ประชุมกรรมการบริหารภาควิชาสัตวแพทยสาธารณสุข ครั้งที่ 1/2564

SAECHUE et al. Genes to Cells |     5

F I G U R E 3   RT-LAMP detection of (a) Uninfected CHIKV Uninfected CHIKV
CHIKV-infected IFNAR1-deficient mice
at 4 days postinfection. (a) Two microliters 1 2 3 4 5 6 7 8 9 10NCPC 1 2 3 4 5 6 7 8 9 10 NCPC
of serum from either uninfected mice or
CHIKV-infected mice was applied on the 10 min
RT-LAMP, incubated for the indicated
time and then visualized using GelGreen 20 min
fluorescence dye (left) and HNB (right).
(b) RNA extracted samples from the same 30 min
serum were analyzed by RT-PCR. (c) The
detection limit of the RT-LAMP system was 60 min
determined using a 10-fold serial dilution of
CHIKV with the serum viral titers indicated. (b) Uninfected CHIKV
Visual inspections using GelGreen
fluorescence dye (left) and HNB (right) are M 1 2 3 4 5 6 7 8 9 10 NC PC
shown. (d) Whole blood samples from either
uninfected mice or CHIKV-infected mice 300 bp
were mixed with the lysis buffer described
in Materials and Methods, and tested with (c) CHIKV CHIKV
the RT-LAMP system. Visual inspections PFU/tube 106 105104103102 101NS PC 106 105104103102 101NS PC
using GelGreen fluorescence dye (left) and
HNB (right) are shown. 1–5: uninfected 10 min
mice, 6–10: CHIKV-infected mice, NC:
negative control (RNase free water), PC: 20 min
positive control (1,000 PFU of CHIKV),
NS: negative serum control, M: DNA 30 min
marker
60 min

(d) Uninfected CHIKV Uninfected CHIKV

1 2 3 4 5 6 7 8 9 10 NCPC 1 2 3 4 5 6 7 8 9 10 NCPC

10 min

20 min

30 min

40 min

50 min

60 min

90 min

phase within 80 min, whereas the samples containing 40 and system was unable to detect CHIKV in the serum (data not
8 PFU of CHIKV did not enter the log phase of amplification shown), the liquid RT-LAMP system detected the viral ge-
(Figure 4b). nome in nine out of ten RNA samples (90%) within 20 min
of incubation. However, the system did not react with RNAs
Finally, the sensitivity of the dry RT-LAMP was verified prepared from healthy human serum (Figure 5a). In the case
using serum samples of CHIKV-infected mice. The results of the dry RT-LAMP system, six out of ten RNA samples
showed an initial positive reaction being observed at 30 min (60%) were detected in 20  min of incubation. Seven RNA
of incubation, whereas all others, with the exception of one samples (70%) showed a positive reaction at 30  min, and
sample, showed a positive reaction at 70 min of incubation by 60 min of incubation, nine RNA samples (90%) reacted
(Figure 4c). These results showed that the dry RT-LAMP sys- positively (Figure 5b). Nevertheless, both liquid and dry RT-
tem was able to correctly detect the CHIKV genome without LAMP systems have potential utility for on-site diagnosis of
a nonspecific reaction, although with less sensitivity than the CHIKV infection using purified RNA from human clinical
liquid RT-LAMP system. samples.

2.5  |  RT-LAMP with clinical samples 3  | DISCUSSION

To evaluate the RT-LAMP system as a screening kit, both CHIKV is a causative agent of Chikungunya fever, which
liquid and dry RT-LAMP systems were validated using is characterized by high fever and severe arthralgia.
CHIKV-infected patient samples. Although the RT-LAMP

|6       Genes to Cells SAECHUE et al.

(a) CHIKV NC CHIKV NC F I G U R E 4   The assessment of the dry
RT-LAMP system was performed based
PFU/tube Fluorescence (10–2) on (a) visual inspection and (b) real-time
50 min 12,4000000 monitoring as shown in Figure 1. (c) The
60 min 8 dry RT-LAMP system was assessed using
70 min 0 serum collected from uninfected mice or
80 min 0 CHIKV-infected IFNAR1-deficient mice
0 as shown in Figure 3. 1–5: uninfected mice
(b) 16 0 serum, 6–10: CHIKV-infected mice serum,
12,4000000 NC: negative control (RNase free water),
8 PC: positive control (1,000 PFU of CHIKV)
0
12 01,000 PFU/tube
0200 PFU/tube
040 PFU/tube
8 PFU/tube
8 0 PFU/tube
0 PFU/tube
0 PFU/tube NC

4 0 PFU/tube

0
0 10 20 30 40 50 60 70 80 90
Time (min)

(c) Uninfected CHIKV Uninfected CHIKV

1 2 3 4 5 6 7 8 9 10 NC PC 1 2 3 4 5 6 7 8 9 10 NC PC

10 min

30 min
40 min

60 min

70 min

Although a substantial number of infected patients remain previous reports regarding RT-LAMP methods for CHIKV
completely  asymptomatic, these patients can be a pub- detection (Lu et al., 2012; Parida et al., 2007), the reaction of
lic health concern as a potential source of transmission. RT-LAMP was monitored by turbidity using an expensive re-
Moreover, CHIKV and other arbovirus such as Zika virus, al-time turbidimeter. Goto et al. reported a colorimetric assay
dengue virus, and Ross River virus share the same vec- of the LAMP reaction using hydroxy naphthol blue (HNB),
tor species, geographical distribution, seasonal correlation which enables us to monitor gene amplification easily with
and clinical symptoms, which increases the difficulty of the naked eye. HNB is a metal ion indicator that can detect
species-specific diagnosis (Kraemer et  al.,  2015; Renault decreased Mg2+ concentration in accordance with the prog-
et  al.,  2007; Weaver & Reisen,  2010). Thus, it is neces- ress of the RT-LAMP reaction. For blood samples, however,
sary for public health laboratories to have access to an in- it is difficult to judge the positive or negative result of the
creased availability of proper diagnostic tests. Molecular LAMP reaction by the colorimetric assay because of the
PCR-based methods that detect pathogen-derived nucleic color of red blood cells (Figure 3d, right). The use of fluo-
acids are very sensitive and relatively rapid compared to rescent indicators such as SYBR Green and calcein has been
conventional culturing methods; however, PCR-based de- applied for the RT-LAMP reaction (Goto, Honda, Ogura,
tection of pathogens requires high skills, appropriate facili- Nomoto, & Hanaki, 2009; Parida et al., 2007). However, the
ties and expensive devices. assay using the intercalating dye such as SYBR Green is as-
sociated with an increased risk of contamination because the
The RT-LAMP system is a low-cost alternative diagnos- assay requires opening the tubes to add the dye to the reac-
tic tool, especially in resource-limited settings, because it tion after amplification. A metal ion indicator, calcein, can
does not require sophisticated equipment such as a thermo- be added to the prereaction solution of RT-LAMP; however,
cycler. It could be applied in the early diagnosis of CHIKV the brightness of calcein fluorescence is significantly weaker
infection because of its sensitivity, speed and simplicity. In

SAECHUE et al. Genes to Cells |     7

(a) Serum of CHIKV-infected patients GelGreen and HNB indicators instead of SYBR Green I.
1 2 3 4 5 6 7 8 9 10 NC PC Both their primer set and our primer set showed a highly sen-
sitive reaction with CHIKV in the Loopamp® kit; however,
10 min after an hour incubation, all negative controls began to show
false-positive reactions, probably due in part to a high con-
20 min centration of Mg2+ in the kit (data not shown). Accordingly,
the conditions of each reaction mixture must be customized
1 Serum of healthy donors 10 NC PC precisely for each pathogen.
60 min 2 3 45 67 8 9
More recently, related studies have been reported (Lopez-
(b) Serum of CHIKV-infected patients Jimena et al., 2018 and Hayashida et al., 2019). Thus, we
1 2 3 4 5 6 7 8 9 10 NC PC compared the sensitivity and specificity of our RT-LAMP
system to those of their systems. Hayashida et al. used the
10 min primer sequences that are identical to those used in the report
by Parida et al. Although their primer set seemed to show
20 min relatively higher sensitivity than our primer set in the LAMP
buffer we used, it showed the false positive at 60 min of incu-
30 min bation. However, our primer set did not show any false-pos-
itive reactions even after 120-min incubation. Lopez-Jimena
40 min et al. designed three distinct primer sets and all of them
were less sensitive than our primer set (data not shown).
60 min Accordingly, our primer set appears to be enough sensitive to
detect CHIKV without false-positive results.
F I G U R E 5   Extracted RNA from either CHIKV-infected patients
or healthy donor serum samples was evaluated by liquid RT-LAMP The development of the RT-LAMP system for on-site
system (a). The dry RT-LAMP system was assessed by using CHIKV- diagnosis requires a system effective enough to detect the
infected patients (b). Samples were incubated for the indicated time pathogen in clinical samples such as serum and blood. It is
and then visualized using GelGreen fluorescence dye. 1–10: extracted noteworthy that we evaluated our RT-LAMP system using
RNA, NC: negative control (RNase free water), PC: positive control blood samples from mice infected with CHIKV, in which the
(1,000 PFU of CHIKV) viral load was precisely controlled. When we used the serum
of CHIKV-infected IFNAR1-deficient mice, RT-LAMP was
than that of SYBR green fluorescence (Goto et  al.,  2009). able to detect the virus in the serum in just 30 min without
Furthermore, both fluorescent indicators are expensive for an additional RNA extraction step (Figure  3a). However, it
large-scale screening in CHIKV-endemic areas. To this end, took more time in the case of the blood samples (Figure 3d),
the development of a cost-effective diagnostic system based probably because of the blood samples being diluted 10
on RT-LAMP technology to detect CHIKV is desired. times with lysis buffer to inhibit coagulation and sup-
press biological inhibitors such as hemoglobin (Al-Soud &
In this study, we designed new LAMP primers targeting Radstrom,  2001). The sensitivity of the RT-LAMP system
the E1 region of CHIKV and used GelGreen and HNB as was 104 times lower in mice serum than in the viral culture.
fluorescent and colorimetric indicators, respectively. The Moreover, the RT-LAMP system failed to detect CHIKV in
RT-LAMP system clearly detected at least 8 PFU of CHIKV the serum from infected patients (data not shown) that re-
within 30  min by visual inspection, which was as great as quires an improvement in sensitivity of the system for biolog-
that of conventional CHIKV-specific RT-PCR. GelGreen is a ical samples. Hemoglobin and immunoglobulin G are known
cost-effective indicator, costing approximately one third the as PCR inhibitors in the blood; that is, hemoglobin directly
amount of SYBR Green or calcein, and can be added to the inhibits DNA polymerase activity and quenches the fluores-
prereaction solution of RT-LAMP like calcein. Moreover, cence of free dye molecules, and immunoglobulin G binds to
the fluorescence signal from GelGreen can be applied for single-strand genomic DNA leading to low amplification ef-
quantitative monitoring, if necessary, using a real-time PCR ficiency (Al-Soud & Radstrom, 2001; Sidstedt et al., 2018).
machine. A process for removing or suppressing these inhibitory fac-
tors might be necessary.
In a previous study, Parida et al. established the CHIKV
RT-LAMP method using a commercial based RT-LAMP, Another positive aspect of the development of the RT-
Loopamp® kit and SYBR Green I dye (Parida et al., 2007). LAMP system for on-site diagnosis is its portability in en-
To follow their study, we performed RT-LAMP under the demic areas. To make the RT-LAMP system less dependent
same conditions as Parida et al. used the Loopamp® kit with on a cold chain, we developed the dry RT-LAMP system
using trehalose as a potent protectant, which prevents the

|8       Genes to Cells SAECHUE et al.

enzyme from desiccation or freezing damage during the 4.3  |  Viral sample preparation
vitrification process of the reagents (Teramoto, Sachinvala,
& Shibata,  2008). Although the sensitivity of the dry RT- To determine the viral titer, plaque assays were performed as de-
LAMP system was lower than that of the liquid RT-LAMP scribed previously (Kamiyama et  al.,  2017). Briefly, confluent
system, the dry system was able to detect at least 200 PFU Vero cells in 12-well culture plates were infected with serial dilu-
of CHIKV in the culture supernatant as well as the virus in tions of each virus in 2% complete MEM. After 1-hr adsorption at
mouse serum at an 80% detection rate within 70 min, without 37°C, 2% methylcellulose (MP Biomedicals, Aurora, OH, USA)
a nonspecific reaction. Moreover, the system successfully de- was layered on the cells. Subsequently, cells were incubated for
tected viral RNA extracted from human clinical samples with 5 days at 37°C, 5% CO2 in a humidified environment, fixed in
a high detection rate (90%) (Figure 5). To improve the sensi- 10% formalin (FUJIFILM Wako Pure Chemical) and then stained
tivity of the dry system, a combination of different kinds of with 1.125% methylene blue (FUJIFILM Wako Pure Chemical)
saccharides for the vitrification process should be examined. to count the plaques and the plates were photographed.

