method (for All Purpose 10 min. The supernatant is then decanted and discarded.
Except COBAS®
TaqMan® MTB Test) or 2. The sediment is washed with 500 mL in-house wash buffer or
by Roche AMPLICOR® RW buffer and is vortexed to mix.
Respiratory Specimen
Preparation Kit (for all 3. The mixture is then spun at 18,600 × g in a microcentrifuge for
Purpose) (see Note 2) 10 min. The supernatant is then decanted.

4. 100 mL in-house lysis solution or RL buffer is added to the
sediment and the mixture is vortexed thoroughly.

5. The tube is incubated at 60°C for 45 min in dry heat block and
is then briefly centrifuged to remove the droplets on the lid.

6. 100 mL in-house neutralization solution or RN buffer is added
and vortexed briefly.

7. The mixture is centrifuged at 18,600 × g in a microcentrifuge
for 10 min. The supernatant containing mycobacterial DNA is
transferred to a new microtube (see Note 3).

3.3. Identification of 1. For each PCR reaction, a volume of 90 mL reaction mixture is
M. tuberculosis Complex firstly prepared. It consists of 1× PCR buffer (10 mM Tris–HCl
(pH 8.3), 50 mM KCl), 2 mM MgCl2, 0.15 mM dATP, dGTP,
3.3.1. Identification of dCTP, and 0.45 mM dUTP (see Note 5), 0.02 mM external
M. tuberculosis Complex primers, 0.75 mM internal primers (see Table 1), 2 U AmpliTaq
by Single Tube Nested Gold, and 0.5 U Uracil-DNA-glycosylase.
IS6110 Polymerase Chain
Reaction (see Note 4) 2. A volume of 10 mL extracted DNA specimens weak and strong
positive controls or negative control rewarmed to room tem-
perature are added to the 90 mL of reaction mixture.

3. The PCR reaction mixture is transferred to the PCR machine
(GeneAmp® PCR system 9700) and the reaction cycle is set as
follow: a single cycle of 37°C for 10 min, followed by 94°C for
12 min. The temp-cycling condition consists of 94°C for 45 s
and 72°C for 1.5 min for the first 15 cycles, then 94°C for
45 s, 55°C for 45 s, and 72°C for 1 min for 45 cycles. This is
followed by 72°C for 10 min. and the reaction products stored
at 4°C (see Note 6).

186 W.-C. Yam and K.-H.G. Siu

3.3.2. Identification of 4. After completion of the PCR reaction, the PCR product is
M. tuberculosis Complex pulse spun. A 10 mL portion of the PCR product is electro-
by the COBAS® TaqMan® phoresed through a 2% agarose gel in TBE buffer.
MTB Test
5. The gel is stained with ethidium bromide for 15 min with mild
shaking and the size of any bands determined by comparison
with to the standard molecular size marker A positive result is
indicated by the presence of target bands of 216 bp and/or
315/304 bp under UV illumination. For negative result, no
target bands are observed (see Fig. 1b and Note 7).

The test is performed according to manufacturer’s instruction. In
brief:

1. The working controls, MTB (+) C and MYCO (−) C, are pre-
pared as follow: 50 mL of each of the controls are transferred
into a 1.5 mL microtube, respectively. 200 mL of RL are added
to each controls and is vortexed to mix. 100 mL of each mix-
ture is transferred to new 1.5 mL microtubes, respectively, fol-
lowed by incubation at 60°C in a dry heat block for 45 min.
The tubes are pulse spun to remove condensate from cap.
100 mL of RN is added and vortexed briefly to mix. Once
opened, the working MTB (+) C and MYCO (−) C solutions
should be used within 4 weeks or until expiration date, which-
ever comes first.

2. The working reaction mixture is prepared as follow: the MTB
MMX, MYCO Mg2+, and MYCO IC (see Note 8) are equili-
brated at ambient temperature for at least 30 min. K-carrier is
placed in a K-carrier holder and new K-tubes are placed in the
K-carrier without touching the sides of the K-tubes. For 12
tests, 200 mL of MYCO Mg2+ and 50 mL MYCO IC are added
into one vial MTB MMX. (By proportion, for 1 test added,
add 16.7 mL of MYCO Mg2+, 4.2 mL MYCO IC, and 38.3 mL
MTB MMX) (see Note 9). The vial is capped and mixed well
by inverting ten times. 50 mL of working MMX is transferred
into each K-tube.

3. 50 mL of extracted specimen or controls are added to the
appropriate K-tube containing working MMX using a micropi-
pettor with an aerosol barrier. Each specimen or controls are
gently mixed up and down three times with the micropipettor
without generating bubbles. The reaction mixtures are now
ready to load.

