UFH Research Report 2021/2022

University of Fort Hare

RESEARCH
REPORT

2021/2022

Towards a Decade of Renewal

Research Report 2021/2022 | 1





Foreword As the University of Fort Hare at the
start of this year began implementing
Professor Sakhela Buhlungu, its 2022-2026 Strategic Plan
Vice Chancellor and Principal focused on institutional renewal, it
is important to showcase our recent
1 | University of Fort Hare research. Given the UFH’s unique
location and specific context, we
aim to produce research that is
both locally responsive and globally
relevant and impactful. For the
period 2021-2022, we have achieved
excellence in several research
areas as well as in the financial and
administrative management of our
institutional resources that support
research endeavours. Our aim is to
create an enabling environment for
our researchers, and to cultivate an
institutional culture that nurtures
young researchers and values the
quality and depth of our research
output.

As I write to you, 39 academics have
received NRF-ratings, demonstrating
a solid upward trajectory. This
achievement goes a long way towards
positioning UFH as a research-focused
university that has a strong and visible
footprint regionally, nationally and
internationally. We have also been
working on building, formalising and
strengthening our Research Niche
Areas (RNAs). In addition, significant
shifts have taken place in terms of
support for researchers and the
establishment of a proper research
office. Following the formal approval of
the Research Rewards Policy and the
SOPs for operationalizing the policy,
research cost centres were created

The University is indeed making significant strides towards achieving its vision of
becoming ’a distinctive African university, advancing excellence and innovation in
research, teaching, learning, administration, and social engagement‘

for 289 researchers who were due conditions in order to continue ranking. Earlier this year, UFH also
to receive research incentive funds conducting research. Moreover, our performed well in the Scimago
emanating from DHET-approved UFH researchers turned the lens Institutions (SI) Rankings, where, in
research outputs for 2020. The on the Covid-19 pandemic itself, the overall ranking for South African
created research cost centres allow and investigated the consequences higher education institutions – which
funds to roll over indefinitely in order thereof and shifts it produced, so that considered research, societal impact
to enable researchers to build up it became a research area in its own and innovation – UFH was clustered
their research funds until they have right. in the second quartile. In terms
enough funds available to carry out of South African universities, the
their research activities. None of these achievements would University of Fort Hare was placed
have been possible without our UFH in the 12th position with 23 South
The University also received researchers, postdoctoral fellows, African institutions listed. There are,
an unqualified audit for Grant postgraduate students, research and of course, many university ranking
Management from the National finance support staff, funders, donors indexes available, and the UFH does
Research Foundation’s auditors in and the communities that we engage not participate in all rankings or
August 2022. The audit highlighted with within the province and beyond. perform equally well in all of these. We
that findings identified in previous The University is indeed making are therefore focused on doing the
audit cycles from 2016 had been significant strides towards achieving right things at the University, in the
addressed effectively, and the 2022 its vision of becoming ’a distinctive knowledge that this will also reflect
audit tests performed showed that African university, advancing in the University’s position on ranking
the UFH Research and Innovation excellence and innovation in research, indexes, without placing undue focus
Office now fully complies with NRF teaching, learning, administration, on chasing rankings. Doing the right
grant conditions and the Master Fund and social engagement‘. things means, in the first instance,
Administration Agreement. The audit investing in our researchers, inducting
verified the accuracy and validity of Whilst our UFH 2021-2022 Research our students in research methods
transactions and compliance with Report showcases only some of our early on in their training, and, perhaps
pertinent UFH policies that include outstanding research projects, it does most importantly, encouraging and
procurement and travel policies. not cover all our research activities. rewarding the kind of intellectual
Independent external auditors also I have no doubt, however, that the curiosity and tenacity that produce
reported zero findings in 2022, glimpse it provides of the diverse truly extraordinary research.
corroborating the findings of the NRF range of research and the innovative
audit. thinking underpinning these research
projects demonstrates that research
Although our research activities since is the cornerstone of our renewal
early 2020 were negatively affected programme.
by the Covid-19 pandemic and the
related lockdowns, which hindered Recently, the University of Fort Hare
fieldwork and data collection, our was ranked on the prestigious Times
researchers demonstrated resilience Higher Education World University
and adaptability. This enabled Rankings, one of only fifteen South
them to navigate the restrictive African universities to receive a

Research Report 2021/2022 | 2

3 | University of Fort Hare

Introduction

Dr Nthabi Taole-Mjimba,
Deputy Vice-Chancellor: Research, Partnerships and Innovation

The University of Fort Hare’s (UFH) 2021-2022 Research
Report provides a succinct but comprehensive overview
of some of the excellent research activities conducted by
our researchers, postdoctoral fellows and postgraduate
students. It is not possible to cover all the activities of
researchers at the University in a single annual report.
What is presented here is therefore but a sample of our
research strengths and achievements.

The report showcases research conducted in a number of
knowledge areas including the Science and Agriculture, the
Health Sciences, Law and Management and Commerce. It
also highlights work done on renewable energy, a focus
area with the potential to benefit all humankind regardless
of their location in the world.

At UFH recognition of excellence in research is achieved
by means of the Vice Chancellor’s awards for emerging
researchers and established researchers. Awards are
made to an overall winner in each category as well as
to winners at faculty level. In order to foster innovation,
two additional awards have been introduced: an award
for the development of the most innovative prototype
and another for the most novel pre-commercialization
product, service or process developed by institutional
researchers.

Partnerships with other universities are important in
enhancing the standing of the University at regional,
national and international levels. Partnerships exist with
institutions in Africa, Europe, Asia, South America and
North America and are evidence of the extent to which
collaboration with us is valued. This report provides
but a glimpse of some of the research activities that
strengthened our research and innovation profile and our
ranking. I hope you will enjoy reading about the work of
our researchers and what they have achieved.

Research Report 2021/2022 | 4

Contents

1 | University of Fort Hare at a glance................................................................................................ 7
2 | Natural and Agricultural Sciences................................................................................................. 9

Smart energy systems and sustainable development studies at the Fort Hare Institute of
Technology ..................................................................................................................................................................11
Helping farmers to adapt to climate change.......................................................................................................13
Vulnerability and flooding: Paving the way for South Africa to deal with climate change........................15
Reducing goat kid mortality: Another UFH project benefits local communities.........................................17
UFH team takes us a step forward in addressing antibiotic resistance.......................................................19
Synthesis of silica nanoparticles doped with zinc cation for the removal of bacteria DNA
harboring antibiotic resistance genes from aqueous solution.......................................................................21
Making choices for the future: UFH research informs thinking about the feasibility of
rooftop solar systems...............................................................................................................................................25
3 | Health Sciences.............................................................................................................................. 27
Identifying misconceptions about tuberculosis: A step forward in developing effective
awareness campaigns...............................................................................................................................................29
The link between crime and mental health in South Africa.............................................................................31
Making a difference in the health of local communities: The work of the HIV/ AIDS Research
Group............................................................................................................................................................................33
Learning from African Traditional Medicine: Fort Hare researcher leads the way....................................35
Keeping active: promoting the benefits of physical activity and exercise for pregnant women............37
Promoting exercise and healthy eating amongst farmers...............................................................................39