We established a novel RT-LAMP system to detect the E1 IFNAR1-deficient mice were injected with 104 plaque
region of CHIKV, which accurately identifies the virus in a forming units (PFU) of CHIKV via subcutaneous injection.
cost-effective manner, without a cold chain. The system has The blood was collected from the mice at 4 days postinfec-
great potential to be applied for CHIKV diagnosis in endemic tion. 20 μl of whole blood samples were mixed with 180 μl
areas. of lysis buffer (0.1% Triton X-100 in RNase free water) for
the RT-LAMP assay. For the preparation of serum samples,
4  | EXPERIMENTAL whole blood was centrifuged at 13,000 g for 10 min and then
the supernatant was collected.
PROCEDURES
CHIKV-infected human samples and healthy human sam-
4.1  |  Virus and cells ples were collected at the Institute of Epidemiology, Disease
Control and Research (IEDCR), Dhaka, Bangladesh, and
Four strains of CHIKV (SL11131, SL10571, BaH306 Department of Gastroenterology, Faculty of Medicine, Oita
and S27), ZIKV strain PRVABC, DENV4, JEV and RRV University, Oita, Japan, respectively. CHIKV infection was
were kindly provided by Dr. Tomohiko Takasaki (National confirmed by conventional RT-PCR assay prior to RT-LAMP
Institute of Infectious Diseases). C6/36 cells (Aedes albop- assay. All experiments using human samples in this study
ictus) were maintained at 28°C in 5% CO2 in 10% com- were approved by the Ethics Committee of Oita University
plete MEM, which consisted of Eagle's MEM (Nissui, (approval no. 1691).
Tokyo, Japan) with 2  mM L-alanyl-glutamic acid (Gibco
GlutaMAX; Thermo Fisher Scientific, Waltham, MA, The genomic viral RNA was extracted from viral stock,
USA), 0.1  mM nonessential amino acids (Thermo Fisher blood and serum samples using a QuickGene RNA Tissue
Scientific), 0.15% sodium bicarbonate (Thermo Fisher Kit SⅡ (RT-S2; KURABO, Osaka, Japan) according to the
Scientific) and 10% FBS (Hyclone FBS; Thermo Fisher manufacturer's protocol. The RNA was eluted from the col-
Scientific). Vero cells (African Green Monkey Kidney umns at a final volume of 100 μl by elution buffer and was
Epithelial Cells) were maintained at 37°C in 5% CO2 in 10% stored at −80°C until being used for RT-PCR.
complete DMEM containing 55 µM 2-Mercaptoethanol
(Thermo Fisher Scientific), 100 U/mL Penicillin, 100 µg/ml 4.4  | RT-PCR
Streptomycin (Nacalai tesque, Kyoto, Japan) and 10% FBS.
CHIKV was subsequently propagated on either C6/36 cells RT-PCR was carried out using SuperScript III One-Step RT-
or Vero cells in 2% complete MEM. PCR System, Platinum Taq (Thermo Fisher Scientific) ac-
cording to the manufacturer's protocol. Reverse transcription
4.2  | Mice was performed for 30 min at 50°C and for 2 min at 94°C, fol-
lowed by PCR amplification with CHIKV E1-specific prim-
Male IFNAR1-deficient mice (Muller et  al.,  1994) aged ers (Lim et al., 2009) (Table 1). The amplification program
7–9 weeks were used throughout this study. Mice were kept was as follows: 35 cycles of 94°C for 30 s, 53°C for 30 s, and
in a biosafety level 3 (BSL-3) laboratory in the Division of 68°C for 1 min and a final extension step at 68°C for 2 min.
Laboratory Animal Science of Oita University (Oita, Japan).
All experiments using these mice were approved by and per- 4.5  | RT-LAMP
formed according to the guidelines of the Oita University
Animal Ethics Committee. The RT-LAMP primers were designed based on the se-
quences of the envelope protein 1 (E1) region of CHIKV

SAECHUE et al. Genes to Cells |     9

T A B L E 1   RT-LAMP and RT-PCR Primer Length Oligonucleotide sequence (5’ to 3’) Product
primers for Chikungunya virus (CHIKV) RT-LAMP (bp) size
CACACTGTGAGCGCGTAC
CHIKV-F3 18 GACGGTTTTGTATTCGCACG 300 bp
CHIKV-B3 20 AGCCCGGTCTGTTGACTAGAGTttttACACG
CHIKV-FIP 46 TAACAGTGATCCCGA
ACAGCCCCATGGTACTGGAGAttttTCAAGC
CHIKV-BIP 43 GATAGCGTTGGC
ACGGTACTCCCACCGTGT
CHIKV-FLP 18 GGAGCTACTGTCAGTCACTTTG
CHIKV-BLP 22
RT-PCR ACGCAATTGAGCGAAGCACAT
10294f 21 AAATTGTCCTGGTCTTCCTG
10573r 20

strain S27-African prototype (GenBank accession number For the primer dry-up step, 100 μM stocks of 6 primers
AF369024). A set of six RT-LAMP primers including two were prepared in RNase free water. Primer mixtures con-
inner primers (FIP and BIP), two outer primers (F3 and B3) sisting of 0.4  μl each of FIP and BIP, 0.05  μl each of F3
and two loop primers (FLP and BLP) were designed with and B3, and 0.2 μl each of FLP and BLP, 0.9 μl of 2 M tre-
PrimerExplorer V5 software (http://primer​explo​rer.jp/e/) halose, 0.14 μl of 50% glycerol (Nacalai tesque) and 0.5 μl
(Table 1). TTTT spacers were added to FIP and BIP. of indicator were mixed and placed into the bottom of the
microtube. The final primer concentrations of each primer
The RT-LAMP reaction was carried out in a total of 25 μl in the reaction were 1.6 μM (FIP and BIP), 0.2 μM (F3 and
reaction volume containing 2  μl of viral culture superna- B3) and 0.4 μM (FLP and BLP).
tant, 1 μl of 25X LAMP buffer (500 mM Tris-HCl [pH 8.8],
250 mM KCl and 25 mM MgSO4), 6 mM MgSO4 (final con- For the final dry-up step, the mixture was dried for 6 hr
centration 7 mM), 1.4 mM dNTPs (25 mM each; NIPPON under a flow of clean air. The tubes were further dried in
GENE CO., LTD.), eight units Bst DNA Polymerase (8  U/ a desiccator with phosphorus oxide and silica gel overnight
μl; NIPPON GENE CO., LTD.), four units RNase inhibitor under a vacuum until completely dried. After this step, the
(40 U/μl; Nacalai tesque), 0.6 units AMV reverse transcrip- tubes were placed in an aluminum bag with zeolite molecular
tase (20 U/μl; NIPPON GENE CO., LTD.), 0.2 M trehalose sieves, tightly sealed, and stored until use. The reaction tubes
(FUJIFILM Wako Pure Chemical), 1.6 μM each of FIP and were reconstituted with 25  μl of LAMP buffer containing
BIP, 0.2  μM each of F3 and B3, 0.4  μM each of FLP and viral template, 6  mM MgSO4 and 0.1% Triton X-100. The
BLP, 1 μl of indicators (3 mM hydroxynaphthol blue [HNB; reaction tubes were inverted several times under vigorous ag-
MP Biomedicals], 0.35% v/v GelGreen [10,000X in DMSO; itation until the dried reagents were completely reconstituted.
Biotium, Inc.]) and 0.1% Triton X-100 in DDW were added
to make a 25-μl reaction mix. The RT-LAMP reaction mix- 4.7  |  Monitoring of amplification by the RT-
ture was incubated at 59°C for 60 min.
LAMP
4.6  |  Drying RT-LAMP reagents procedure
For visual inspection, the amplified DNA was stained with
The procedure for drying RT-LAMP was described previ- GelGreen fluorescent dye and observed under a blue-green
ously (Hayashida, Kajino, Hachaambwa, Namangala, & (λ = 470 nm) LED light. The color of the CHIKV-positive
Sugimoto,  2015). Briefly, for the enzyme and dNTP dry- samples exhibited green-yellow fluorescence in accordance
up step, 1.6 μl of 2 M trehalose, 1.4 μl of dNTPs (25 mM with an RT-LAMP reaction. In addition, the color of the posi-
each), 0.05  μl of Bst DNA Polymerase (120  U/μl; New tive samples changed from violet to sky blue by HNB under
England Biolabs), 0.25  μl of Bst DNA Polymerase (8  U/ ambient light conditions.
μl), 0.1 μl of RNase inhibitor (40 U/μl), 0.04 μl of AMV
reverse transcriptase (20 U/μl) and 0.5 μl of indicator were The amplification in RT-LAMP reactions was monitored
mixed and placed in the center of a microtube cap (Watson at 59°C using a real-time PCR machine (LightCycler™96;
Bio Lab). Roche Diagnostics, Mannheim, Germany). Fluorescence sig-
nal of GelGreen was automatically recorded every 1 min for
90 min. After amplification by RT-LAMP, the final products

|10       Genes to Cells SAECHUE et al.

were analyzed by agarose gel electrophoresis on a 1% gel in Kamiyama, N., Soma, R., Hidano, S., Watanabe, K., Umekita, H.,
1X Tris acetate-EDTA buffer (0.04  M Tris acetate, 1  mM Fukuda, C., … Kobayashi, T. (2017). Ribavirin inhibits Zika virus
EDTA), stained with ethidium bromide and visualized on a (ZIKV) replication in vitro and suppresses viremia in ZIKV-infected
UV transilluminator at 302 nm. STAT1-deficient mice. Antiviral Research, 146, 1–11. https://doi.
org/10.1016/j.antiv​iral.2017.08.007
ACKNOWLEDGMENTS
Karabatsos, N. (1975). Antigenic relationships of group A arboviruses
We thank Ms. Chiharu Aoki and Ms. Yoko Kudo for their by plaque reduction neutralization testing. The American Journal
excellent secretarial assistance and the members of Dr. of Tropical Medicine and Hygiene, 24(3), 527–532. https://doi.
Kobayashi's laboratory for valuable discussions. This work org/10.4269/ajtmh.1975.24.527
was supported by Grants-in-Aid from the Japan Society
for the Promotion of Science (Grant numbers 17K08889, Khan, A. H., Morita, K., Parquet Md Mdel, C., Hasebe, F., Mathenge,
17H04649 [TK], 18K16155 [TO], 17K17104 [NK] and E. G., & Igarashi, A. (2002). Complete nucleotide sequence of chi-
17K15680 [SH]), Suzuken Memorial Foundation, Kurozumi kungunya virus and evidence for an internal polyadenylation site.
Medical Foundation and GSK Japan Research Grant 2016. Journal of General Virology, 83(Pt 12), 3075–3084. https://doi.
Lotte Foundation. org/10.1099/0022-1317-83-12-3075

CONFLICT OF INTEREST Kraemer, M. U. G., Sinka, M. E., Duda, K. A., Mylne, A. Q. N., Shearer,
The authors have no competing financial interests to declare. F. M., Barker, C. M., … Hay, S. I. (2015). The global distribution
of the arbovirus vectors Aedes aegypti and Ae. albopictus. Elife, 4,
ORCID e08347. https://doi.org/10.7554/eLife.08347