4. The COBAS® TaqMan® 48 Analyzer is loaded and operated
according to the manufacturer’s guidance: The workstation
computer and the COBAS® TaqMan® 48 Analyzer should be
turned on at least 30 min prior to starting the run. Quality
Control information, K-carrier ID, Batch, and sample ID are
entered into the analyzer prior to sample loading. The cover

12 Rapid Identification of Mycobacteria and Rapid Detection of Drug Resistance… 187

Fig. 5. (a) COBAS® TaqMan® MTB test result table. Sample positive with M. tuberculosis DNA was showed as “1 positive”;
whereas sample negative for M. tuberculosis DNA was showed as “Target Not Detected.” Samples were valid if no flags
are present. (b) Amplification curve showing the fluorescent intensity against PCR cycles for the Internal control (Square)
and a positive target (rhombus). (c) Amplification curve showing the fluorescent intensity against PCR cycles for the Internal
control (Square) and a negative target (rhombus).

of the thermal cycler is opened when all the information is
entered. The loaded K-carrier containing the capped K-tubes
with working Master Mix and specimens and controls is
transferred into the Thermal Cycler. The reaction is then
started. Amplification and detection are automatically per-
formed by the COBAS® Taq Man® 48 Analyzer and are com-
plete in about 2.5 h.

5. After the run, the results window or printout must be checked
for “flags” and comments to ensure that the run is valid. The
run is valid if no flags appear for the COBAS® TaqMan® MTB
controls. The run is not valid if flags appear for the COBAS® Taq
Man® MTB Controls. When the run is invalid, the entire run
including specimen and control preparation must be repeated
for amplification and detection. For a valid run, check each indi-
vidual specimen for flags or comments on the result printout.
A valid run may include both valid and invalid specimen results
depending on whether flags and/or comments are obtained for
the individual specimens (see Fig. 5 and Note 10).

3.4. DNA Concentration 1. 100 mL of DNA sample extracted by in-house alkaline lysis
and Purification by method or by Roche AMPLICOR® Respiratory Specimen
QIAquick PCR Preparation Kit is transferred to a 1.5 mL microtube.
Purification Kit (see
Note 11) 2. 5 volumes (500 mL) of PB solution are added to 1 volume
(100 mL) of DNA extract and mixed well.

188 W.-C. Yam and K.-H.G. Siu

3. The mixture is applied to the QIAquick column and centrifuged
for 1 min at 16,000 × g.

4. Flow-through is discarded and the column is placed to the new
tube.

5. 750 mL Buffer PE is added to column and is centrifuged for
1 min at 16,000 × g.

6. Flow-through is discarded and the column is placed to a new
collection tube.

7. The column is centrifuged for an additional 1 min at 16,000 × g.
The collection tube is discarded. The column is placed in a
clean 1.5 mL microtube.

8. The cap of the column is opened for 2 min to allow evapora-
tion of residual ethanol.

9. 30 mL Buffer EB is added to the center of the column.

10. The column is left to stand for 5 min and is then centrifuged
for 1 min at 16,000 × g.

11. The flow-through is the purified DNA extract which is used in
the drug-resistance detection assay.

3.5. Detection of drug 1. For each PCR reaction, a volume of 40 mL reaction mixture is
resistance firstly prepared. It consists of 1× PCR buffer (10 mM Tris–HCl
in Mycobacterium (pH 8.3), 50 mM KCl), 1.25 mM MgCl2, 0.2 mM (each)
tuberculosis dNTP, 0.4 mM (each) primers, TR8x and TR9x (see Table 1
by molecular methods and Note 13), and 2 U AmpliTaq Gold.

3.5.1. Detection 2. A volume of 10 mL purified DNA extract is add to the 40 mL
of RIF-Resistant of reaction mixture.
M. tuberculosis by PCR
Sequencing (see Note 12) 3. PCR reaction mixture is transferred to the PCR machine
(GeneAmp® PCR system 9700) and the reaction cycle is set as
follow: a single cycle of 94°C for 12 min. The reaction mixture
is then subjected to 40 cycles of amplification (denaturation at
94°C for 1 min, and annealing and extension at 72°C for
2 min), followed by a final 7-min extension at 72°C and is
finally stored at 4°C.

4. After completion of the PCR reaction, the PCR product is
pulse spun. A 10 mL of PCR product is electrophoresed
through a 2% agarose gel in TBE buffer.