5 | University of Fort Hare

4 | Management and Commerce....................................................................................................... 41
Using technology in teaching and learning: Important insights from Fort Hare study.............................43
Forging partnerships for excellence - The role of the African University.....................................................45
Improving service delivery through e-government............................................................................................47
Pandemics and infodemics: the importance of providing trustworthy information.................................49
An alternative to the universities? Investigating service quality at TVET Colleges......................................51
UFH-based accredited journal contributes to renewal of local government..............................................53

5 | Legal Issues..................................................................................................................................... 55
Free trade and the human right to food: The need to re-theorise and review international
agricultural trade regulation....................................................................................................................................57
The role of the judiciary in achieving the goals of the 2030 Agenda for Sustainable
Development in South Africa...................................................................................................................................59
Two heads are better than one: Assessing South Africa’s ‘twin-peaks’ financial regulation model.......61
Company law and investor confidence: Analysing Zimbabwe’s new Companies and Other
Business Entities Act..................................................................................................................................................63
Getting to school and the right to basic education...........................................................................................65

6 | Vice Chancellor’s Research Awards............................................................................................. 67
VC’s Senior Researcher Awards..............................................................................................................................69
VC’s Emerging Researcher Awards........................................................................................................................72
VC’s Innovation Awards.............................................................................................................................................74
VC’s Awards for Newly NRF-rated Researchers..................................................................................................75

Acknowledgements............................................................................................................................. 79

Research Report 2021/2022 | 6

University of
Fort Hare at
a glance

B3 Faculty/ NRF-Rating Total
Y2 Research Centre
B3 C1 C2 C3 Y2
39 C1
Science & Agriculture 1 3 8 6 3 21

Law 111 3

Health Sciences 11 2

NRF Rated Social Sciences 13 21 7
Researchers
Management & 22 4
C3 C2 Commerce 11 2
7 11 12 7 39
Centre for Leadership 2
Ethics in Africa (CLEA)

Total

85,63% 52,63%
South
South African

2022 Graduation African 160 57

(2021 Academic year) masters doctoral
graduates graduates

14,37% 47,37%
foreign foreign

7 | University of Fort Hare

2022 Masters Students Registrations

Masters registrations according to faculty and nationality (2022)

Education 100 150 200 250
Health Sciences South African Foreign
Law
Management & Commerce
Science & Agriculture
Social Sciences & Humanities
0 50

93,2% 868 6,8 % female 55,3% male
South foreign female
African masters students
students

2022 Doctoral Registrations

Doctoral registrations according to faculty and nationality (2022)

Education
Health Sciences
Law
Management & Commerce
Science & Agriculture
Social Sciences & Humanities

0 20 40 60 80 100 120 140
South African Foreign

69,84% 451 30,16% female 51,22% male
South foreign
African doctoral female
students students

Research Report 2021/2022 | 8

9 | University of Fort Hare

Natural and
Agricultural
Sciences

Research Report 2021/2022 | 10

NATUR AL AND AGRICULTUR AL SCIENCES

Smart energy systems and
sustainable development
studies at the Fort Hare
Institute of Technology

Professor Edson L. Meyer

Global warming and the Professor Edson L. Meyer solar power means that areas that
climate change associated would otherwise have been available
with it mean that ensuring installed are sometimes made worse to grow crops are reduced. In addition,
our planet remains by defects in their manufacture. large-scale solar generation projects
habitable for generations Researchers at the UFH Institute of do not often involve participation from
in the future is enormously Technology, located in SolarWatt communities in the area or result in
important. Thankfully, Park on the Alice Campus, are now job opportunities once the systems
scientists at the Fort Hare conducting studies which aim to have been installed. However, using
Institute of Technology detect and classify defects in PV land for both PV power generation
under the leadership of systems and which also identify the and agriculture has the potential to
Director Professor Edson L. way in which they degrade. change all this, and this has resulted
Meyer have been working in UFH scientists becoming interested
to achieve this very goal In South Africa, the potential of in ‘agrovoltaic’ projects.
thanks to research focused photovoltaics (PV) as a renewable
on solar energy technology, technology has resulted in the large- Studies on agrovoltaic projects show
bio energy engineering, scale usage of land to harvest solar
smart energy systems and energy. The use of land to generate
sustainable development.

Photovoltaic (PV) systems that
convert power from the sun
into clean, sustainable, cheap
energy are increasing in popularity,
with houses, shopping complexes
and other buildings now sporting
the panels that make this possible
on their rooftops. Often, these
systems have to endure extreme
environmental conditions which
contribute to their ageing rate and
deterioration. Problems resulting
from harsh conditions in the outdoor
environments in which they are

11 | University of Fort Hare

NATUR AL AND AGRICULTUR AL SCIENCES

Figure 1: Daylighting assessment of a heritage building using CBDM

that plants utilise about two-thirds of The evolution in lighting technology illuminance data in weather files to
the daily solar radiation in a system has meant that the old-fashioned do this. Analysis using the Climate-
and that yield from crops grown light bulbs and fluorescent tubes Based Daylight Model (CBDM) made
underneath the photovoltaic modules of the past have been replaced by it possible to assess the impact of
increases. If agrovoltaic systems are innovations such as Light Emitting daylighting on energy-use intensity
introduced, land efficiency can be Diodes (LEDs) and incandescent and thermal behaviour in the
increased by up to 186%. In addition, and magnetic ballast fluorescent building. The study showed that using
workers from local communities fittings. These have reduced the automated on/off sensors would
can become involved in agricultural amount of electricity needed to reduce annual lighting energy savings
production, and communities benefit provide light in buildings. In spite of by 52% while continuous dimming
from job creation. If drip irrigation these developments, daylight is still would result in energy savings of 64%.
and agroponic systems are also the only free, zero-energy and zero- The study also showed that lighting
introduced, water is conserved carbon light source. In addition to energy costs would be reduced by 50%
and a further step is taken towards these benefits, studies have shown by using on/off sensors and by 62% by
sustainability. Regenerative farming that daylighting improves well- using continuous dimming sensors.
methods using minimum fertiliser being, health, and productivity in the Importantly, CO2 emissions due to
can then result in the increased workplace. annual lighting energy consumption
retention of water in the soil. When in this building were mitigated by
agrovoltaic systems are established in Researchers at the UFH Institute of 52% and 64% using automated on/
urban areas in the form of inner-city Technology are exploring the use off and continuous dimming sensors,
gardening, the temperatures in ‘heat of daylighting in residential and respectively. These examples of some
islands’ are reduced. All this means commercial buildings in the context of the studies conducted by the UFH
that the promise of renewable energy of the need to conserve energy. One Institute of Technology show how
and an increase in the availability study has involved research on the UFH researchers are contributing
of food resulting from agrovoltaic daylight performance of Livingstone to sustainable futures in meaningful
projects underlines the importance of Hall on the Alice campus. ways.
the research being done in the UFH
Institute of Technology. The study drew on sky conditions and
models based on solar irradiance and