Takashi Kobayashi  https://orcid. Lim, C.-K., Kotaki, A., Nishibori, T., Ito, M., Watanabe, K., Tanaka,
org/0000-0002-9069-5736 K., … Takasaki, T. (2009). Chikungunya virus isolated from a
returnee to Japan from Sri Lanka: Isolation of two sub-strains
REFERENCES with different characteristics. The American Journal of Tropical
Medicine and Hygiene, 81(5), 865–868. https://doi.org/10.4269/
Al-Soud, W. A., & Radstrom, P. (2001). Purification and character- ajtmh.2009.09-0009
ization of PCR-inhibitory components in blood cells. Journal of
Clinical Microbiology, 39(2), 485–493. https://doi.org/10.1128/ Lopez-Jimena, B., Wehner, S., Harold, G., Bakheit, M., Frischmann,
JCM.39.2.485-493.2001 S., Bekaert, M., … Weidmann, M. (2018). Development of a sin-
gle-tube one-step RT-LAMP assay to detect the Chikungunya virus
Blackburn, N. K., Besselaar, T. G., & Gibson, G. (1995). Antigenic rela- genome. PLOS Neglected Tropical Diseases, 12(5), e0006448.
tionship between chikungunya virus strains and o'nyong nyong virus http://dx.doi.org/10.1371/journa​ l.pntd.0006448
using monoclonal antibodies. Research in Virology, 146(1), 69–73.
https://doi.org/10.1016/0923-2516(96)80591-​ 7 Lumsden, W. H. (1955). An epidemic of virus disease in Southern
Province, Tanganyika Territory, in 1952–53. II. General description
Fire, A., & Xu, S. Q. (1995). Rolling replication of short DNA cir- and epidemiology. Transactions of the Royal Society of Tropical
cles. Proceedings of the National Academy of Sciences, 92(10), Medicine and Hygiene, 49(1), 33–57.
4641–4645.
Mo, Z., Li, X., Shi, L., Shan, X., Zhao, H., Lu, X. I., … Jin, F.
Goto, M., Honda, E., Ogura, A., Nomoto, A., & Hanaki, K. (2009). (2012). Rapid identification of Chikungunya and Dengue virus
Colorimetric detection of loop-mediated isothermal amplification by a real-time reverse transcription-loop-mediated isother-
reaction by using hydroxy naphthol blue. BioTechniques, 46(3), mal amplification method. The American Journal of Tropical
167–172. https://doi.org/10.2144/00011​3072 Medicine and Hygiene, 87(5), 947–953. https://doi.org/10.4269/
ajtmh.2012.11-0721
Hasebe, F., Parquet, M. C., Pandey, B. D., Mathenge, E., Morita, K.,
Balasubramaniam, V., … Igarashi, A. (2002). Combined detection Mori, Y., Nagamine, K., Tomita, N., & Notomi, T. (2001). Detection
and genotyping of Chikungunya virus by a specific reverse tran- of loop-mediated isothermal amplification reaction by turbidity de-
scription-polymerase chain reaction. Journal of Medical Virology, rived from magnesium pyrophosphate formation. Biochemical and
67(3), 370–374. https://doi.org/10.1002/jmv.10085 Biophysical Research Communications, 289(1), 150–154. https://
doi.org/10.1006/bbrc.2001.5921
Hayashida, K., Kajino, K., Hachaambwa, L., Namangala, B., &
Sugimoto, C. (2015). Direct blood dry LAMP: A rapid, stable, Muller, U., Steinhoff, U., Reis, L. F., Hemmi, S., Pavlovic, J.,
and easy diagnostic tool for Human African Trypanosomiasis. Zinkernagel, R. M., & Aguet, M. (1994). Functional role of type
PLOS Neglected Tropical Diseases, 9(3), e0003578. https://doi. I and type II interferons in antiviral defense. Science, 264(5167),
org/10.1371/journ​al.pntd.0003578 1918–1921.

Hayashida, K., Orba, Y., Sequeira, P. C., Sugimoto, C., Hall, W. W., Nagamine, K., Hase, T., & Notomi, T. (2002). Accelerated reaction
Eshita, Y., … Sawa, H. (2019). Field diagnosis and genotyping of by loop-mediated isothermal amplification using loop prim-
chikungunya virus using a dried reverse transcription loop-mediated ers. Molecular and Cellular Probes, 16(3), 223–229. https://doi.
isothermal amplification (LAMP) assay and MinION sequencing. org/10.1006/mcpr.2002.0415
PLOS Neglected Tropical Diseases, 13(6), e0007480. http://dx.doi.
org/10.1371/journ​al.pntd.0007480 Nie, K., Qi, S.-X., Zhang, Y., Luo, L. E., Xie, Y., Yang, M.-J., … Ma,
X.-J. (2012). Evaluation of a direct reverse transcription loop-me-
diated isothermal amplification method without RNA extraction
for the detection of human enterovirus 71 subgenotype C4 in naso-
pharyngeal swab specimens. PLoS One, 7(12), e52486. https://doi.
org/10.1371/journ​al.pone.0052486

SAECHUE et al. Genes to Cells |     11

Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Schwartz, O., & Albert, M. L. (2010). Biology and pathogenesis of
Amino, N., & Hase, T. (2000). Loop-mediated isothermal amplifi- chikungunya virus. Nature Reviews Microbiology, 8(7), 491–500.
cation of DNA. Nucleic Acids Research, 28(12), E63. https://doi. https://doi.org/10.1038/nrmic​ro2368
org/10.1093/nar/28.12.e63
Sidstedt, M., Hedman, J., Romsos, E. L., Waitara, L., Wadsö, L., Steffen,
Nyan, D. C., Ulitzky, L. E., Cehan, N., Williamson, P., Winkelman, C. R., … Rådström, P. (2018). Inhibition mechanisms of hemoglo-
V., Rios, M., & Taylor, D. R. (2014). Rapid detection of hepatitis bin, immunoglobulin G, and whole blood in digital and real-time
B virus in blood plasma by a specific and sensitive loop-mediated PCR. Analytical and Bioanalytical Chemistry, 410(10), 2569–2583.
isothermal amplification assay. Clinical Infectious Diseases, 59(1), https://doi.org/10.1007/s0021​6-018-0931-z
16–23. https://doi.org/10.1093/cid/ciu210
Staples, J. E., Breiman, R. F., & Powers, A. M. (2009). Chikungunya fever:
Parida, M. M., Santhosh, S. R., Dash, P. K., Tripathi, N. K., Lakshmi, An epidemiological review of a re-emerging infectious disease. Clinical
V., Mamidi, N., … Morita, K. (2007). Rapid and real-time detec- Infectious Diseases, 49(6), 942–948. https://doi.org/10.1086/605496
tion of Chikungunya virus by reverse transcription loop-mediated
isothermal amplification assay. Journal of Clinical Microbiology, Telles, J. N., Le Roux, K., Grivard, P., Vernet, G., & Michault, A.
45(2), 351–357. https://doi.org/10.1128/JCM.01734-​06 (2009). Evaluation of real-time nucleic acid sequence-based am-
plification for detection of Chikungunya virus in clinical samples.
Piepenburg, O., Williams, C. H., Stemple, D. L., & Armes, N. A. (2006). Journal of Medical Microbiology, 58(Pt 9), 1168–1172. https://doi.
DNA detection using recombination proteins. PLOS Biology, 4(7), org/10.1099/jmm.0.010736​ -0
e204. https://doi.org/10.1371/journa​ l.pbio.0040204
Teramoto, N., Sachinvala, N. D., & Shibata, M. (2008). Trehalose and
Powers, A. M., Brault, A. C., Tesh, R. B., & Weaver, S. C. (2000). Re- trehalose-based polymers for environmentally benign, biocompati-
emergence of Chikungunya and O'nyong-nyong viruses: Evidence ble and bioactive materials. Molecules, 13(8), 1773–1816. https://
for distinct geographical lineages and distant evolutionary relation- doi.org/10.3390/molec​ules13​ 081773
ships. Journal of General Virology, 81(Pt 2), 471–479. https://doi.
org/10.1099/0022-1317-81-2-471 Vincent, M., Xu, Y., & Kong, H. (2004). Helicase-dependent isother-
mal DNA amplification. EMBO Reports, 5(8), 795–800. https://doi.
Renault, P., Solet, J. L., Sissoko, D., Balleydier, E., Larrieu, S., Filleul, org/10.1038/sj.embor.7400200
L., … Pierre, V. (2007). A major epidemic of chikungunya virus
infection on Reunion Island, France, 2005–2006. The American Weaver, S. C. (2006). Evolutionary influences in arboviral disease.
Journal of Tropical Medicine and Hygiene, 77(4), 727–731. Current Topics in Microbiology and Immunology, 299, 285–314.

Robinson, M. C. (1955). An epidemic of virus disease in Southern Weaver, S. C., & Reisen, W. K. (2010). Present and future arbo-
Province, Tanganyika Territory, in 1952–53. I. Clinical features. viral threats. Antiviral Research, 85(2), 328–345. https://doi.
Transactions of the Royal Society of Tropical Medicine and Hygiene, org/10.1016/j.antivi​ ral.2009.10.008
49(1), 28–32.
SUPPORTING INFORMATION
Ross, R. W. (1956). The Newala epidemic. III. The virus: Isolation,
pathogenic properties and relationship to the epidemic. The Journal Additional supporting information may be found online in
of Hygiene, 54(2), 177–191. the Supporting Information section.

Safavieh, M., Kanakasabapathy, M. K., Tarlan, F., Ahmed, M. U., Zourob, How to cite this article: Saechue B, Kamiyama N,
M., Asghar, W., & Shafiee, H. (2016). Emerging Loop-Mediated Wang Y, et al. Development of a portable reverse
Isothermal Amplification-Based Microchip and Microdevice transcription loop-mediated isothermal amplification
Technologies for Nucleic Acid Detection. ACS Biomaterials Science system to detect the E1 region of Chikungunya virus
& Engineering, 2(3), 278–294. https://doi.org/10.1021/acsbio​ mate​ in a cost-effective manner. Genes Cells.
rials.5b00449 2020;00:1–11. https://doi.org/10.1111/gtc.12797

Schuffenecker, I., Iteman, I., Michault, A., Murri, S., Frangeul, L.,
Vaney, M.-C., … Brisse, S. (2006). Genome microevolution of chi-
kungunya viruses causing the Indian Ocean outbreak. PLoS Med,
3(7), e263. https://doi.org/10.1371/journ​al.pmed.0030263

See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/316183526

Molecular detection of blood pathogens and their impacts on levels of packed
cell volume in stray dogs from Thailand

Article  in  Asian Pacific Journal of Tropical Disease · April 2017 READS

DOI: 10.12980/apjtd.7.2017D6-370 342

CITATIONS

4

1 author:

Supawadee Piratae
Mahasarakham University
28 PUBLICATIONS   306 CITATIONS   

SEE PROFILE

Some of the authors of this publication are also working on these related projects:
Situation and Cercarial Infection of Freshwater Mollusk from Sirindhorn Reservoir, Ubon Ratchathani Province, Thailand View project

All content following this page was uploaded by Supawadee Piratae on 18 April 2017.
The user has requested enhancement of the downloaded file.

Asian Pac J Trop Dis 2017; 7(4): 233-236 233

Asian Pacific Journal of Tropical Disease

journal homepage: http://www.apjtcm.com

Pathogens research https://doi.org/10.12980/apjtd.7.2017D6-370 ©2017 by the Asian Pacific Journal of Tropical Disease. All rights reserved.

Molecular detection of blood pathogens and their impacts on levels of packed cell volume in stray dogs
from Thailand

Supawadee Piratae*, Benjawan Sae-chue, Pratch Sukumolanan, Aphinan Phosri
Faculty of Veterinary Sciences, Mahasarakham University, Mahasarakham 44000, Thailand

ARTICLE INFO ABSTRACT

Article history: Objective: To evaluate the prevalence of blood parasite infection in stray dogs by PCR
Received 12 Oct 2016 technique and the association between levels of packed cell volume (PCV) and blood parasitic
Received in revised form 24 Oct, 2nd infection in stray dogs.
revised form 25 Oct 2016 Methods: A total of 65 blood samples were collected from stray dogs in animal quarantine
Accepted 15 Nov 2016 station from Mahasarakham, Thailand to evaluate the levels of PCV before molecular screening
Available online 10 Apr 2017 for tick-borne pathogens infection.
Results: Stray dogs were positive with one or more pathogens in 44 (67.69%) out of 65 blood
Keywords: samples. Ehrlichia canis [43.1%, 95% confidence interval (CI): 38.1–48.1] was the most
Stray dogs common blood pathogen found infecting in stray dogs in Mahasarakham Province, followed by
Blood pathogens Anaplasma platys (29.2%, 95% CI: 24.2–34.2), Hepatozoon canis (12.3%, 95% CI: 7.3–17.3)
Packed cell volume and Babesia canis vogeli (6.2%, 95% CI: 1.2–11.2), respectively. Moreover, co-infections with
Thailand two pathogens were identified in 11 (16.9%) of dogs examined and two (2.9%) dogs were co-
infections with three pathogens. Statistically significant relationship between the PCV levels
and Ehrlichia canis infection was found (P < 0.05).
Conclusions: This study indicated that blood pathogens are spreading in stray dogs and they
are potentially high risk of agent transmission to human via exposure with tick vectors. It was
also the first report of Anaplasma platys infection in dogs in north-eastern part of Thailand.