5. The gel is stained with ethidium bromide for 15 min with mild
shaking, a positive result is indicated by the presence of a target
band of 157-bp under UV illumination. For negative result,
no target bands are observed.

6. For positive sample, the remaining 40 mL PCR product is sub-
jected to purification by QIAquick PCR Purification kit prior
to sequencing. Five times volume (200 mL) of PB solution is
added to 1 volume (40 mL) of PCR product and mixed well.

12 Rapid Identification of Mycobacteria and Rapid Detection of Drug Resistance… 189

The product is then purified by following steps 3–11 in
Subheading 3.4.

7. Two cycle sequencing reactions, one forward and one reverse
reaction, are set up for each sample. A 20 mL sequencing mixture
should be freshly prepared. It consists of 1× sequencing buffer,
1/8× BigDye® Terminator v 1.1 Mix, (see Note 14), 0.16 mM
of TR8x or TR9x, and 3 mL of PCR product (see Note 15).

8. The PCR reaction mixture is transferred to the PCR machine
(GeneAmp® PCR system 9700) and the reaction setup as
follows. After a single cycle of heating to 96°C for 1 min, the
reaction mixture is then subjected to 25 cycles of amplification
(denaturation at 96°C for 10 s, and annealing at 50°C for 5 s
and extension at 60°C for 4 min) and is then stored at 4°C.

9. The sequencing product is then purified using Dye-Ex spin
column (referring to manufacturer protocol).

(a) The spin column is gently vortexed to resuspend the resin
and then the cap of the column is loosened by a quarter
turn.

(b) The bottom closure of the spin column is snapped off and
the column is placed in the collection tube.

(c) The column is centrifuged at 750 × g for 3 min. The col-
umn is then transferred to a clean microtube.

(d) A total of 20 mL of the sequencing product is transferred
to the gel bed of the column.

(e) The purified product is collected into the microtubes by
centrifuging at 750 × g for 3 min.

(f) All of purified product is added to 0.2-mL wells of a
96-well plate containing 15 mL Hi-Di™ formamide.

(g) The plate is heated at 95°C for 2–3 min to denature (do
not exceed 5 min). Hereafter, it is immediately placed in ice
block for 3 min. The product is now ready for sequencing.

10. The purified sequencing product is loaded to the Applied
Biosystems 3130 Genetic Analyzer according to manufactur-
er’s instruction.

11. The generated sequences are assembled using Pre Gap 4 soft-
ware, followed by editing using Gap v 4.10 software of the
Staden package, which is a free software downloaded from
http://staden.sourceforge.net/

12. After editing, the sequence is saved as a fasta file and is com-
pared with the reference rpoB sequence, region 76786 to
76942 under accession no. NC_000962 using an online pro-
gram clustalW (http://www.ebi.ac.uk/Tools/clustalw2/
index.html) (see Fig. 2b).

190 W.-C. Yam and K.-H.G. Siu

13. For samples harboring mutations, the regions of mutation and
the consequent amino acid substitutions should be reported
clearly, e.g., resistance-associated mutation Ser531Leu pres-
ent. For a sample without a known mutation, it should be
reported as “no known mutation found” (see Note 16).

3.5.2. Detection 1. For each KatG MAS-PCR reaction, a volume of 22.5 mL reac-
of INH-Resistant tion mixture is firstly prepared. It consists of 1× PCR buffer
M. tuberculosis by (10 mM Tris–HCl (pH 8.3), 50 mM KCl), 2 mM MgCl2,
MAS-PCR (see Note 12) 0.2 mM (each) dNTP, 0.6 mM outer forward primer katG0Fx,
0.8 mM outer reverse primer katG4Rx, 0.6 mM inner reverse
primer (see Table 1), (see Note 13), and 1.25 U of AmpliTaq
Gold Polymerase.

2. For each MabA MAS-PCR reaction, a volume of 22.5 mL reac-
tion mixture is firstly prepared. It consists of 1× PCR buffer
(10 mM Tris–HCl (pH 8.3), 50 mM KCl), 2 mM MgCl2,
0.2 mM (each) dNTP, 0.85 mM outer forward primer kat-
G0Fx, 0.17 mM outer reverse primer katG4Rx, 0.85 mM inner
reverse primer (see Table 1), and 1.25 U of AmpliTaq Gold
Polymerase.

3. A volume of 2.5 mL purified DNA extract is add to the 22.5 mL
of reaction mixtures of KatG MAS-PCR and MabA MAS PCR,
respectively.