Research Report 2021/2022 | 12

NATUR AL AND AGRICULTUR AL SCIENCES

Helping farmers to adapt to
climate change

Martin Chari and Dr Leocadia Zhou

Dr Leocadia Zhou problems and other challenges that Fortunately, remote sensing, a
continue to threaten resource-poor technique that involves detecting
Alleviating the impact of global communities. energy that is reflected from the earth,
warming and climate change is provides a means of overcoming
the focus of a study conducted Predictions are that global warming these limitations. The research team
by doctoral candidate Martin Chari, will result in some areas being therefore embarked on a study that
under the supervision of Professor more susceptible to flooding, while aimed to identify what needed to be
Hamisai Hamandawana of the others are expected to suffer from done to ensure that remote sensing
University of the Free State’s Risk and unpredictable failures in rainfall. could used more fully by the small-
Vulnerability Science Centre (RVSC) Although farmers may try to adapt scale farmers whose lives it could
and Dr Leocadia Zhou of the RSCV to changing rainfall patterns by benefit.
at the University of Fort Hare. The shifting from the production of food
study aims to support farmers whose crops to rearing livestock, this is The study was based on a review
livelihoods are largely dependent on not necessarily a positive solution of articles in the Web of Science
rain-fed agriculture and demonstrates as a rise in livestock numbers publications between 1999 and 2019.
the willingness and commitment will lead to an escalation in the Overall, the team identified 1,337
of UFH researchers to address production of green-house gases articles focusing on soil moisture,
pressing climate-change related and a consequent increase in global 172 of which finally emerged as
warming. peer-reviewed articles that used
techniques to estimate soil moisture
One way of addressing changes which then led to the use of strategies
in rainfall patterns is to provide intended to cope with climate change.
farmers with usable information In accounting for the marginal
on how to overcome a reduction use of remote sensing techniques
in the amount of moisture in in the papers they reviewed, the
soil by adopting climate-friendly researchers concluded that this was
farming practices. However, doing because most African countries have
this requires information about soil limited access to appropriately scaled
moisture at levels of spatial detail images. This then led the team to
that meet the needs of farmers argue that the best way forward is to
themselves. Although the literature formulate techniques that use freely
offers information on a wide range accessible coarse resolution images
of techniques used to estimate to provide much needed information.
soil moisture, most are difficult to
implement because they rely on high- The contribution made by Martin
resolution datasets most developing Chari and his supervisors is valuable
countries cannot afford, are labour because it shows what needs to be
intensive and time consuming, and done in order to enhance the ability
are also incapable of providing the of farmers to adapt to changes in soil
information at a level that is usable by moisture driven by climate change.
small-scale farmers.

13 | University of Fort Hare

NATUR AL AND AGRICULTUR AL SCIENCES

Reference:
Chari, M.M., Hamandawana, H., Zhou, L. 2022. ‘Integrating Remotely Sensed Soil Moisture in Assessing the Effects
of Climate Change on Food Production: A Review of Applications in Crop Production in Africa.’ In: Leal Filho, W.,
Djekic, I., Smetana, S., Kovaleva, M. (eds) Handbook of Climate Change Across the Food Supply Chain. Climate
Change Management. Springer, Cham. https://doi.org/10.1007/978-3-030-87934-1_12

14 | University of Fort Hare

NATUR AL AND AGRICULTUR AL SCIENCES

Vulnerability and flooding:
Paving the way for South
Africa to deal with climate
change

One of the most common predictions made in Learning from past flooding events
relation to global warming is that, regardless of the in order to plan for the future is
country in which we live, we will experience extreme therefore hugely important, a point
weather events, such as increased flooding. In a not missed by a team of researchers
country such as South Africa, where large numbers comprising Dr Saul Ngarava and Dr
of people live in informal settlements and insecure Leocardia Zhou from the Risk and
housing, floods have the potential to cause Vulnerability Science Centre (RVSC) at
enormous suffering. the University of Fort Hare (UFH) and
Professor Abbyssinia Mushuje from the
Floods in Durban 2022 University’s Department of Economics.
The team also included Dr Petronella
15 | University of Fort Hare Chaminuka from the Economic Analysis
Unit at the Agricultural Research
Council, testimony to the ability of
Fort Hare researchers to network and
collaborate with colleagues working in
research councils and other entities
external to the universities.

A recent flooding event in Port St
Johns in April 2019, when 190mm of
rain fell in 24 hours, devastated local
communities. Extraordinarily high
rainfall coupled with high oceanic
tides that pushed the Mzimvubu
River water back upstream caused
the river to burst its banks resulting
in low lying settlements being cut off
and hundreds of residents having
to be evacuated. The research
team therefore put their skills and
knowledge to use and designed a
semi-structured questionnaire that
was administered to 195 residents
in the area in order to determine
the exposure, susceptibility and
resilience of communities to flooding.

NATUR AL AND AGRICULTUR AL SCIENCES

Floods in Durban 2022

A multiplicative method drawing on levels, and a lack of alternative forms of Reference:
these indicators was then used to livelihood, residing on slopes and flood
develop a Flood Vulnerability Index prone areas meant that communities Ngarava, S., Zhou, L., Mushunje,
(FVI). were vulnerable economically and
environmentally. A., Chaminuka, P. (2021).
As a result of their research, the team
found that, because of its topography, In April 2022, floods in Durban resulted Vulnerability of Settlements to
Port St Johns was particularly in more than 300 people losing
vulnerable to the impact of floods. their lives and once again showed Floods in South Africa: A Focus
People living in informal settlements how vulnerable many South African
were most likely to be physically and communities are to flooding and on Port St Johns. In: Nhamo,
socially vulnerable because of blocked affirmed the work of the UFH team,
drainage systems, impermanent, which has now appeared as a chapter G., Chapungu, L. (eds) The
poorly designed and badly in a book published by international
constructed shelters, a lack of storm publisher Springer. The chapter paves Increasing Risk of Floods and
water infrastructure, overcrowding the way for more research of this
and high levels of poverty. In rural nature if South Africa is to prepare Tornadoes in Southern Africa.
settlements characterised by high itself for the future.
levels of unemployment, low-income Sustainable Development

Goals Series. Springer, Cham.

https://0-doi.org.wam.

sealsac.za/10.1007/978-3-030-

74192-1_12

Research Report 2021/2022 | 16

NATUR AL AND AGRICULTUR AL SCIENCES

Reducing goat kid
mortality: Another
UFH project
benefits local
communities

Dr M. Slayi, Dr Leocadia Zhou, Dr Thobela Tyasi and
Dr Ishmael Jaja

The commitment of researchers to find ways of improving the
from the University of Fort Hare survival rates of kids. Interventions
to use their knowledge for the included fortnightly dipping to control
benefit of local communities was parasites, supplying food to pregnant
demonstrated once again in a project and lactating does, providing shelters
led by Dr Mhlangabezi Slayi of the and improving hygiene. Traditionally,
Risk and Vulnerability Science Centre community members had relied
(RVSC) in the Faculty of Science and on indigenous remedies to cure
Agriculture. sickness. The project made veterinary
assistance and medication available
Goats are owned by many small-scale when needed.
farmers in South Africa, with more
than 50% of the total goat population In the first year of the project, 132
of the country being raised in rural of the 235 (56.17%) kids born in the
areas of the Eastern Cape. For many villages studied died. By year two,
families, rearing goats provides however, the impact of the project
enormous socio-economic benefits, was such that the mortality rate was
so high mortality rates amongst kid reduced to 22.38%, with only 62 of
goats prevent them from optimising the 277 kids born in the year dying.
what should be a major source of The reduction in the mortality rate
income and well-being. was particularly significant in kids
aged younger than 45 days.
The two-year project led by Dr
Slayi aimed not only to confirm the In their paper published in the
identification of the major causes of prestigious international journal,
goat mortality in community flocks Tropical Animal Health and
(identified by farmers themselves in a Production, Dr Slayi and fellow team
project conducted in 2014), but also members Dr Leocadia Zhou, Dr
to work with community members Thobela Tyasi and Dr Ishmael Jaja