1. Introduction E. canis) or ingestion of infected ticks (H. canis)[6]. Infections of
these pathogens range in their effects from asymptomatic to severe
Canine tick-borne pathogens are recognized by the cause of illness. The compatibility of clinical signs includes fever, anorexia,
morbidity and mortality in infected wild and domestic dogs lymphadenomegaly, pale mucous membranes, lethargy, scleral
and prevalent as zoonotic agents in human[1,2]. The brown dog injection, anemia, weight loss, icterus and thrombocytopenia[7-9].
tick, Rhipicephalus sanguineus which is worldwide distribution
particularly in the tropical and subtropical countries, serves as the Several studies reported tick-borne diseases in dogs in Thailand
vector[3]. The significant blood pathogens related to Rhipicephalus and suggested that dogs were normally infected due to distribution
sanguineus described for dogs in Thailand and neighboring of tick vectors. However, tick-borne diseases in human have
countries are Babesia canis vogeli (B. canis vogeli), Hepatozoon increased[10,11] and should be concerned in this endemic region.
canis (H. canis), Anaplasma platys (A. platys) and Ehrlichia canis Epidemiological data on prevalence of tick-borne diseases are not
(E. canis)[4,5]. Dogs who play the role as the reservoir, are infected adequate, so studies of distribution and density of dog infections
principally by biting of infected ticks (B. canis vogeli, A. platys and are necessary. Recently, routine diagnosis of canine blood parasitic
infections can be defined based on the evidence of health status,
*Corresponding author: Supawadee Piratae, Faculty of Veterinary Sciences, clinical signs, serology and complete blood count or a platelet
Mahasarakham University, Mahasarakham 44000, Thailand. count, but most infected hosts are sub-clinical and non-specific
signs. Moreover, laboratory diagnostic findings may include trend
Tel: +66840306880 of low packed cell volume (PCV). We hypothesized that infected
E-mail: [email protected] dogs may have a trend of PCV values lower than those of the non-
All experimental procedures involving animals were conducted in accordance infected. This study aims to evaluate the prevalence of blood
to Animals for Scientific Purpose Act B.E. 2558 (A.D. 2015) (U1-01509-2558) parasite infection in stray dogs by PCR technique and the association
and approved by the institutional Animal Care and Use Committee, Mahasarakham between levels of PCV and blood parasitic infection in stray dogs.
University (0009/2017).

Foundation Project: Supported by Faculty of Veterinary Sciences of
Mahasarakham University (Grant of Veterinary Sciences Research Project 2015).

The journal implements double-blind peer review practiced by specially invited
international editorial board members.

234 Supawadee Piratae et al./Asian Pac J Trop Dis 2017; 7(4): 233-236

2. Materials and methods H. canis, A. platys and E. canis were selected based on previously
description[12-17] (Table 1). The PCR reactions contained 10–50 ng
2.1. Blood collection and measurement of PCV of extracting DNA, 10 pmol of each primer, 200 µmol/L of each
dNTPs, 1.5 mmol/L of MgCl2 and 1 U Taq polymerase (Vivantis,
This cross-sectional study collected 65 blood samples from Selangor Darul Ehsan, Malaysia). The PCR protocols were done
Mahasarakham animal quarantine station, Thailand (16°25'50" N, with 35 cycles of denaturation at 95 °C for 1 min, annealing at 55
103°3'36.4" E) on 25–27th February, 2015. Blood was collected °C for B. canis vogeli, 57 °C for H. canis, 60 °C and 62 °C for first
approximately 3 mL from the cephalic vein into sterile tubes with and second steps of A. platys and 60 °C for both 2 steps of E. canis
anticoagulant (ethylene diamine tetraacetic acid) and kept on ice for 1 min, extension at 72 °C for 2 min and a final extension at 72
during transport to the laboratory. For long term preservation, blood °C for 5 min. PCR amplification was performed using Biometra
was stored at –20 °C until DNA extraction. All steps for animal GmbH thermocycle (Germany). PCR products were identified by
handles and blood collections were conducted by veterinarians. 1% agarose gels stained with ethidium bromide and visualized under
Levels of the PCV was evaluated by filling blood directly into 2/3 ultraviolet light.
of the heparinized microhematocrit tube. The tube was placed into
a calibrated microhematocrit centrifuge and spined at 10 000 r/min 2.3. Statistic analysis
for 5 min. The height of the total blood column and the height of the
red cell layer were measured within a minute after the centrifuge has The association between level of PCV and blood parasite infections
stopped. The PCV levels were classified into four groups according was compared with Pearson’s Chi-squared test. The prevalence (%)
to PCV (%) severity: level 1 was normal group (PCV ≥ 37%), level and 95% confidence intervals (CI) were calculated.
2 was mild anemia group (PCV = 30%–37%), level 3 was moderate
anemia group (PCV = 20%–29%) and level 4 was severe anemia 3. Results
group (PCV ≤ 20%).
3.1 Detection of B. canis vogeli, H. canis, E. canis and A.
2.2. DNA extraction and amplification of tick-borne pathogens platys in stray dogs from Mahasarakham animal quarantine
station, Thailand
Total DNA was extracted from blood samples using GF-1
blood DNA extraction kit (Vivantis, Selangor Ehsan, Malaysia). A total of 65 stray dogs samples collected from the animal
Concentrations of total DNA were determined by exposing the quarantine station, Mahasarakham included 32 (49.2%) males and
DNA to ultraviolet light at a wavelength of 260 nm with UV-vis 33 (58.8%) females. Blood parasitic detection showed 44 (67.7%)
spectrophotometer (Mecasys, Korea). B. canis vogeli and H. canis samples were positive for at least one species of blood pathogens.
18S rRNA gene were amplified by single PCR. E. canis and A. platys Overall 31 (47.7%) were single infection, and 11 (16.9%) were
16S rRNA gene were amplified by nested PCR. In amplification double infection and 2 (3.1%) were multiple infection (Table 2). PCR
steps, primers used in PCR for detection of DNA of B. canis vogeli, detection was positive at 6.2% (95% CI: 1.2–11.2) and 12.3% (95%

Table 1
Primers for PCR amplification.

Blood parasites Primers Sequences Product size (bp) References
B. canis vogeli BAB1 5' GTG-AAC-CTT-ATC-ACT-TAA-AGG 3' 602 [17]
H. canis BAB4 5' CAA-CTC-CTC-CAC-GCA-ATC-G 3' 665
E. canis HepF 5' ATA-CAT-GAG-CAA-AAT-CTC-AAC 3' 478 [16]
HepR 5' CTT-ATT-ATT-CCA-TGC-TGC-AG 3' 389
A. platys ECC 5' AGA-ACG-AAC-GCT-GGC-GGC-AAG-CC 3' 473 [13]
ECB 5' CGT-ATT-ACC-GCG-GCT-GCT-GGC-A 3' 402
CANIS 5' CAA-TTA-TTT-ATA-GCC-TCT-GGC-TAT-AGG-A 3' [13]
HE3 5' TAT-AGG-TAC-CGT-CAT-TAT-CTT-CCC-TAT 3' [12]
ECC 5' AGA-ACG-AAC-GCT-GGC-GGC-AAG-CC 3' [13]
ECB 5' CGT-ATT-ACC-GCG-GCT-GCT-GGC-A 3'
PLATYS 5' TTT-GTC-GTA-GCT-TGC-TAT-G 3' [15]
GA1UR 5' GAG-TTT-GCC-GGG-ACT-TCT-TCT 3' [14]

Table 2
Blood pathogens among stray dogs (No.).

PCV (%) Samples Infected samples Single infection Double infection Multiple infection
HA H+A+E
B 37 E B+A B+E H+A H+E A+E 1
-- 6 - 3 1
> 37% 39 22 1 -1 8 1 -1- 2 -
-- 3 - 1 -
30%–37% 18 16 1 3 (4.6%) 8 (12.3%) 1 - 111 - 2 (3.1%)
18 (27.7%) 2 (3.1%)
20%–29% 6 5- 31 (47.7%) 1 (1.5%) --- 6 (9.2%)

< 20% 2 1- ---

Total 65 (100.0%) 44 (67.7%) 2 (3.1%) 1 (1.5%) 2 (3.1%) 1 (1.5%)

Total 65 (100.0%) 44 (67.7%) 11 (16.9%)

B = B. canis vogeli; H = H.canis; A = A. platys; E = E. canis.

Supawadee Piratae et al./Asian Pac J Trop Dis 2017; 7(4): 233-236 235

Table 3
Blood pathogens infection and determination on the levels of PCV.

Pathogens Status Levels of PCV (%) infection [n (%)] 95% CIa Pb df
B. canis vogeli
H. canis Positive > 37% 30%–37% 20%–29% < 20% 0.184 3
A. platys Negative 1 (1.5%) - - -
E. canis Positive 38 (58.5%) 3 (4.6%) - 4 (6.2%) 1.2–11.2 3
Total Negative 5 (7.7%) 2 (3.1%) 61 (93.8%) - 0.694 -
Positive 34 (52.3%) 15 (23.1%) 6 (9.2%) - 8 (12.3%) - 3
Negative 12 (18.5%) 57 (87.7%) 7.3–17.3 -
Positive 27 (41.5%) 3 (4.6%) - 2 (3.1%) 19 (29.2%) - 0.816 3
Negative 10 (15.4%) - 46 (70.8%) - -
29 (44.6%) 15 (23.1%) 6 (9.2%) 28 (43.1%) 24.2–34.2 -
2 (3.1%) 37 (56.9%) - 0.006*
39 5 (7.7%) 2 (3.1%) 1 (1.5%) -
1 (1.5%) - 38.1–48.1 -
13 (20.0%) 4 (6.2%) -
2 -
13 (20.0%) 4 (6.2%)

5 (7.7%) 2 (7.7%)

18 6

a: 95% CI; b: Pearson’s Chi-squared test; *: Statistically significant (P < 0.05).

CI: 7.3–17.3) for DNA of B. canis vogeli and H. canis. Nested PCR 4. Discussion
detection was positive at 43.1% (95% CI: 38.1–48.1) and 29.2%
(95% CI: 24.2–34.2) for DNA of E. canis and A. platys (Table 3). This study observed tick-borne pathogen in blood of stray dogs
and evaluated the association between parasitic infections and the
3.2. Evaluation infections on levels of PCV levels of PCV. We discovered the elevated infection rate status of
stray dogs and reported the first study on the prevalence of A. platys
The PCV values of these dogs were classified into 4 levels: level in dogs in Northeast Thailand. The prevalence of E. canis was
1 was normal group (PCV (%) ≥ 37%); level 2 was mild anemia the highest with 43.08%, followed by A. platys (29.2%), H. canis
group (PCV (%) = 30%–37%); level 3 was moderate anemia group (12.3%) and B. canis vogeli (6.2%), respectively. The results of this
(PCV (%) = 20%–29%) and level 4 was severe anemia group (PCV study supported the previous report regarding the presence of the
(%) ≤ 20%). Among 65 dogs in this study, 39, 18, 6 and 2 were highest prevalence of E. canis (21.5%) then H. canis (10.1%) and
classified by PCV values into level 1, 2, 3 and 4, respectively. There B. canis vogeli (6.3%) in stray dogs in Mahasarakham, Thailand[18].
were overall 39 in level 1, 22 dogs infection, 17 for single infection, In the southern region of Thailand, occurrence of E. canis infection
4 for double infections, 1 for multiple infections and 17 for non- in stray dogs was the lowest at 3.9%[19]. The variations of all tick-
infection. Of the 18 dogs in level 2, 16 dogs were infected, 9, 6 and borne pathogen infection rate may have been caused by differences
1 dogs were single, double and multiple infections, respectively, and in sampling location, distribution of the tick vector, season and
2 dogs were negative for blood pathogens. At level 3, 4 and 1 of the examination technique. Moreover, accumulation of the stray dogs is
dogs were positive with one and two pathogens, respectively, and 1 an indispensable factor, because they act as potential reservoir hosts
dog was negative tested. Two dogs in level 4 were single infection in the transmission cycle. A study conducted in Turkey found stray
and non-infection, respectively (Table 2). Stray dogs which were dogs had a higher prevalence of tick-borne infections (7.4%) when
positive for blood pathogens showed a low tendency of PCV values. compared to pet dogs (1.2%)[20]. The high prevalence of E. canis
The highest rate of tick-borne infection was the PCV level 2 (mild and A. platys in stray dogs may be remarkable for the increasing
anemia), followed by PCV level 3 (moderate anemia), PCV level 1 possibility of disease transmission to human.
(normal) and PCV level 4 (severe anemia) (Figure 1). Results from
Chi-square testing showed a statistically significant relationship Several studies reported blood pathogen infections can affect the
between levels of PCV and E. canis positive dogs (P < 0.05). PCV values[21]. From this study, we found the frequency of tick-
However, other pathogen had no significant effect between blood borne infection in stray dogs was higher in mild anemia cases than
parasitic infection and PCV levels (Table 3). normal group but there was no statistically significance. Moreover,
only E. canis positive dogs displayed significant relationship with
25 levels of PCV. Likewise, tick-borne pathogen infection is not
necessarily effected by PCV values in shelter dogs in Mauritius
Number of stray dogs 20 also[22]. On the other hand, lower PCV indicated a significant
positive correlation with infection with blood pathogens. Moreover,
15 co-infected dogs had lower PCV values compared to non-infected
and single-infected dogs from Costa Rica[23]. However, the
10 discrepancy of PCV values may be occurred by many factors such as
dehydration, lack of nutrition, intestinal parasitic infection and blood
5 parasitic infection, etc. Therefore, evaluation of the PCV values can
be used in combining for diagnosis tick-borne pathogen infections
0 but necessarily standardize other confounding factors.