4. PCR reaction mixtures are transferred to the PCR machine
(GeneAmp® PCR system 9700) and the reaction cycle is set as
follow: initial denaturation at 96°C for 8 min; 6 cycles at 95°C
for 1 min, 72°C for 1 min, 72°C for 30 s; 6 cycles at 95°C for
1 min, 70°C for 40 s, 72°C for 30 s; 25 cycles at 94°C for
1 min, 68°C for 30 s, 72°C for 30 s; followed by final elonga-
tion at 72°C for 7 min and is finally stored at 4°C.

5. After completion of the PCR reaction, the PCR product is
pulse spun and 10 mL of each PCR product is electrophoresed
through a 2% agarose gel in TBE buffer.

6. The gel is stained with ethidium bromide for 30 min with mild
shaking, the size of band measured and compared to the stan-
dard molecular size marker. For KatG MAS-PCR, wildtype
katG315 is indicated by the presence of target bands of 296-bp
with or without the band of 435-bp under UV illumination;
the mutated katG315 is indicated by a single band of 435-bp.
For MabA MAS-PCR, wildtype mabA-15 is indicated by the
target bands of 123-bp with or without the band of 454-bp;
the mutated mabA-15 is indicated by a single band of 454-bp
(see Note 16 and Fig. 6a, b).

3.5.3. Detection 1. For each PCR reaction, a volume of 45 mL reaction mixture is
of OFX-Resistant firstly prepared. It consists of 1× PCR buffer (10 mM Tris–HCl
M. tuberculosis by PCR (pH 8.3), 50 mM KCl), 1.5 mM MgCl2, 0.2 mM (each) dNTP,
Sequencing (see Note 12)

12 Rapid Identification of Mycobacteria and Rapid Detection of Drug Resistance… 191

Fig. 6. (a) Schematic diagrams of KatG315 MAS-PCR. (b) Schematic diagrams of MabA-15 MAS-PCR. (c) Results of
KatG315 MAS-PCR typing. M: 100-bp DNA ladder; lane 1–6, 9, 11, 13: sample with mutated katG315 allele; lane 7, 10, 12,
14, 15: samples with wildtype katG315 allele; lane 8: negative result on MAS-PCR. (d) Results of MabA-15 MAS-PCR typ-
ing. M: 100-bp DNA ladder; lane 6, 9, 11–14: sample with mutated MabA-15 allele; lane 1–5, 7, 8, 10, 15:: samples with
wildtype MabA-15 allele.

0.3 mM (each) primers, GyrA1 and GyrA2 (Table 1), and 1 U
AmpliTaq Gold.

2. A volume of 5 mL purified DNA extract is add to the 45 mL of
reaction mixture.

3. PCR reaction mixture is transferred to the PCR machine
(GeneAmp® PCR system 9700) and the reaction setup as fol-
lows: after a single cycle of heating to 94°C for 12 min, the reac-
tion mixture is then subjected to 45 cycles of amplification
(denaturation at 94°C for 1 min, and annealing at 55°C for 1 min
and extension at 72°C for 2 min), followed by a final 10-min
extension at 72°C and is then stored at 4°C (see Note 17).

4. After completion of the PCR reaction, the PCR product is
pulse spun and a 5 mL of PCR product electrophoresed through
a 2% agarose gel in TBE buffer.

5. The gel is stained with ethidium bromide for 15 min with mild
shaking. Compared to the standard molecular size marker
(GeneRuler 100 bp DNA Ladder Plus), a positive result is indi-
cated by the target bands of 320-bp under UV illumination.

6. For positive sample, the remaining 45 mL PCR product is sub-
jected to purification by QIAquick PCR Purification kit. 5 vol-
umes (225 mL) of PB solution are added to 1 volume (45 mL)

192 W.-C. Yam and K.-H.G. Siu

of PCR product and mixed well. The product is then purified
by following steps 3–11 in Subheading 3.4.

7. Two cycle sequencing reactions, one forward and one reverse
reaction, are set up for each sample. A 20 mL sequencing mix-
ture should be freshly prepared. It consists of 1× sequencing
buffer, 1/8× BigDye® Terminator v 1.1 Mix, 0.16 mM of
GyrA1 or GyrA2 and 3 mL of PCR product.

8. The sequencing reaction is then performed and purified accord-
ing to Subheading 3.5.1 steps 8–10.

9. The generated sequences are assembled using Pre Gap 4 soft-
ware, followed by editing using Gap v 4.10 software of the
staden package.

10. After editing, the sequence is saved as a fasta file and is com-
pared with the reference gyrA sequence with accession no.
L27512 in GenBank using an online program clustalW.