17 | University of Fort Hare

NATUR AL AND AGRICULTUR AL SCIENCES

identify the project as having enjoyed Support from the government and Reference:
‘moderate success’ in reducing kid private research institutions for
mortality. Outsiders would probably the establishment and facilitation Slayi, M., Zhou, L., Tyasi, T.L. &
consider the success as more than of control programmes, as well as Jaja, I. 2022. ‘A community based
moderate, however, especially as the for the funding of research on the intervention approach to control
project also provided major insights effects of disease and climate on goat disease outbreaks and climate
into the impact of major diseases production, is inadequate. However, related deaths in communally
and climate related events on goat Fort Hare researchers have once raised goat kids in the Eastern Cape
production, which will serve both again shown how scholarship and Province, South Africa.’ Tropical
researchers and farmers into the commitment can be of benefit to local Animal Health and Production,
future. communities as well as to science 54: 140 https://doi.org/10.1007/
more generally. s11250-022-03143-5

Research Report 2021/2022 | 18

NATUR AL AND AGRICULTUR AL SCIENCES

UFH team takes us a step
forward in addressing
antibiotic resistance

Adaora Ezeuko and Eric Anthony

The introduction of penicillin in had the potential to become much people admitted for treatment, who
the 1940s heralded a new era greater threats to health and life then have to contend with a life-
of medical practice. Doctors was greatly increased. However, for threatening bacterial infection as well
and healers had battled bacterial years now, scientists and doctors as the original disease, and, of course,
infections for centuries, and the have been warning about the abuse we are all aware of drug resistant
discovery of an antibiotic that would of antibiotics and the development of TB because of its effect on many
kill bacteria meant surgery suddenly drug resistant strains of bacteria that members of our own communities.
became safer, the chances of healing threaten human lives.
from injuries became stronger, and Scientists have been able to identify
the ability to combat simple ailments So-called ‘superbugs’ in hospitals the genes that are implicated in
like sore throats and bronchitis that can have devastating effects on resistance to antibiotics for some time

19 | University of Fort Hare

NATUR AL AND AGRICULTUR AL SCIENCES

now. Water is one of the main routes also a member of the Microbial Water the resulting compound was used in
by which antibiotic resistant genes Quality Monitoring Centre. Professor an experiment aimed at the removal
(ARGs) are spread, and freshwater, Omobola Okoh is a Lecturer in the of an antibiotic-resistant bacterium
surface water, drinking water and Department of Pure and Applied named Listeria monocytogene.
wastewater have all been identified Chemistry and is linked to the
as carrying them. Of all these, Microbial Water Quality Monitoring Previous testing had shown that
wastewater is a particular ‘hotspot’, Centre while Professor Anthony Okoh Listeria monocytogene was resistant
and the quest is on to combat the is a lecturer in the Department of to sulfamethoxazole, erythromycin,
proliferation and spread of ARGs in Biochemistry and Microbiology and streptomycin, amoxicillin, and
this particular water source. is also linked with the Department tetracycline, antibiotics often used
of Environmental Health Sciences in by doctors as the first line of defence
Adsorption technology is one method the College of Health Sciences at the against infection. Through painstaking
that has been identified as having University of Sharjah in the United and rigorous research, the UFH
the potential to combat ARGs in Arab Emirates. Professor Okoh is also research team was able to show that
wastewater. Its cost effectiveness a member of the Microbial Water the mesoporous silica nanoparticles
is just one of the reasons why the Quality Monitoring Centre at UFH. doped with zinc cation (SiO2@Zn2+)
technique attracted the attention of were effective in removing bacterial
a team of prestigious and emerging The attention of the research team DNA conveying antibiotic resistance
scientists from the University of was drawn to the use of metallic genes from water. The team went
Fort Hare (UFH). Emerging scientists oxides in adsorption technology. further than this broad observation,
Adaora Ezeuko and Eric Anthony are Metal oxide nanoparticles have a however, as they also explored how
PhD scholars in the Department of large surface area and have been different operating parameters (such
Pure and Applied Chemistry at UFH shown to be effective in removing as the time concentration profile
and are also linked to the Microbial organic and inorganic pollutants and the adsorbent dose) influenced
Water Quality Monitoring Centre. Both in previous studies conducted by adsorption and enhanced the
doctoral candidates have conducted Professors O. Okoh, Professor removal of bacterial DNA.
research on the removal of ARGs A. Okoh, and Dr Ojemaye. Zinc
from water using nanomaterials as an Oxide (ZnO) is typical of the class of It is unlikely that anyone reading this
adsorbents. Testimony to the quality adsorbents that are very effective in article will not have needed antibiotics
of the training they have received at eradicating diverse pollutants from in their lifetime. The idea that
UFH is the fact that both students water/wastewater. In this latest study antibiotics may not be available in the
already have three publications involving the UFH team, mesoporous future to treat ailments and diseases
under their belts with Adaora Ezeuko silica nanoparticles doped with Zinc to which we are all susceptible is little
expecting a fourth imminently. Fellow cation (SiO2@Zn2+) were used. To short of horrifying. However, thanks
team member Dr Mike Ojemaye is a test this method, the team first had to the work of this UFH research
research fellow in the Department of to develop a technique to incorporate team, the world is a step nearer to
Pure and Applied Chemistry and is zinc cation onto silica oxide before avoiding what is feared so widely.

Research Report 2021/2022 | 20

NATUR AL AND AGRICULTUR AL SCIENCES

Synthesis of silica nanoparticles
doped with zinc cation for the
removal of bacteria DNA harboring
antibiotic resistance genes from
aqueous solution

Adaora S. Ezeuko1,2, Eric T. Anthony1,2, Mike O. Ojemaye1,2 Omobola O. Okoh1,2,
and Anthony I. Okoh*2.

1 Department of Pure and Applied Chemistry, University of Fort Hare, Alice 5700, South Africa.
2 SAMRC, Microbial Water Quality Monitoring Centre, University of Fort Hare, Alice, South Africa.
Corresponding Author: [email protected]

Abstract:

This study investigated the removal of bacterial DNA from aqueous solution
using silica oxide nanoparticles doped with zinc cation (SiO2@Zn2+). The
authenticity of the adsorbent was confirmed by scanning electron microscopy

(SEM) coupled with energy-dispersive x-ray spectroscopy (EDX). Adsorption

studies involving two operating conditions (time-concentration profile and

adsorbent dose) showed increased removal efficiency during the adsorption of

bacterial DNA by SiO2@Zn2+. We conclude that SiO2@Zn2+ may be a promising
adsorbent that can tackle the consequences of ARGs infected water.