Level 1 Level 2 Level 3 Level 4 This cross-sectional study examined the prevalence of B. canis
vogeli, H. canis, A. platys and E. canis and evaluated the association
Infected dogs Non-infected dogs between parasitic infections and the levels of PCV. Sixty-five blood

Figure 1. Comparison number of infected and non-infected dogs in
different PCV (%). Of 65 dogs in this study, 39, 18, 6 and 2 were
classified by PCV (%) in level 1 (> 37%), level 2 (30%–37%), level 3
(20%–29%) and level 4 (< 20%), respectively. Level 1: 22 dogs were
infections; Level 2: 16 dogs were infections; level 3: 5 dogs were
infections; level 4: one of dog was infected with at least a pathogen.

236 Supawadee Piratae et al./Asian Pac J Trop Dis 2017; 7(4): 233-236

samples of stray dogs were collected from the animal quarantine [9] Nair AD, Cheng C, Ganta CK, Sanderson MW, Alleman AR,
station of Mahasarakham, Thailand. The results indicated that blood Munderloh UG, et al. Comparative experimental infection study in
pathogens were abundantly spreading in stray dogs and they were dogs with Ehrlichia canis, E. chaffeensis, Anaplasma platys and A.
potentially high risk of agent transmission to human via exposure phagocytophilum. PLoS One 2016; 11(2): e0148239.
with tick vectors. On the volume percentage of red blood cell,
the PCV values of all stray dogs were ranged from 16% to 57%. [10] A rraga-Alvarado CM, Qurollo BA, Parra OC, Berrueta MA, Hegarty
Chi-square testing revealed a statistically significant relationship BC, Breitschwerdt EB. Case report: molecular evidence of Anaplasma
between the PCV levels and E. canis infection, but other pathogens platys infection in two women from Venezuela. Am J Trop Med Hyg
had no significant effect. Moreover, this is the first report of A. 2014; 91(6): 1161-5.
platys infection in dogs in north-eastern part of Thailand.
[11] B eatriz Silva A, Pina Canseco S, Gabriel de la Torre Mdel P, Mayoral
Conflict of interest statement Silva A, Mayoral MÁ, Pérez-Campos Mayoral L, et al. [Asymptomatic
human infection from contact with dogs: a case of human ehrlichiosis].
We declare that we have no conflict of interest. Gac Med Mex 2014; 150(2): 171-4. Spanish.

Acknowledgments [12] A nderson BE, Sumner JW, Dawson JE, Tzianabos T, Greene CR, Olson
JG, et al. Detection of the etiologic agent of human ehrlichiosis by
The authors gratefully acknowledge the veterinarian staffs from polymerase chain reaction. J Clin Microbiol 1992; 30(4): 775-80.
Faculty of Veterinary Sciences, Mahasarakham University and
all staffs from animal quarantine station, Mahasarakham for their [13] Dawson JE, Biggie KL, Warner CK, Cookson K, Jenkins S, Levine JF,
helps with sample collection. This project was supported by Faculty et al. Polymerase chain reaction evidence of Ehrlichia chaffeensis, an
of Veterinary Sciences of Mahasarakham University (Grant of etiologic agent of human ehrlichiosis, in dogs from Southeast Virginia.
Veterinary Sciences Research Project 2015). Am J Vet Res 1996; 57(8): 1175-9.

References [14] L ittle SE, Stallknecht DE, Lockhart JM, Dawson JE, Davidson WR.
Natural coinfection of a white-tailed deer (Odocoileus virginianus)
[1] M aggi RG, Mascarelli PE, Havenga LN, Naidoo V, Breitschwerdt population with three Ehrlichia spp. J Parasitol 1998; 84(5): 897-901.
EB. Co-infection with Anaplasma platys, Bartonella henselae and
candidatus Mycoplasma haematoparvum in a veterinarian. Parasit [15] Kordick SK, Breitschwerdt EB, Hegarty BC, Southwick KL, Colitz
Vectors 2013; 6: 103. CM, Hancock SI, et al. Coinfection with multiple tick-borne pathogens
in a Walker Hound kennel in North Carolina. J Clin Microbiol 1999;
[2] Chitanga S, Gaff H, Mukaratirwa S. Tick-borne pathogens of potential 37(8): 2631-8.
zoonotic importance in the Southern African Region. J S Afr Vet Assoc
2014; 85(1): 1084. [16] Inokuma H, Okuda M, Ohno K, Shimoda K, Onishi T. Analysis of the
18S rRNA gene sequence of a Hepatozoon detected in two Japanese
[3] Latrofa MS, Dantas-Torres F, Giannelli A, Otranto D. Molecular dogs. Vet Parasitol 2002; 106(3): 265-71.
detection of tick-borne pathogens in Rhipicephalus sanguineus group
ticks. Ticks Tick Borne Dis 2014; 5(6): 943-6. [17] D uarte SC, Linhares GF, Romanowsky TN, da Silveira Neto OJ,
Borges LM. Assessment of primers designed for the subspecies-specific
[4] Laummaunwai P, Sriraj P, Aukkanimart R, Boonmars T, Boonjaraspinyo discrimination among Babesia canis canis, Babesia canis vogeli and
S, Sangmaneedet S, et al. Molecular detection and treatment of tick- Babesia canis rossi by PCR assay. Vet Parasitol 2008; 152(1-2): 16-20.
borne pathogens in domestic dogs in Khon Kaen, Northeastern
Thailand. Southeast Asian J Trop Med Public Health 2014; 45(5): [18] P iratae S, Pimpjong K, Vaisusuk K, Chatan W. Molecular detection of
1157-66. Ehrlichia canis, Hepatozoon canis and Babesia canis vogeli in stray
dogs in Mahasarakham province, Thailand. Ann Parasitol 2015; 61(3):
[5] I npankaew T, Hii SF, Chimnoi W, Traub RJ. Canine vector-borne 183-7.
pathogens in semi-domesticated dogs residing in Northern Cambodia.
Parasit Vectors 2016; 9(1): 253. [19] Liu M, Ruttayaporn N, Saechan V, Jirapattharasate C, Vudriko P,
Moumouni PF, et al. Molecular survey of canine vector-borne diseases
[6] Baneth G. Tick-borne infections of animals and humans: a common in stray dogs in Thailand. Parasitol Int 2016; 65(4): 357-61.
ground. Int J Parasitol 2014; 44(9): 591-6.
[20] Aktas M, Özübek S, Altay K, Ipek ND, Balkaya İ, Utuk AE, et al.
[7] Kelly PJ, Xu C, Lucas H, Loftis A, Abete J, Zeoli F, et al. Ehrlichiosis, Molecular detection of tick-borne rickettsial and protozoan pathogens
babesiosis, anaplasmosis and hepatozoonosis in dogs from St. Kitts, in domestic dogs from Turkey. Parasit Vectors 2015; 8: 157.
West Indies. PLoS One 2013; 8(1): e53450.
[21] C annon SH, Levy JK, Kirk SK, Crawford PC, Leutenegger CM,
[8] Hii SF, Traub RJ, Thompson MF, Henning J, O’Leary CA, Burleigh A, Shuster JJ, et al. Infectious diseases in dogs rescued during dogfighting
et al. Canine tick-borne pathogens and associated risk factors in dogs investigations. Vet J 2016; 211: 64-9.
presenting with and without clinical signs consistent with tick-borne
diseases in northern Australia. Aust Vet J 2015; 93(3): 58-66. [22] R ojas A, Rojas D, Montenegro V, Gutiérrez R, Yasur-Landau D, Baneth
G. Vector-borne pathogens in dogs from Costa Rica: first molecular
description of Babesia vogeli and Hepatozoon canis infections with a
high prevalence of monocytic ehrlichiosis and the manifestations of co-
infection. Vet Parasitol 2014; 199(3-4): 121-8.

[23] Lee GK, Ignace JA, Robertson ID, Irwin PJ. Canine vector-borne
infections in Mauritius. Parasit Vectors 2015; 8: 174.

View publication stats





Original Paper Received: April 6, 2018
Accepted: November 13, 2018
Inflamm Intest Dis 2018;3:145–154 Published online: January 10, 2019
DOI: 10.1159/000495462

Dysbiosis of the Gut Microbiota on the
Inflammatory Background due to Lack of
Suppressor of Cytokine Signalling-1 in Mice

Yoshiko Gendo a, b Takashi Matsumoto c Naganori Kamiyama a
Benjawan Saechue a Ciaki Fukuda a Astri Dewayani a Shinya Hidano a
Kaori Noguchi a Akira Sonoda a, b Takashi  Ozaki a Nozomi Sachi a
Haruna Hirose a Sotaro Ozaka a Yuki Eshita a Kazuhiro Mizukami b
Tadayoshi Okimoto b Masaaki Kodama b Tomoko Yoshimatsu d
Haruto Nishida d Tsutomu Daa d Yoshio Yamaoka c Kazunari Murakami b
Takashi Kobayashi a

a Department of Infectious Disease Control, Faculty of Medicine, Oita University, Yufu, Japan; b Department of
Gastroenterology, Faculty of Medicine, Oita University, Yufu, Japan; c Department of Environmental and Preventive
Medicine, Faculty of Medicine, Oita University, Yufu, Japan; d Department of Diagnostic Pathology, Faculty of
Medicine, Oita University, Yufu, Japan

Keywords proinflammatory genetic background affects the gut micro-
Colitis · Dysbiosis · Genetic factors · Prevotella · Suppressor biota, we used SOCS1–/–Tg mice as a model of spontaneous
of cytokine signaling-1 chronic colitis. Fecal samples were collected from SOCS1–/–
Tg mice and SOCS1+/+Tg (control) mice at 1 and 6 months of
Abstract age, and the fecal bacterial 16S ribosomal RNA genes were
Background: Both environmental and genetic factors have sequenced using the Illumina MiSeq platform. Results: Gut
been implicated in the induction of autoimmune disease. microbial diversity was significantly reduced and the intesti-
Therefore, it is important to understand the pathophysiolog- nal bacterial community composition changed in SOCS1–/–
ical significance of the gut microbiota and host genetic back- Tg mice in comparison with the control mice. Interestingly,
ground that contribute to an autoimmune disease such as the population of Prevotella species, which is known to be
inflammatory bowel disease (IBD). We have previously re- elevated in ulcerative colitis and colorectal cancer patients,
ported that mice deficient for suppressor of cytokine signal- was significantly increased in SOCS1–/–Tg mice regardless of
ing-1 (SOCS1), in which SOCS1 expression was restored in T age. Conclusion: Taken together, these results suggest that
and B cells on an SOCS1–/– background (SOCS1–/–Tg mice), the proinflammatory genetic background owing to SOCS1
developed systemic autoimmune diseases accompanied by deficiency causes dysbiosis of the gut microbiota, which in
spontaneous colitis. Methods: To investigate whether the turn generates a procolitogenic environment.

© 2019 S. Karger AG, Basel

© 2019 S. Karger AG, Basel Takashi Kobayashi
E-Mail [email protected] Idaigaoka 1-1
www.karger.com/iid Hasama-machi, Yufu, Oita 879-5593 (Japan)
E-Mail [email protected]