3.6. Genotypic 1. The colony on LJ medium is lightly touched and is suspended
Identification of in 500 mL in-house wash buffer.
Non-tuberculous
Mycobacteria from 2. The isolate DNA is then extracted by following steps 3–7 in
Culture Subheading 3.2.

3.6.1. DNA Extraction by
In-House Alkaline Lysis
Method for Cultured Isolate

3.6.2. In-House PCR 1. For each PCR reaction, a volume of 100 mL reaction mixture
for M. avium Complex is firstly prepared. It consists of 1× PCR buffer (10 mM Tris–
Identification HCl (pH 8.3), 50 mM KCl), 2 mM MgCl2, 0.2 mM (each)
dNTP, 0.4 mM (each) primers, MAC1, MAC2, and MACR
(see Table 1), and 2 U AmpliTaq Gold.

2. A volume of 10 mL purified DNA extract is add to the 90 mL
of reaction mixture.

3. PCR reaction mixture is transferred to the PCR machine
(GeneAmp® PCR system 9700) and after heating at 94°C for
10 min, the reaction mixture is then subjected to 50 cycles of
amplification (denaturation at 94°C for 1 min, annealing at
68°C for 1 min, and extension at 72°C for 1 min), followed by
a final 10-min extension at 72°C and is finally stored at 4°C.

4. After completion of the PCR reaction, the PCR product is
pulse spun and 10 mL of PCR product is electrophoresed
through a 2% agarose gel in TBE buffer.

5. The gel is stained with ethidium bromide for 15 min with mild
shaking. Compared to the standard molecular size marker
(GeneRuler 100 bp DNA Ladder Plus), a positive result is indi-
cated by the target bands of 390-bp under UV illumination. For
negative result, no target bands are observed (see Note 18).

12 Rapid Identification of Mycobacteria and Rapid Detection of Drug Resistance… 193

3.6.3. 16S rDNA PCR 1. For each PCR reaction, a volume of 45 mL reaction mixture is
Sequencing for Identification firstly prepared. It consists of 1× PCR buffer (10 mM Tris–HCl
of Mycobacteria (see Note 19) (pH 8.3), 50 mM KCl), 2 mM MgCl2, 0.2 mM (each) dNTP,
0.4 mM (each) primers, primer-285 and primer-264 (see
Table 1), and 2 U AmpliTaq Gold.

2. A volume of 5 mL purified DNA extract is added to the 45 mL
of reaction mixture.

3. The PCR reaction mixture is transferred to the thermal cycler
(GeneAmp® PCR system 9700) and the reaction setup as fol-
lows: After a single cycle of heating to 94°C for 10 min, the
reaction mixture is then subjected to 35 cycles of amplification
(denaturation at 94°C for 1 min, annealing at 65°C for 1 min,
and extension at 72°C for 2 min), followed by a final 10-min
extension at 72°C and is then stored at 4°C.

4. After completion of the PCR reaction, the PCR product is
pulse spun. A 5 mL of PCR product is electrophoresed through
a 2% agarose gel in TBE buffer.

5. The gel is stained with ethidium bromide for 15 min with mild
shaking. Compared to the standard molecular size marker
(GeneRuler 100 bp DNA Ladder Plus), a positive result is
indicated by the presence of a target band under UV illumina-
tion of about 1040-bp, depending on species.

6. If a positive result is obtained, the remaining 40 mL PCR prod-
uct is subjected to purification by QIAquick PCR Purification
kit. 5 volumes (200 mL) of PB solution are added to 1 volume
(40 mL) of PCR product and mixed well. The product is then
purified by following steps 3–11 in Subheading 3.4.

7. Two cycle sequencing reactions, one forward and one reverse
reaction, are set up for each sample. A 20 mL sequencing mix-
ture should be freshly prepared. It consists of 1× sequencing
buffer, 1/8× BigDye® Terminator v 1.1 Mix, 0.16 mM of
primer-285 or 16SrDNA sequencing primer-259 (see Table 1),
and 3 mL of PCR product.

8. The sequencing reaction is then performed and purified accord-
ing to Subheading 3.5.1 steps 8–10.

9. The generated sequences are assembled using PreGap 4 soft-
ware, followed by editing using Gap v 4.10 software of the
Staden package.

10. After editing, the sequence is saved as a fasta file and is searched
for sequence match in Ribosomal Differentiation of Medical
Microorganisms (RIDOM) (http://www.ridom-rdna.de/).

11. A sequence match of м 99% with that of the prototype strain
sequence in a repository should be used as the criterion for
species, group or complex level identification (see Note 20).