1.0. Introduction

The gain in the fight against bacterial infection has been short-lived due to the

development and subsequent proliferation of antibiotic-resistance genes (ARGs)

(Le et al., 2018). ARGs render antibiotics ineffective in the treatment of bacterial

infections. Water bodies are one of the most important routes for the spread of

ARGs. Thus, abundant ARGs have been detected in freshwater, surface water,

drinking water, and wastewater (Zhang et al., 2009). While the presence of Professor Anthony I. Okoh
naturally occurring minerals enhances the spread of ARGs in fresh and surface

water, the hotspot for the enrichment of ARGs has been wastewater, incredibly

wastewater rich in antibiotics (Ezeuko et al., 2021b). In the quest to combat the proliferation of ARGs in water bodies,

adsorption technology has been proposed as a cost-effective technique for the removal of ARGs (Eric et al., 2021), and

the application of metallic oxides has been applied for this purpose (Ezeuko et al., 2021a).

In adsorption technology, the specific surface area as well as physical and chemical affinities of the adsorbent towards the
adsorbate are essential criteria of an adsorbent (Song et al., 1998). Metal oxide nanoparticles possesses a large specific
surface area (Chew et al., 2010) and has been used as an adsorbent to remove organic and inorganic pollutants (Ojemaye
et al., 2017; Ojemaye & Okoh, 2019). ZnO is a typical adsorbent used to combat the proliferation of antibiotic-resistant
bacteria-harboring ARGs due to their bacteriostatic tendencies (Eric et al., 2022). In lieu, in this study, mesoporous silica
nanoparticles doped with zinc cation (SiO2@Zn2+) were synthesized via the combustion protocol and used to remove
bacterial DNA harboring ARGs, free-cell DNA of Listeria monocytegene present in aqueous solution.

21 | University of Fort Hare

NATUR AL AND AGRICULTUR AL SCIENCES

2.0. Materials and methods

2.1. Synthesis and characterization of SiO2@Zn2+

Incorporation of Zn2+ cation onto SiO2 was achieved according to the procedure or method described in literature with
slight modifications (Chen et al., 2020). 2 g of cetyltrimethylammonium bromide (CTAB) and 4 mL of NaOH were dissolved
into 50 mL deionized water. The solution was stirred on the mantle for 1h at 70 oC. 5 mL of tetraothorsilicate (TEOS) and
nitric acid (HNO3) was added after a minute. The solution was further stirred for 30 minutes at 60 oC. Then, 0.02 M of
zinc nitrate (N2O6Zn.6H20) was added in the ratio 1:1 of Zn:TEOS. All particles were further stirred for 2 h before being
separated and centrifuge. Then, the particles were washed three times with distilled water and dried overnight in an oven
at 50 oC. The cation-containing particles were calcined at 550 oC for 18 h to remove the remaining CTAB and nitrite. The
surface morphology and elemental compositions were achieved using scanning electron microscope (SEM) coupled with
energy dispersive x-ray spectroscope (EDX) (JOEL JSM-6390LVSEM), respectively.

2.2. Extraction and molecular characterization of bacterial DNA

The antibiotic-resistant Listeria monocytogene bacteria used in this study were obtained from our laboratory archives
isolated from food and vegetables. Before the commencement of genomic DNA extraction, the bacteria isolate was
subjected to an antibiotic susceptible test (Humphries et al., 2021). The extraction was carried out according to the
method described in literature (Ribeiro et al., 2016). The test for antibiotic resistance genes was conducted using the
primers and PCR conditions of the targeted resistance gene shown in Table 1.

Table 1: Primer sequence, expected product size, and PCR protocol used for the
amplification of resistance genes.

Antibiotic PCR Primer sequences Product PCR protocols References
Class primers size (bp)
F: GCTACATCCTGCTTGCCTTC 94 °C – 5 min; 35[94 °C – 1 min; 55 °C – (Titilawo et
Tetracyclines tetA R: CATAGATCGCCGTGAAGAGG 210 1 min; 72 °C 1½ min]; 72 °C – 5 min. al., 2015)

2.3. Batch adsorption study

Bacterial DNA (2 mL) was used to contaminate nuclease-free water (NFW). 20 mg of SiO2@Zn2+ as adsorbent was weighed
and added to the prepared contaminated NFW for the batch adsorption study according to the method described in
literature (Ezeuko et al., 2022). Effect of contact time (0-80 mins), initial DNA concentrations (7.28 µg/mL), and adsorbent
dose (10-30 mg) on DNA removal were investigated. The optimum parameters were determined and adopted during the
experimentation. The percentage removal efficiency (%R) in all the solutions was calculated using Equation (1) described
by (Panahi et al., 2019).

Where Ci and Cf are the initial and final concentrations of DNA
measured in µg/mL, and % R is the removal efficiency.

3.0. Result and discussion

3.1. Antibiotic susceptibility test (AST)/molecular characterization of genomic DNA

The AST test showed that Listeria monocytogenes (bacteria isolates) were resistant to sulfamethoxazole, erythromycin,
streptomycin, amoxicillin, and tetracycline. The determination of resistance genes was achieved by visualizing the PCR
product amplifications containing genomic DNA using gel electrophoresis, indicating that bacteria isolates habors tetA
resistance genes at the molecular weight of 210 bp (Figure 1)

Figure 1. Gel representing tetracycline resistant gene (tetA) amplified

Research Report 2021/2022 | 22

NATUR AL AND AGRICULTUR AL SCIENCES
3.2. Adsorbent characterization
3.2.1. SEM and EDX analysis
The morphology of the adsorbent (SiO2@Zn2+) was determined using the SEM instrument captured at 20 µm. It showed
that the material has an irregular shape and formed some slight aggregates (Figure 2A). The elemental composition
(Figure 2B) showed strong signal for silica (Si) at 2Kev and a medium peak representing zinc (Zn) at 0.5 Kev indicating that
this material is pure and its synthesis was successful.

Figures 2 A and B: Represent SEM images captured at 20 µm and EDX showing the
elemental compositions of SiO2@Zn2+.

3.3. Bacterial DNA removal study
3.3.1. Time-concentration profile
Effect of time as a function of initial DNA concentration was conducted at intervals while maintaining the adsorbent dose
of 20 mg at pH 7.1. It was observed that when contact time was increased from 0 to 80 minutes, percentage adsorption
efficiencies increased from 52.60-71.15% at initial DNA concentration of 7.28 µg/mL (Fig.3A) until removal became stable.
This result is an indication that increase in time leads to increase in the removal of DNA from aqueous solution. The result
is similar to a recently published study (Ezeuko et al., 2022).
3.3.2. Effect of adsorbent dose
The adsorbent dose was studied and it is illustrated in Fig 3B. As expected, the percentage removal of bacteria DNA
rapidly increased with an increase in sorbent mass from 10 to 30 mg. At 30 mg, the optimum removal efficiencies reached
81.73%.

B
A

Figure 3A and B: Effect of A= time-concentration profile and B = adsorbent dose on the removal of bacteria
DNA onto SiO2@Zn2+.

23 | University of Fort Hare

NATUR AL AND AGRICULTUR AL SCIENCES

4.0. Conclusion

The synthesis of SiO2@Zn2+ was successfully achieved and employed for bacteria DNA removal from aqueous solution.
This study showed that different operating parameters (time-concentration profile, and adsorbent dose) influenced the
adsorption process and enhanced the removal of bacterial DNA conveying ARG onto SiO2@Zn2+ from aqueous solution.
Acknowledgments

The authors thank the South Africa Medical Research Council for financial support.