Introduction within 6 months of age [10, 14]. These observations clear-
About 1 × 1014 microbes exist in the human gastro­ ly indicate that a genetic factor resulting in excessive cy-
intestinal tract [1]. The intestinal mucosa is constantly tokine signaling predisposes to spontaneous autoim-
exposed to an enormous number of microbes, including mune colitis. However, it is not yet fully understood how
bacteria, viruses, fungi, and protozoa that raises the risk the proinflammatory genetic background affects the gut
of infection. Accordingly, the intestinal immune system microbiota.
must strictly control the delicate balance between im-
mune tolerance to commensal microbes and immune re- In this study, we employed SOCS1–/–Tg mice as an
sponse to pathogens. Therefore, immune dysregulation autoimmune colitis model. Analysis of the fecal micro­
may result in dysbiosis, an imbalance in the composition biome using 16S ribosomal RNA (rRNA) gene amplicon
of bacterial populations in the gut, and intestinal auto­ sequencing revealed that SOCS1–/–Tg mice showed re-
immune diseases, both of which are affected by environ- duced microbial diversity and altered bacterial composi-
mental and genetic factors [2, 3]. tion in the gut. Interestingly, the relative abundance of
Intestinal autoimmune disorders have been implicat- Prevotella species, which is known to be elevated in UC
ed in environmental factors such as the Western diet, ear- [15] and colorectal cancer (CRC) [16] patients, was sig-
ly childhood antibiotic exposure, and microbial infec- nificantly increased in SOCS1–/–Tg mice regardless of
tions. Recent advances in culture-independent sequenc- age.
ing have provided many insights into the relationship
between gut microbiota and intestinal autoimmune dis- We propose that the proinflammatory environment
eases. It has been reported, for example, that 17 selected owing to SOCS1 deficiency resulted in dysbiosis of the gut
strains of intestinal bacteria, including Clostridium clus- microbiota characterized by increased Prevotella, which
ters IV, XIVa, and XVIII, which are known to be reduced is a potential exacerbating factor for autoimmune colitis.
in ulcerative colitis (UC) patients, have a potent capacity
to induce colonic Treg cells [4]. Furthermore, dysbiosis is Materials and Methods
associated not only with inflammatory bowel disease Mice
(IBD) but also with other autoimmune diseases. For ex- SOCS1–/–Tg mice were described previously [10, 14]. Briefly,
ample, intestinal Prevotella copri has been implicated in littermates of SOCS1–/–Tg mice and SOCS1+/+Tg (control) mice
the pathogenesis of rheumatoid arthritis (RA) [5]. More- from heterozygous (SOCS1+/–Tg) intercrosses were used in these
over, Faecalibacterium, Prevotella, and Anaerostipes were experiments. Each of the experimental groups (SOCS1–/–Tg and
less abundant at the genus levels in the gut microbiota of control) were housed in separate cages directly after weaning. The
multiple sclerosis patients [6]. Although there is increas- mice were maintained in specific pathogen-free facilities in the Di-
ing evidence for an association between dysbiosis and vision of Laboratory Animal Science at Oita University (Oita, Ja-
autoimmune diseases, disease causality related to altered pan). All experiments using these mice were approved by and were
microbial communities is still uncertain. In addition to performed according to the guidelines of the Oita University Ani-
the environmental factors, genetic factors are shown to be mal Ethics Committee. To determine the genotype of each mouse,
critical for the disease process of IBD. Mice lacking inter- PCR analysis was performed by using primer sets 10F:
leukin (IL)-1 receptor antagonist, IL-2, IL-10, and other AGAGCTTGGGCGACCTCACC and mJAB: TCAGGTAGT-
cytokine-related molecules develop autoimmune re- CACGGAGTACC for the SOCS1 Tg allele, and JAB P1: CAG-
sponses and IBD [7–9]. GCACCCACTCCTGGCCTT, JAB P2: TGGCCATTCGGCCTG-
Suppressor of cytokine signaling-1 (SOCS1), a nega- GCCTT, and JAB P3: GCCTTCTTGACGAGTTCTTCTG for the
tive regulator of interferon (IFN) signaling, has been im- SOCS1 wild-type and deficient allele [13].
plicated in the pathogenesis of spontaneous colitis [10– Sample Collection
12]. SOCS1 knockout (SOCS1–/–) mice die within 3 weeks Fecal samples were collected directly from the anus into 1.5-mL
of birth due to severe systemic inflammation caused by microtubes, and these samples were stored at –20  ° C within 1 h
excessive IFNγ signaling [13]. In contrast, SOCS1–/–Tg after collection. Fecal samples were collected in the evening (4 p.m.
mice, in which SOCS1 is expressed in T and B lympho- to 9 p.m.) to obtain reproducible data, because it has been shown
cytes, but not in nonlymphoid cells, are able to survive for that the intestinal microbiota oscillates rhythmically over a 24-h
over 6 months; however, these mice develop systemic period in both mice and humans [17]. Fecal samples were collect-
autoimmune-like disease including spontaneous colitis ed from 1-month-old (young) mice and 6-month-old (old) mice.
For 16S rRNA sequencing, fecal samples derived from 2–6 mice
were pooled in one tube and then subjected to the analysis. The
mice were euthanized at 6 months of age. For each mouse, a por-
tion of the proximal colon near the cecum was frozen immedi-
ately in liquid nitrogen, and stored at –80  ° C until analysis by real-

146 Inflamm Intest Dis 2018;3:145–154 Gendo et al.

DOI: 10.1159/000495462

time reverse transcription polymerase chain reaction (RT-PCR). P. copri Colonization
The remaining proximal colon and distal colon were fixed in 10% Prevotella copri was obtained from RIKEN BRC Microbe divi-
formaldehyde, embedded in paraffin, and stained with hematox­ sion (Japan Collection of Microorganism). P. copri was cultured
ylin-eosin to examine colitis. These experiments were repeated for 48 h on phenylethyl alcohol brucella blood agar (Kyokuto
twice independently. Pharmaceutical Industrial Co. Ltd, Tokyo, Japan) in an anaerobic
condition. The colonies of P. copri were collected and suspended
Illumina MiSeq Sequencing in skimmed milk. The suspension was orally administrated to
For library preparation, the V3–V4 region of bacterial 16S C57BL/6 mice using a sonde for 12 consecutive days.
rRNA genes was amplified by PCR using universal primers 341F Induction of DSS Colitis
(5′-CCTACGGGNGGCWGCAG-3′) and 805R (5′-GACTACH- One day after the administration of P. copri, the mice were giv-
VGGGTATCTAATCC-3′) [18]. The 16S rRNA gene amplicon se- en 2.5% DSS (dextran sulfate sodium) in drinking water for 8 days
quencing was performed by Hokkaido System Science Co. Ltd. followed by water alone for an additional 3 days. During the course
(Hokkaido, Japan) with an Illumina MiSeq platform (Illumina, of induction of DSS colitis, the severity of colitis was measured by
San Diego, CA, USA). Briefly, the PCR products were purified, and body weight change. Mice were eventually sacrificed and colonic
paired-end DNA sequencing (2 × 300 bp) was carried out on the mucosal damage was evaluated by microscopic observation of HE-
Illumina MiSeq platform using a MiSeq reagent kit version 3. stained colon sections.
Sequence Data Analysis Quantification of TNFα by Real-Time PCR
Barcoded Illumina reads were processed using the microbial Total RNA from the colons of DSS colitis-induced mice was
genomics module on a CLC Genomics Workbench version 8.5.1 isolated using TRI Reagent (Molecular Research Center Inc., Cin-
(Qiagen Inc., Hilden, Germany). Index and adapter sequences cinnati, OH, USA); reverse-transcription into cDNA was carried
were removed from the raw fastq files, and quality filtering was out using a Verso cDNA synthesis kit (Thermo Fisher Scientific
performed with the following parameters (ambiguous limit 2, Inc., Waltham, MA, USA). Real-time PCR was performed using
quality limit 0.05, minimum sequence length 200, and minimum the SYBR green kit (KAPA SYBR FAST qPCR kit, Kapa Biosystem
number of reads 100). Chimeric reads were detected and filtered Inc., Wilmington, MA, USA) with a LightCycler 96 (Roche, Merck,
from the paired-end reads using the chimera crossover detection Darmstadt, Germany). Each mRNA level was normalized to
algorithm with the following parameters (merge paired-end read: β-actin mRNA expression. The amplification conditions were: 45
mismatch cost 1, minimum score 40, gap cost 4, and maximum cycles of 95  ° C (5 s) and 60  ° C (30 s). The sequences of the primers
unaligned end mismatches 2; remove chimera read: chimera were as follows: TNFα FW: 5′-CCACCACGCTCTTCTGTC-
crossover cost 3 and Kmer size 6). Reference-based operational TA-3′; TNFα RV: 5′-TCCTCCACTTGGTGGTTTGT-3′; β-actin
taxonomic unit (OTU) clustering was achieved at 97% identity FW: 5′-CTTCCTCCCTGGAGAAGAGCTATGAGC-3′; β-actin
with the Greengenes database version 13_8 (similarity percentage RV: 5′-GCCTAGAAGCACTTGCGGTGCACG-3′.
97, minimum occurrences 2, fuzzy match duplicates FALSE, and
find best match TRUE). Low-abundance OTUs with combined Results
abundance across all samples of less than 10 were eliminated. A Levels of Cytokine Gene Expression Assessed by
total of 788 OTUs were predicted; these were aligned using the Real-Time RT-PCR
MUSCLE [19] algorithm, and a neighbor-joining tree with a We used SOCS1–/–Tg mice as a model of spontaneous
Jukes-Cantor nucleotide substitution model was constructed. Al- autoimmune colitis. As shown in a previous report, these
pha diversity indices (bias-corrected Chao1, Shannon entropy, mice exhibited inflammation not only in the colon but
and phylogenetic diversity) were calculated, and rarefaction also in various organs [14]. We analyzed the colonic
curves were plotted with a maximum rarefaction depth of 5,000 mRNA expression levels of proinflammatory cytokines
sequences per sample. Beta diversity was calculated as follows: such as TNFα, IL-1β, IL-6, IL-12p40, IFNγ, and MIP-1α
principal coordinate analysis based on the generalized UniFrac by real-time RT-PCR. Consistent with our previous re-
distance was conducted to compare microbial communities [20]. port [10], colonic TNFα expression was significantly up-
The generalized UniFrac kernel with α = 0.5 provided the highest regulated in SOCS1–/–Tg mice compared to control mice,
power [21]. while no change was observed in the expression of IL-1β,
Statistical Analysis IL-6, IFNγ, IL-12p40, and MIP-1α (data not shown). Fur-
Generalized UniFrac distances used for microbial community thermore, we confirmed the elevation of TNFα expres-
comparison were statistically evaluated by permutational multi- sion by Western blot analysis (data not shown). The coli-
variate analysis (PERMANOVA) in the microbial genomics mod- tis in SOCS1–/–Tg mice was also apparent in the histo-
ule of the CLC Genomics Workbench (QIAGEN). The number of logical analysis, which exhibited a hyperplasia on the
permutations was defined as 99,999. Comparison of alpha diver- mucosa (data not shown). The number of goblet cells de-
sity indices and the relative proportion of bacterial genera between
the SOCS1–/–Tg and SOCS1+/+Tg groups were evaluated using the
Student t test. p values <0.05 were considered significant. Linear
discriminant analysis (LDA) and LDA effect size (LEfSe) were es-
timated by using LEfSe software with the default settings in the
Galaxy platform [22, 23].

Dysbiosis due to Lack of SOCS1 Inflamm Intest Dis 2018;3:145–154 147
DOI: 10.1159/000495462

Rela�ve abundance (% of 16S rRNA gene sequences)100

Color version available online90

80

70

60

50

40

30

20

10

0 KO Ctrl KO
Ctrl 6-month-old

1-month-old

other
k__Bacteria;p__Firmicutes;c__Bacilli;o__Turicibacterales;f__Turicibacteraceae
k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;Other
k__Bacteria;p__Proteobacteria;c__Betaproteobacteria;o__Burkholderiales;f__Alcaligenaceae
k__Bacteria;p__Actinobacteria;c__Coriobacteriia;o__Coriobacteriales;f__Coriobacteriaceae
k__Bacteria;p__Proteobacteria;c__Deltaproteobacteria;o__Desulfovibrionales;f__Desulfovibrionaceae
k__Bacteria;p__TM7;c__TM7-3;o__CW040;f__F16
k__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Porphyromonadaceae
k__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__[Odoribacteraceae]
k__Bacteria;p__Proteobacteria;c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae
k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae
k__Bacteria;p__Verrucomicrobia;c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae
k__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Bacteroidaceae
k__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Rikenellaceae
k__Bacteria;p__Firmicutes;c__Erysipelotrichi;o__Erysipelotrichales;f__Erysipelotrichaceae
k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae
k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae
k__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae
k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__
k__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__S24-7
k__Bacteria;p__Bacteroidetes;c__Bacteroidia;o__Bacteroidales;f__Prevotellaceae

Fig. 1. Relative abundance of bacterial family composition in the pooled feces. SOCS1–/–Tg (KO) and SOCS1+/+Tg
(control) mice were analyzed at 1 month and 6 months of age. Stacked columns represent the abundance of a
given family as a percentage of the total bacterial sequences in the pooled sample derived from 2–6 mice. Each
stacked column represents pooled fecal samples from 2–6 mice per group. The 20 most representative families
are shown.