References

Eric A. T, Ojemaye, M. O., Okoh, O. O., & Okoh, A. I. (2022). Le, T. H., Ng, C., Tran, N. H., Chen, H., & Gin, K. Y. H. (2018).
Influence of different Ag/ZnO heterostructures on the Removal of antibiotic residues, antibiotic-resistant
removal efficiency of multidrug-resistant Enterococcus bacteria, and antibiotic resistance genes in municipal
faecium harboring multiple resistance genes from tap wastewater by membrane bioreactor systems. Water
water. Environmental Progress & Sustainable Energy, May, Research, 145, 498–508. https://doi.org/10.1016/j.
1–11. https://doi.org/10.1002/ep.13925. watres.2018.08.060.

Eric A. T, Ojemaye, M. O., Okoh, A. I., & Okoh, O. O. (2021). Ojemaye, M. O., & Okoh, A. I. (2019). Multiple nitrogens
Potentials of low-cost methods for removing antibiotic- functionalized magnetic nanoparticles as an efficient
resistant bacteria and their genes in low-budget adsorbent: synthesis, kinetics, isotherm, and
communities: A review. Journal of Water Process Engineering, thermodynamic studies for removing rhodamine B from
40(October 2020), 101919. https://doi.org/10.1016/j. aqueous solution. Scientific Reports, 9(1), 1–13. https://doi.
jwpe.2021.101919. org/10.1038/s41598-019-45293-x.

Chen, S., Greasley, S. L., Ong, Z. Y., Naruphontjirakul, P., Page, Ojemaye, M. O., Okoh, O. O., & Okoh, A. I. (2017). Adsorption
S. J., Hanna, J. V., Redpath, A. N., Tsigkou, O., Rankin, S., of Cu2+ from aqueous solution by a novel material,
Ryan, M. P., Porter, A. E., & Jones, J. R. (2020). Biodegradable azomethine functionalized magnetic nanoparticles.
zinc-containing mesoporous silica nanoparticles for Separation and Purification Technology, 183, 204–215.
cancer therapy. Materials Today Advances, 6. https://doi. https://doi.org/10.1016/j.seppur.2017.02.055.
org/10.1016/j.mtadv.2020.100066
Panahi, A. H., Ashrafi, S. D., Kamani, H., Khodadadi, M., Lima,
Chew, T.-L., Ahmad, A. L., & Bhatia, S. (2010). Ordered E. C., Mostafapour, F. K., & Mahvi, A. H. (2019). Removal
mesoporous silica (OMS) as an adsorbent and membrane of cephalexin from artificial wastewater by mesoporous
to separate carbon dioxide (CO2). Advances in Colloid and silica materials using Box-Behnken response surface
Interface Science, 153(1), 43–57. https://doi.org/https://doi. methodology. Desalination and Water Treatment, 159, 169–
org/10.1016/j.cis.2009.12.001. 180. https://doi.org/10.5004/dwt.2019.24109.

Ezeuko, A. S., Ojemaye, M. O., Okoh, O. O., & Okoh, A. I. Ribeiro, J. C., Tamanini, R., Soares, B. F., De Oliveira, A. M., De
(2021a). Journal of Water Process Engineering Potentials Godoi Silva, F., Da Silva, F. F., Augusto, N. A., & Beloti, V.
of metallic nanoparticles for removing antibiotic- (2016). The efficiency of boiling and four other methods for
resistant bacteria and antibiotic resistance genes from genomic DNA extraction of deteriorating spore-forming
wastewater : A critical review. Journal of Water Process bacteria from milk. Semina:Ciencias Agrarias, 37(5), 3069–
Engineering, 41(March), 102041. https://doi.org/10.1016/j. 3078. https://doi.org/10.5433/1679-0359.2016v37n5p3069.
jwpe.2021.102041.
Song, H.-K., Won Cho, K., & Lee, K.-H. (1998). Adsorption
Ezeuko, A. S., Ojemaye, M. O., Okoh, O. O., & Okoh, A. I.
(2021b). Technological advancement for eliminating of carbon dioxide on the chemically modified silica
antibiotic resistance genes from wastewater: A review of
their mechanisms and progress. Journal of Environmental adsorbents. Journal of Non-Crystalline Solids, 242(2),
Chemical Engineering (Vol. 9, Issue 5). https://doi.
org/10.1016/j.jece.2021.106183. 69–80. https://doi.org/https://doi.org/10.1016/S0022-

Ezeuko, A. S., Ojemaye, M. O., Okoh, O. O., & Okoh, A. I. 3093(98)00793-5.
(2022). OpenNano The effectiveness of silver nanoparticles
as a clean-up material for water polluted with bacteria Titilawo, Y., Obi, L., & Okoh, A. (2015). Occurrence of virulence
DNA conveying antibiotics resistance genes : Effect of gene signatures associated with diarrhoeagenic and non-
different molar concentrations and competing ions. diarrhoeagenic pathovars of Escherichia coli isolates
OpenNano, 7(July), 100060. https://doi.org/10.1016/j. from some selected rivers in South-Western Nigeria. BMC
onano.2022.100060. Microbiology, 15(1), 1–14. https://doi.org/10.1186/s12866-
015-0540-3.
Humphries, R., Bobenchik, A. M., Hindler, J. A., & Schuetz,
A. N. (2021). Overview of Changes to the Clinical and Wang, Y., Zhou, Y., Zhang, T., He, M., & Bu, X. (2014). Two-
Laboratory Standards Institute Performance Standards dimensional ultrathin nanosheets of Ni-In-layered double
for Antimicrobial Susceptibility Testing, M100, 31st Edition. hydroxides prepared in water enhance DNA adsorption
Journal of Clinical Microbiology, 59(12), e0021321. https:// performance. RSC Advances, 4(57), 29968–29974. https://
doi.org/10.1128/JCM.00213-21. doi.org/10.1039/c3ra47728b.

Zhang, X.-X., Zhang, T., & Fang, H. H. P. (2009). Antibiotic
resistance genes in the water environment. Applied
Microbiology and Biotechnology, 82(3), 397–414. https://doi.
org/10.1007/s00253-008-1829-z.

Research Report 2021/2022 | 24

NATUR AL AND AGRICULTUR AL SCIENCES

Making choices for the future:
UFH research informs thinking
about the feasibility of rooftop
solar systems

Oyeniyi A. Alimi, Edson L. Meyer, Olufemi I. Olayiwola, Ochuko K. Overen

Dr Oyeni A. Alimi summer mean temperature would of five hailstorms has occurred in the
result in a 40% increase in the the Raymond Mhlaba Municipality (RMM)
Concern for the environment severity of hailstorms, which occur and at least two have caused major
along with rising costs and when a thunderstoom updraught lifts damage to infrastructure.
loadshedding has resulted in water droplets above the freezing
an increased number of people and level in the atmosphere. In South A hailstorm that occurred on
businesses turning to solar power for Africa, the mean annual temperature September 30, 2022 was categorised
their energy needs. While there are has increased at least 1.5 times the as H3 on the Tornado and Storm
many benefits to having photovoltaic observed global average increase of Research Organisation (TORRO) scale
(PV) panels installed on rooftops, 0.65°C during the last 50 years as a as it caused considerable damage
systems can be damaged by extreme result of global warming. All this gives to exposed infrastructure including
weather events such as hailstorms. rise to questions about the feasibility rooftop solar PV modules. The TORRO
of solar-powered PV systems if the scale ranges from H0 to H10, where
likelihood of costly damage increases. H0 corresponds to ‘no damage’ and
H10 corresponds to ‘catastrophic
The Misgund area in the Langkloof damage’.
Valley as well as the southern slopes
of the Winterberg Mountains in the Concerns about the adverse effect of
Eastern Cape (north of Somerset East extreme weather events on solar PV
to north of Fort Beaufort) are popular systems led the UFH research team
hailstorm ‘hotspots’ in South Africa. In to investigate their impact on the
the last four months, a record number feasibility of the systems themselves

An experimental analysis conducted Figure 1. Occurrence, severity and cumulative duration of hailstorms in
by a University of Fort Hare research Raymond Mhlaba municipality Dec. 2021 – Sept. 2022
team consisting of Dr Oyeniy Alimi,
Professor Edson Meyer, doctoral
candidate Olufemi I. Olayiwola and
Professor Ochuko Overen showed
that every 1°C increase in the

25 | University of Fort Hare

NATUR AL AND AGRICULTUR AL SCIENCES

result of savings is referred to as the
‘payback time’. The cost of replacing
PV modules significantly damaged by
these hailstorms has been calculated
as R 53,500. All this means that
consideration needs to be given to
whether or not solar PV systems will
be sustainable or financially viable if
adverse weather events increase as
a result of climate change.

Figure 2. Images from the hailstorm event in Alice on September 30, 2022: Given annual solar radiation levels,
(a) dimension of some hailstones, (b) damaged property and (c) impact of Alice has the potential for significant
hailstones on solar PV modules solar PV power generation, with the
result that a strong argument can be
in a study that involved monitoring One of the reasons for installing solar made for a campus that is completely
the systems installed at SolarWatt PV systems is to save on energy costs, solar powered on the basis of cost
Park on the Alice Campus. with consumers often calculating savings. However, climate change
the time it will take for savings in the may mean that this argument has
Monitoring of the 6 year old cost of buying electricity to cover the to be revisited as an increase in
polycrystalline modules installed on cost of installation. The period taken severe weather events results in
the rooftops at SolarWatt Park after to cover the cost of the system as a damage that reduces generation
the first hailstorm in December 2021 power. This then leaves arguments
revealed a drop in obtainable power about the value of solar PV systems
output of about 13%. After the in contributing to sustainability.
second severe storm on September Regardless of the focus of future
30, 2022, the output further dipped discussions, the University will be able
by another 17% for a moderately to count on its own researchers at the
damaged module and 62% for a Fort Hare Institute of Technology and
module with major cracks (Figure 2). associated departments to provide
sound research-based advice, as the
study reported above shows.

The system at SolarWatt Park was Figure 3. Electrical characterisation of the solar PV modules before and
initially designed to generate a after the hailstorm
minimum of 7.875 kWh per annum.
However, in its current state, it can
only generate about 2.520 kWh per
annum since more than half of the
modules have been badly damaged.

Research Report 2021/2022 | 26

Health
Sciences

27 | University of Fort Hare

Research Report 2021/2022 | 28

HEALTH SCIENCES

Identifying misconceptions
about tuberculosis: A step
forward in developing effective
awareness campaigns

Peggy Onyango, Professor Daniel Ter Goon and Ntombana Rala

South Africa carries a particularly Findings from the study indicate the threat of stigma associated with
high burden of cases of widespread misconceptions about HIV also adds to a failure to seek a
tuberculosis (TB) with 3% of all causes of the disease. For example, diagnosis and get treatment.
cases reported worldwide occurring 76.5% of respondents expressed
here. Of even more concern is the the belief that TB was caused by cold Treatment for TB can be lengthy and
fact that the country also has a high air, 85.9% claimed that it was due requires repeated visits to health
number of cases of drug-resistant TB. to a dusty environment and 84.7% facilities for testing and check-ups.
Reasons cited for the high prevalence indicated smoking as a cause with The majority of respondents (87.2%)
of the disease often include poverty many (60.6%) claiming that people were aware that treatment took six
and poor, overcrowded housing who smoke and drink are responsible months or longer, with 70.6% noting
conditions. However, lack of for its spread. Nonetheless, the that they thought follow-up sputum
knowledge about the disease itself in largest proportion of participants in tests were an important part of
a country where levels of education the study (88.4%) did identify correctly treatment. However, more than half
are generally low is undoubtedly also the presence of TB bacteria in the air said they thought treatment for TB
a factor. as a cause. was unpleasant and interfered with
work or marriage, with the majority
The need to be more conscious of Importantly, participants in the study indicating stigmatisation as the main
the way TB is understood and how shared misconceptions about the reason for avoiding follow up visits at
understandings relate to behaviour relationship of TB to HIV, with 77.4% clinics. Given these results, it is not
led to a study conducted by Nurse claiming that TB could develop difficult to see why many patients fail
Peggy Onyango, Professor Daniel into HIV and that HIV infects those to follow up on their treatment.
Ter Goon and Nurse Ntombana Rala. suffering from TB. According to the
The research project focused on 327 researchers, these misconceptions Although 53.5% of those who
patients suffering from TB attending could be related to the fact that South completed the questionnaire did
three community health centres Africa has a high incidence of HIV not associate TB with poverty, the
in the Nelson Mandela Bay Health and TB is a major cause of death for multivariate logistic regression
District. The three researchers used a those infected with both TB and HIV. analysis conducted by the researchers
close-ended questionnaire to collect The belief that TB develops into HIV showed that place of residence was a
information for the study and used was also identified as an explanation factor that was statistically significant,
descriptive and multivariate logistic for some patients choosing to hide with residence in formal housing
regression analyses to work with data. symptoms, resulting in a delay in emerging as a predictor of correct
getting medical advice. In addition, knowledge.

29 | University of Fort Hare

HEALTH SCIENCES

A lack of knowledge about TB along Reference:
with people’s attitudes towards the
disease and delays in seeking health Onyango, P.A., Goon, D.T, & Rala, N. M. D. (2020).
advice are all factors linked to mortality Knowledge, attitudes and health-seeking behaviour
from the disease. Because of this the among patients with tuberculosis: a cross-sectional
three researchers identify the need study. The Open Public Health Journal, 13(1).
to scale up TB programmes and to
focus on stigma-related perceptions
and attitudes. This important study
thus contributes to ways South Africa
could begin to lessen the burden of
TB on its population by developing
research-based campaigns that
ensure misconceptions about the
disease are challenged and people
are provided with the information
that will encourage healthy behaviour.