148 Inflamm Intest Dis 2018;3:145–154 Gendo et al.

DOI: 10.1159/000495462

termined by alcian blue staining was significantly reduced Gut Microbiome Composition Was Altered in
in SOCS1–/–Tg mice (data not shown). SOCS1–/–Tg Mice
We next analyzed the abundance of bacterial species
Gut Microbial Composition in SOCS1–/–Tg and in the pooled data of SOCS1–/–Tg mice and control mice
SOCS1+/+Tg mice using LEfSe software (LDA score [log10] >3.0; p < 0.05;
To clarify whether the proinflammatory background Fig. 2c). Positive LDA scores indicated an increased rela-
of SOCS1–/–Tg mice affects the gut microbiota, 16S tive abundance in SOCS1–/–Tg mice, while negative LDA
metagenome was performed with the fecal samples col- scores indicated an increased relative abundance in con-
lected from young and old mice. The bacterial 16S rRNA trol mice. SOCS1–/–Tg mice had a higher relative abun-
genes in the samples were sequenced for phylogenetic dance of Prevotella, Bilophila, Ruminococcus, and Strep-
analysis using the Illumina MiSeq platform, allowing us tococcus (LDA score [log10] >3.0), whereas S24–7 was the
to investigate total 788 OTUs belonging to 9 phyla, 18 most enriched family in control mice (Fig. 2c).
classes, 24 orders, 42 families, and 62 genera. The phyla P. copri Did Not Alter the Disease Phenotype of
of Bacteroidetes and Firmicutes were abundant in both DSS-Induced Colitis in Mice
SOCS1–/–Tg and control mice (data not shown). The rel- Since we observed the increased abundance of Pre-
ative abundance of taxa at the family level was compared votella, which is known as the pathogenesis of RA [5] in
between SOCS1–/–Tg and control mice at 1 and 6 months SOCS1–/–Tg mice, we examined the effect of transfer of
of age (Fig.  1). S24–7, Clostridiaceae, Lactobacillaceae, feces from SOCS1–/–Tg mice to colonize the microbiota
Ruminococcaceae, and Lachnospiraceae were abundant in WT mice. However, we failed to observe a change in
in both groups; however, Prevotellaceae was more abun- the gut microbiota in SOCS1+/+Tg mice (no colitis) co-
dant in SOCS1–/–Tg mice than in control mice, regardless housing with SOCS1–/–Tg mice. We then examined the
of age. effect of inoculation of P. copri from human feces in the
Species Richness of the Gut Microbiota Was Reduced DSS-induced colitis model. One day prior to the admin-
in SOCS1–/–Tg Mice istration of DSS, wild-type mice were given P. copri using
Next, we calculated alpha diversity and beta diversity a stomach sonde. As shown in Figure 3a, the body weight
to reveal the species diversity. The filtered reads contain- was comparably reduced in both P. copri-inoculated and
ing 290,451 reads (median 33,745 reads per group, SD ± vehicle-treated mice. TNFα mRNA expression levels
5,138) was used for further alpha diversity and beta diver- were also increased to a similar extent by DSS treatment
sity analysis. in both groups (Fig. 3b). In addition, histological damage
Alpha diversity was compared using the following in- of colonic mucosa was seen in both groups of mice
dices: bias-corrected Chao1, Shannon entropy, and phy- (Fig. 3c).
logenetic diversity. Each analysis revealed that the diver-
sity of the microbiota in the young SOCS1–/–Tg mice was Discussion
decreased compared to that in young control mice (data SOCS1 is an intracellular protein involved in the neg-
not shown). The same was true for the diversity of micro- ative regulation of the cytokine-JAK-STAT pathway
biota in old mice (data not shown). Alpha diversity esti- [24]. We have previously reported that deficiency of
mated by bias-corrected Chao1 using combined data SOCS1 results in the hyperactivation of STAT1, STAT3,
from young and old mice showed a significant reduction and NF-κB, which in turn leads to spontaneous colitis in
of species richness in SOCS1–/–Tg mice (Fig. 2a). SOCS1–/–Tg mice and SOCS1–/–TCRα–/– mice [10, 11].
Principal coordinate analysis was conducted based on These signaling pathways are also known to be activated
generalized UniFrac distances (Fig.  2b). The principal in human IBD [25–28]. Hence, we employed SOCS1–/–
component scores accounted for 48% (PCo1) and 19% Tg mice as an autoimmune colitis model in this study.
(PCo2) of the total variance. The microbial communities Activation of Toll-like receptor (TLR) signaling by
of SOCS1–/–Tg mice and control mice were clearly sepa- commensal bacteria results in the production of inflam-
rated from each other when compared on the basis of the matory cytokines such as TNFα, and consequently the
host genotype, but not when compared by age. Taken to- development of spontaneous colitis [29]. Indeed, it is re-
gether, these results clearly indicated that the bacterial ported that removing commensal bacteria by the admin-
communities in SOCS1–/–Tg mice were significantly re-
duced and separated from those in control mice.

Dysbiosis due to Lack of SOCS1 Inflamm Intest Dis 2018;3:145–154 149
DOI: 10.1159/000495462

600 Rarefaction Measure : ＊ PCo2 (19%) 0.20 1m Color version available online
500 Chao 1 bias-corrected 1m
400 Ctrl 0.15
300 KO
200 Sequences Per Sample 0.10 6m
100
0.05
0
a 0 6m
1m
–0.05 1m 1m

1 –0.10 1m 0 0.1 0.2 0.25
264
527 –0.15 –0.1
2111212233334445,,,,,,,,,,,,,,,,567002146884933173480455216918703951208779410463830 –0.2

b PCo1 (48%)

f_Desulfovibrionaceae_g_Bilophila
f_Prevotellaceae_g_Prevotella
f_Prevotellaceae

f_Streptococcaceae_g_Streptococcus
f_Ruminococcaceae

f_Ruminococcaceae_g_Ruminococcus
f_Streptococcaceae

f_Coriobacteriaceae_g_Unclassified
o_Coriobacteriales
f_Coriobacteriaceae
c_Coriobacteriia
f_Lachnospiraceae_g_Ruminococcus
p_Actinobacteria

f_Coriobacteriaceae_g_Adlercreutzia
f_Helicobacteraceae_g_Unclassified
f_S24-7
f_S24-7_g_Unclassified

−4 −2 0 24
c LDA SCORE (log 10) Ctrl

KO

Fig. 2. Comparison of bacterial taxa between SOCS1–/–Tg and con- (control). Each dot represents a microbial community from KO
trol mice. a Analysis of alpha diversity in SOCS1–/–Tg mice (KO) (white) and control (black) mice, 1-month-old mice (circles) and
and SOCS1+/+Tg mice (control). Diversity indices in KO mice ver- 6-month-old mice (squares), 2–6 mice per dot. p < 0.03, calculated
sus control mice were predicted by bias-corrected Chao1. The data by PERMANOVA. c LEfSe shows differentially abundant OTUs
are presented as the mean ± SD. Statistical differences were ana- between SOCS1–/–Tg mice and SOCS1+/+Tg mice. LDA scores
lyzed by Student t test. * p < 0.05 was considered statistically sig- (log10) for the most prevalent taxa in KO mice are represented on
nificant. b Principal coordinate analysis of generalized UniFrac the positive scale, whereas negative LDA scores indicate enriched
distance analysis for SOCS1–/–Tg mice (KO) and SOCS1+/+Tg mice taxa in control mice.

150 Inflamm Intest Dis 2018;3:145–154 Gendo et al.

DOI: 10.1159/000495462

100Body weightVehicle ns
80change, %P. copri ++
60 TNFα mRNA –+
40
20 Color version available online
0
0 2 4 6 8 10 DSS –

a Days after induction b P. copri –

Vehicle P. copri

Fig. 3. P. copri colonization did not affect 100 μm
the phenotype of DSS colitis. a Body weight
change in vehicle-treated (n = 5) and P. co- c
pri-inoculated mice (n = 6) receiving 2.5%
DSS in drinking water. The data are pre-
sented as the mean ± SD. b Relative mRNA
expression levels of TNFα in the colon of
the DSS-induced mice. c Representative
images of HE-stained colon samples from
the DSS-induced mice. Arrows indicate
mucosal tissue destruction and loss of gob-
let cells; arrowheads show lymphocyte ac-
cumulation in lamina propria.

istration of antibiotics is effective to a certain degree for are two main signal pathways downstream of TLR4, me-
inducing remission in IBD patients [30] as well as for the diated by MyD88 and TRIF [32]. It is known that the
prevention of colitis in SOCS1–/–Rag2–/– mice [12]. As early phase NF-κB activation is controlled by the MyD88-
reported previously [10], we have observed that only dependent pathway [33], while the late phase NF-κB ac-
TNFα expression, but not IL-1β or IL-6, was upregulated tivation is controlled by the TRIF-dependent pathway.
in SOCS1–/–Tg mice (data not shown). Proinflammatory Upon activation of TLR signaling, TNFα is induced in
cytokines such as TNFα, IL-1β, and IL-6 are known to be the relatively early phase, while IL-1β and IL-6 are in-
induced by the activation of NF-κB, which is a transcrip- duced in the late phase. In addition, it has been revealed
tion factor downstream of TLR signaling. Mansell et al. that TNFα is induced in the early phase in an IκBζ-
[31] demonstrated that removal of SOCS1 regulation po- independent manner, while IL-6 is induced in the late
tentiates Mal-dependent phosphorylation and transacti- phase in an IκBζ-dependent manner [34]. These results
vation of NF-κB subunit p65, leading to amplified in- suggest that TLR-mediated IL-6 induction is regulated in
flammatory responses. Hence, SOCS1 deficiency in non- a gene expression process of at least two steps, involving
lymphoid cells leads to activate NF-κB, which may inducible IκBζ that is not required for the TNFα induc-
increase proinflammatory cytokine production. There tion. However, it was unclear how the proinflammatory

Dysbiosis due to Lack of SOCS1 Inflamm Intest Dis 2018;3:145–154 151
DOI: 10.1159/000495462

cytokine milieu affects gut microbiota. Therefore, in this In this study, we examined both young mice and old
study we conducted 16S rRNA gene amplicon sequenc- mice. In humans, it is known that the microbiota of the
ing of the fecal microbiota in SOCS1–/–Tg mice. The data gut alters with aging, and although the association be-
revealed intestinal microbial dysbiosis including a de- tween gut microbiota and aging is not yet fully under-
crease in species diversity characterized by a predomi- stood, diet is one of the most influential factors for alter-
nant population of the Prevotellaceae family in the mu- ing the composition of the gut microbiota [43]. How-
tant mice. ever, although humans consume a variety of foods
during their lifetimes, the mice in our experiments were
Recent advances in metagenomic 16S analysis have fed the same food throughout their lifetimes. Therefore,
enabled us to better understand the association between the host genetic background in which the SOCS1 gene
the microbiota and pathophysiological conditions in the is deleted in nonlymphoid cells could be the most influ-
host. Several studies have indicated that IBD patients ential factor, rather than the aging process, in SOCS1–/–
have dysbiosis, in which taxa in the phylum Firmicutes Tg mice.
are consistently decreased and taxa in phylum Proteo-
bacteria are increased [35–37]. In addition, some immu- We have shown that the proinflammatory genetic
nocompromised mice show a high correlation between background affects the gut microbiota potentially lead-
colitis and dysbiosis. For example, IL-10-deficient mice, ing to dysbiosis. However, it remains to be determined
a widely used IBD model, show reduced bacterial diver- whether upregulation of TNFα results in the perturba-
sity and an increase in taxa in the phylum Proteobacteria tion of the gut microbiota. To address this issue, further
[38]. Moreover, mice doubly deficient in T-bet and Rag2 studies are required to examine whether treatment of
(T-bet–/–Rag2–/– mice), which are also known to develop SOCS1–/–Tg mice with recombinant TNFα disturbs the
UC, exhibit a higher proportional representation of taxa gut microbiota (increases in Prevotella). It would be in-
in the order Bacteroidales [39]. Mice deficient in NLRP6 teresting to examine whether the administration of anti-
(NOD-like receptor family pyrin domain containing 6), TNFα antibody to SOCS1–/–Tg mice or intercrossing
which is highly expressed in colonic epithelial cells, show SOCS1–/–Tg mice with TNFα–/– mice can improve dys-
an increased representation of the phylum Bacteroidetes biosis. On the other hand, Lankelma et al. [44] reported
(Prevotellaceae) and candidate phylum TM7 [40]. that gut microbiota disruption by broad-spectrum anti-
biotics decreases TNFα production by mononuclear
In this study, we found that the proportions of taxa cells. Further studies are still needed to verify the cause-
in the genera Prevotella, Bilophila, and Streptococcus effect relationship between the upregulation of TNFα
were significantly increased in SOCS1–/–Tg mice. Pre- and the loss of diversity of the gut microbiota.
votella, which is a genus of obligate anaerobic Gram-
negative bacilli, exists in the oral cavity and gastrointes- In conclusion, the proinflammatory genetic back-
tinal tract in healthy humans and predominates in the ground due to SOCS1 deficiency leads to dysbiosis ac-
mucosal tissue of UC [15], CRC [16], and RA patients companied by a reduced diversity of gut microbiota and
[5]. Furthermore, it has been demonstrated that P. copri increased abundance of Prevotella, which may exacer-
exacerbates DSS-induced colitis [5], suggesting that Pre- bate autoimmune colitis.
votella is a potential risk factor in the aggravation of coli-
tis. However, in our experiments, inoculation of P. copri Acknowledgements
from humans in mice did not worsen the phenotype of We thank Ms. Chiharu Aoki for her excellent secretarial assis-
DSS-induced colitis, probably due to the failure to colo- tance, Dr. Naoki Hijiya, Ms. Mami Kimoto, and Ms. Aiko Yasuda
nize the mice with P. copri. It is known that Prevotella- for providing technical assistance, and members of Dr. Kobaya­
ceae produce sulfatases which degrade mucus oligosac- shi’s laboratory for valuable discussions. This work was supported
charides leading to disruption of the mucosal barrier by Grants-in-Aid from the Japan Society for the Promotion of Sci-
function [41]. Impairment of the barrier function of the ence (grant No. 15K08953 [K. Mizukami], 26460942 [M.K.],
epithelial cell layer results in chronic inflammation such 26460420 [K. Murakami], 26305014 [T.K.], 15K19577 [T. Ozaki],
as IBD, and indeed sulfatases are increased in the intes- 15H06512 [N.K.], and 16H05191 [Y.Y.]), Suzuken Memorial
tinal mucosa in IBD patients [42]. Interestingly, Pre- Foundation (N.K.), GSK Japan Research Grant (S.H.), Kurozumi
votella is increased in both CRC patients and SOCS1–/– Medical Foundation (N.K.), and Lotte Research Promotion Grant
Tg mice in which colorectal carcinomas develop spon- (S.H.).
taneously; however, the pathophysiological relevance of
Prevotella should be solved.

152 Inflamm Intest Dis 2018;3:145–154 Gendo et al.

DOI: 10.1159/000495462

Statement of Ethics Disclosure Statement
All animal experiments were performed in accordance with the The authors have no competing financial interests to declare.
guidelines of the Oita University Animal Ethics Committee
(OUAEC) and were approved by the OUAEC.

References 12 Chinen T, Komai K, Muto G, Morita R, Inoue 24 Yoshimura A, Naka T, Kubo M. SOCS pro-
N, Yoshida H, et al. Prostaglandin E2 and teins, cytokine signalling and immune regula-
  1 Ahmed I, Roy BC, Khan SA, Septer S, Umar SOCS1 have a role in intestinal immune toler- tion. Nat Rev Immunol. 2007 Jun;7(6):454–
S. Microbiome, Metabolome and Inflamma- ance. Nat Commun. 2011 Feb;2(1):190. 65.
tory Bowel Disease. Microorganisms. 2016
Jun;4(2):20. 13 Marine JC, Topham DJ, McKay C, Wang D, 25 Suzuki A, Hanada T, Mitsuyama K, Yoshida
Parganas E, Stravopodis D, et al. SOCS1 defi- T, Kamizono S, Hoshino T, et al. CIS3/
 2 Klareskog L, Padyukov L, Lorentzen J, Al- ciency causes a lymphocyte-dependent peri- SOCS3/SSI3 plays a negative regulatory role
fredsson L. Mechanisms of disease: genetic natal lethality. Cell. 1999 Sep;98(5):609–16. in STAT3 activation and intestinal inflamma-
susceptibility and environmental triggers in tion. J Exp Med. 2001 Feb;193(4):471–81.
the development of rheumatoid arthritis. Nat 14 Hanada T, Yoshida H, Kato S, Tanaka K, Ma-
Clin Pract Rheumatol. 2006 Aug;2(8):425–33. sutani K, Tsukada J, et al. Suppressor of cyto- 26 Lovato P, Brender C, Agnholt J, Kelsen J, Kal-
kine signaling-1 is essential for suppressing toft K, Svejgaard A, et al. Constitutive STAT3
  3 Hewagama A, Richardson B. The genetics and dendritic cell activation and systemic autoim- activation in intestinal T cells from patients
epigenetics of autoimmune diseases. J Auto- munity. Immunity. 2003 Sep;19(3):437–50. with Crohn’s disease. J Biol Chem. 2003 May;
immun. 2009 Aug;33(1):3–11. 278(19):16777–81.
15 Lucke K, Miehlke S, Jacobs E, Schuppler M.
  4 Atarashi K, Tanoue T, Oshima K, Suda W, Prevalence of Bacteroides and Prevotella spp. 27 Mudter J, Weigmann B, Bartsch B, Kiesslich
Nagano Y, Nishikawa H, et al. Treg induction in ulcerative colitis. J Med Microbiol. 2006 R, Strand D, Galle PR, et al. Activation pattern
by a rationally selected mixture of Clostridia May;55(Pt 5):617–24. of signal transducers and activators of tran-
strains from the human microbiota. Nature. scription (STAT) factors in inflammatory
2013 Aug;500(7461):232–6. 16 Sobhani I, Tap J, Roudot-Thoraval F, Roperch bowel diseases. Am J Gastroenterol. 2005 Jan;
JP, Letulle S, Langella P, et al. Microbial dys- 100(1):64–72.
  5 Scher JU, Sczesnak A, Longman RS, Segata N, biosis in colorectal cancer (CRC) patients.
Ubeda C, Bielski C, et al. Expansion of intes- PLoS One. 2011 Jan;6(1):e16393. 28 Neurath MF, Fuss I, Schürmann G, Petters-
tinal Prevotella copri correlates with en- son S, Arnold K, Müller-Lobeck H, et al. Cy-
hanced susceptibility to arthritis. eLife. 2013 17 Thaiss CA, Zeevi D, Levy M, Zilberman-Scha- tokine gene transcription by NF-kappa B
Nov;2:e01202. pira G, Suez J, Tengeler AC, et al. Transking- family members in patients with inflamma-
dom control of microbiota diurnal oscilla- tory bowel disease. Ann N Y Acad Sci. 1998
  6 Miyake S, Kim S, Suda W, Oshima K, Naka- tions promotes metabolic homeostasis. Cell. Nov;859:149–59.
mura M, Matsuoka T, et al. Dysbiosis in the 2014 Oct;159(3):514–29.
gut microbiota of patients with multiple scle- 29 Greten FR, Eckmann L, Greten TF, Park JM,
rosis, with a striking depletion of species be- 18 Herlemann DP, Labrenz M, Jürgens K, Ber- Li ZW, Egan LJ, et al. IKKbeta links inflam-
longing to clostridia XIVa and IV clusters. tilsson S, Waniek JJ, Andersson AF. Transi- mation and tumorigenesis in a mouse model
PLoS One. 2015 Sep;10(9):e0137429. tions in bacterial communities along the of colitis-associated cancer. Cell. 2004 Aug;
2000 km salinity gradient of the Baltic Sea. 118(3):285–96.
  7 Abdollahi-Roodsaz S, Joosten LA, Koenders ISME J. 2011 Oct;5(10):1571–9.
MI, Devesa I, Roelofs MF, Radstake TR, et al. 30 Khan KJ, Ullman TA, Ford AC, Abreu MT,
Stimulation of TLR2 and TLR4 differentially 19 Edgar RC. MUSCLE: a multiple sequence Abadir A, Marshall JK, et al. Antibiotic ther-
skews the balance of T cells in a mouse model alignment method with reduced time and apy in inflammatory bowel disease: a system-
of arthritis. J Clin Invest. 2008 Jan;118(1): space complexity. BMC Bioinformatics. 2004 atic review and meta-analysis. Am J Gastro-
205–16. Aug;5(1):113. enterol. 2011 Apr;106(4):661–73.

 8 Sadlack B, Merz H, Schorle H, Schimpl A, 20 Chen J, Bittinger K, Charlson ES, Hoffmann 31 Mansell A, Smith R, Doyle SL, Gray P, Fenner
Feller AC, Horak I. Ulcerative colitis-like dis- C, Lewis J, Wu GD, et al. Associating micro- JE, Crack PJ, et al. Suppressor of cytokine sig-
ease in mice with a disrupted interleukin-2 biome composition with environmental co- naling 1 negatively regulates Toll-like recep-
gene. Cell. 1993 Oct;75(2):253–61. variates using generalized UniFrac distances. tor signaling by mediating Mal degradation.
Bioinformatics. 2012 Aug;28(16):2106–13. Nat Immunol. 2006 Feb;7(2):148–55.
  9 Sellon RK, Tonkonogy S, Schultz M, Dieleman
LA, Grenther W, Balish E, et al. Resident en- 21 Plantinga A, Zhan X, Zhao N, Chen J, Jenq RR, 32 Kawai T, Akira S. Signaling to NF-kappaB by
teric bacteria are necessary for development of Wu MC. MiRKAT-S: a community-level test Toll-like receptors. Trends Mol Med. 2007
spontaneous colitis and immune system acti- of association between the microbiota and Nov;13(11):460–9.
vation in interleukin-10-deficient mice. Infect survival times. Microbiome. 2017 Feb;5(1):17.
Immun. 1998 Nov;66(11):5224–31. 33 Yamamoto M, Sato S, Hemmi H, Hoshino K,
22 Goecks J, Nekrutenko A, Taylor J; Galaxy Kaisho T, Sanjo H, et al. Role of adaptor TRIF
10 Hanada T, Kobayashi T, Chinen T, Saeki K, Team. Galaxy: a comprehensive approach for in the MyD88-independent toll-like receptor
Takaki H, Koga K, et al. IFNgamma-depen- supporting accessible, reproducible, and signaling pathway. Science. 2003 Aug;
dent, spontaneous development of colorectal transparent computational research in the life 301(5633):640–3.
carcinomas in SOCS1-deficient mice. J Exp sciences. Genome Biol. 2010;11(8):R86.
Med. 2006 Jun;203(6):1391–7. 34 Yamamoto M, Yamazaki S, Uematsu S, Sato
23 Blankenberg D, Von Kuster G, Coraor N, S, Hemmi H, Hoshino K, et al. Regulation of
11 Chinen T, Kobayashi T, Ogata H, Takaesu G, Ananda G, Lazarus R, Mangan M, et al. Gal- Toll/IL-1-receptor-mediated gene expression
Takaki H, Hashimoto M, et al. Suppressor of axy: a web-based genome analysis tool for ex- by the inducible nuclear protein IkappaBzeta.
cytokine signaling-1 regulates inflammatory perimentalists. Curr Protoc Mol Biol 2010; Nature. 2004 Jul;430(6996):218–22.
bowel disease in which both IFNgamma and 89(1):19.10.1-21.
IL-4 are involved. Gastroenterology. 2006
Feb;130(2):373–88.

Dysbiosis due to Lack of SOCS1 Inflamm Intest Dis 2018;3:145–154 153
DOI: 10.1159/000495462

35 Frank DN, St Amand AL, Feldman RA, Boe- 38 Maharshak N, Packey CD, Ellermann M, 42 Tsai HH, Dwarakanath AD, Hart CA, Milton
deker EC, Harpaz N, Pace NR. Molecular- Manick S, Siddle JP, Huh EY, et al. Altered JD, Rhodes JM. Increased faecal mucin sul-
phylogenetic characterization of microbial enteric microbiota ecology in interleukin phatase activity in ulcerative colitis: a poten-
community imbalances in human inflamma- 10-deficient mice during development and tial target for treatment. Gut. 1995 Apr;36(4):
tory bowel diseases. Proc Natl Acad Sci USA. progression of intestinal inflammation. Gut 570–6.
2007 Aug;104(34):13780–5. Microbes. 2013 Jul-Aug;4(4):316–24.
43 Kumar M, Babaei P, Ji B, Nielsen J. Human
36 Willing BP, Dicksved J, Halfvarson J, Anders- 39 Garrett WS, Gallini CA, Yatsunenko T, Mi- gut microbiota and healthy aging: recent de-
son AF, Lucio M, Zheng Z, et al. A pyrose- chaud M, DuBois A, Delaney ML, et al. En- velopments and future prospective. Nutr
quencing study in twins shows that gastro­ terobacteriaceae act in concert with the gut Healthy Aging. 2016 Oct;4(1):3–16.
intestinal microbial profiles vary with in­ microbiota to induce spontaneous and mater-
flammatory bowel disease phenotypes. nally transmitted colitis. Cell Host Microbe. 44 Lankelma JM, Belzer C, Hoogendijk AJ, de
Gastroenterology. 2010 Dec;139(6):1844– 2010 Sep;8(3):292–300. Vos AF, de Vos WM, van der Poll T, et al.
1854.e1. Antibiotic-Induced Gut Microbiota Disrup-
40 Elinav E, Strowig T, Kau AL, Henao-Mejia J, tion Decreases TNF-α Release by Mononucle-
37 Tong M, Li X, Wegener Parfrey L, Roth B, Ip- Thaiss CA, Booth CJ, et al. NLRP6 inflamma- ar Cells in Healthy Adults. Clin Transl Gas-
politi A, Wei B, et al. A modular organization some regulates colonic microbial ecology and troenterol. 2016 Aug;7(8):e186.
of the human intestinal mucosal microbiota risk for colitis. Cell. 2011 May;145(5):745–57.
and its association with inflammatory bowel
disease. PLoS One. 2013 Nov;8(11):e80702. 41 Wright DP, Rosendale DI, Robertson AM.
Prevotella enzymes involved in mucin oligo-
saccharide degradation and evidence for a
small operon of genes expressed during
growth on mucin. FEMS Microbiol Lett. 2000
Sep;190(1):73–9.

154 Inflamm Intest Dis 2018;3:145–154 Gendo et al.

DOI: 10.1159/000495462