Research Report 2021/2022 | 30

HEALTH SCIENCES

The link between crime and
mental health in South Africa

Ruth Eister, Dr JD Wagner, Jenny Muller and Shirley Jaftha

Crime is a concern to all South of 2022 saw a 70.5% increase in were perpetrated mostly by someone
Africans regardless of where the murder of women and a 37.2% known to the victim.
they live or who they are. In increase in the murder of children.
South Africa, a 9.3% increase in crime Rape has also increased dramatically Crime can change the lives of its
was reported in the first quarter with almost 11,000 cases reported victims by affecting their mental
of 2022 with about 6,083 murders to police. The South African Police health negatively, as members of
occurring in this period. Those most report that a ‘staggering’ 4,653 rapes the Psychiatric Nursing Team in the
affected by crime are the vulnerable took place at the home of the rape Department of Health Sciences, Ruth
members of society. The first quarter victim or the home of the rapist and Eister, Dr JD Wagner, Jenny Muller and
Shirley Jaftha, can attest. Members

31 | University of Fort Hare

HEALTH SCIENCES

Jennifer Muller Dr J.D. Wagner

of the Team draw on a deep pool bodily harm, 3,695 were reported people with psychosocial problems
of expertise on the relationship as related to substance abuse. For and intellectual disabilities. SAFMH
between crime and mental health members of the Psychiatric Nursing also advocates against unnecessary
and are particularly alert to the fact Team, these facts and figures stress institutionalization and promotes
that crime is worsened by substance the need to address alcohol and community psychiatric care. The
abuse and that both substance substance abuse if crime is to be SADAG advocates for the promotion
abuse and crime affect mental reduced of mental health. It runs a toll-free
health. service for various mental health
South Africa is home to about problems for all affected, assists
According to members of the team, 58,78 million people with those callers in resolving their mental
the COVID-19 pandemic highlighted aged between 10 and 34 making health issues, provides free online
the relationship between substance up about a third of this number. training to people who initiate a
abuse and crime in South Africa. Half of all mental health disorders support group in their communities,
According to the Governance, Public begin by the age of 14. However, the and gives ongoing assistance to such
Safety, and Justice Survey 2020/21 majority of instances go unnoticed groups. SADAG is currently linked to
released by Statistics South Africa, and untreated with anxiety, post- 160 support groups. They also assist
crime levels dropped during the traumatic stress disorder and callers with substance abuse, suicide
period 2020/2021 when strict depression noted as conditions with risk, work stress related issues and
COVID-19 pandemic restrictions the highest occurrence rates. so on.
and a ban on the sale of alcohol
were in place. This shows that when However, as the Psychiatric Nursing Although national organisations do
alcohol use is reduced, instances Team are eager to note, those exist, the University of Fort Hare is
of crime and violence also fall in suffering from mental ill health do extremely fortunate to have a pool
number. Liquor outlets are the third not need to suffer alone. Help is of researchers whose expertise in
most likely place to be murdered in available from the South African Psychiatric Nursing Science makes
South Africa. Of the 9,556 rape cases Federation for Mental Health them an invaluable resource to all
reported in the first quarter of 2022, (SAFMH) and the South African members of the university and the
liquor and drugs were reported Depression and Anxiety Group communities it serves with regard to
as involved in 1,383. Amongst the (SADAG). The SAFMH, a national NGO the relationship between crime and
72,762 cases of assault and grievous and an association of mental health mental health.
practitioners, promotes the rights of

Research Report 2021/2022 | 32

HEALTH SCIENCES

Making a difference in the
health of local communities:
The work of the HIV/ AIDS
Research Group

Helen Bunt

Helen Bunt HIV and AIDS have been with us poorest provinces in the country calls
for a long time and the idea for work that acknowledges the social
that they present a serious and economic conditions in which
threat to health may have lessened local communities live. The UFH HIV/
particularly given the prominence AIDS Research Group is committed
given to Covid-19 over the past to producing knowledge that
few years. Against this background, addresses local challenges through
information presented at the recent engagement in research networks,
24th International AIDS Conference in sharing information and fostering
Montreal, Canada (29 July – 2 August, collaboration with others. The newly
2022) makes frightening reading. formed Research group is made up
Decreased funding and worsening of a number of representatives from
economic conditions have resulted the Department of Health, various
in less HIV testing, fewer care and non-governmental organisations
prevention programmes, more (NGO) and staff members who are
instances of stocks of medication and all involved in some area of HIV
other supplies running low or running / AIDS research. The research of
out and more failures in following up members of the group located at
on cases identified. As a result, more UFH focuses on viral load monitoring
patients are now presenting with AIDS by professional nurses as well as
and very low counts of the cells that the dynamics involved in disclosure
can move through the body finding of HIV status among adolescents.
and destroying bacteria and viruses. The team is also investigating the
This then allows for opportunistic experiences of COVID-19 pandemic
diseases, such as tuberculosis and on the elderly living with HIV as well as
cryptococcal meningitis, both leading the development of a care app for HIV
causes of death, to take hold. positive pregnant women.

Health care challenges are always The Research Group in the process of
more complex in poor, rural areas forming a collaboration with Dr Elona
and this makes the work of the HIV/ Tosca of the University of Cape Town.
AIDS Research Group in the Faculty Dr Tosca has conducted extensive
of Health Sciences at the University research on the devastating effects
of Fort Hare all the more critical. The of violence on mental health and on
location of the University in one of the adherence to treatment protocols

33 | University of Fort Hare

HEALTH SCIENCES

in collaboration with the Accelerate conducting a handheld test while in deeply. Yet again, the work of the
Hub, a group committed to working the home itself. If the test is positive, UFH Research Group demonstrates
with adolescents in resource poor the entire household is asked to go to sensitivity to local contexts.
contexts in Africa. the clinic as a group.
Members of the Research Group
Another partnership enjoyed by The need to make the best of limited also partner with another NGO,
the Research Group involves the health services in rural areas also led BeyondZero, focused on investigating
Desmond Tutu Research Foundation’s to the development of a screening best practices in HIV prevention
(DTRF) Dr Andrew Marino. Dr Marino’s tool which reduces demands on programmes. Professor Mzi Nduna
focus is on screening for sexually the time of professional nurses in of the Department of Public Health
transmitted infections (STIs), pre- primary health clinics. Statistics show has extensive experience of working
exposure prophylaxis (PrEP) and that almost half of health care users in the field of sexual minorities and
anti-retroviral therapy (ART). The in the Eastern Cape have mental adolescent sexual health and brings
prevalence of tuberculosis (TB) among health needs even though they go to this in-depth expertise to studies
men in the Amathole District is almost clinics complaining about symptoms conducted by the Group.
double that which is internationally associated with another condition
accepted as a crisis level. Further such as high blood pressure. Mental The commitment of researchers at
research undertaken by Dr Marino health issues including underlying the University of Fort Hare to making
and the DTRF shows a relationship stress, anxiety or depression can then a difference in the lives of South
between mental health (especially go undetected and untreated. The Africans, particularly those living in
depression) and TB rates and has innovation involves the introduction the Eastern Cape, is evident in many
also resulted in a testing innovation of a short screening tool to check for of the accounts of studies in this
particularly suitable for households mental health issues. If a potential research report. The work of the HIV/
in poor rural areas. The innovation problem is then identified, nurses can AIDS Research Group undoubtedly
involves pooling the sputum of use a more rigorous tool involving provides a shining example of this
all members of a household and thirty questions to probe more and needs to be applauded loudly.

Research Report 2021/2022 | 34

HEALTH SCIENCES

Learning from African
Traditional Medicine: Fort Hare
researcher leads the way

of a research programme that will
provide the acknowledgment denied
to the indigenous knowledge used by
healers for centuries.

Medicinal plants have long been
used in the development of drug
therapies, and recent research in this
area has focused on new treatment
and management of diseases such
as malaria, cancer and diabetes.
African traditional medicine draws
on medicinal plants, and healers
have a wealth of knowledge and
understanding about their use.

Dr Bongani Alphouse Nkala The purpose of the ATM Research
Unit is to promote IKS by contributing
DrBonganiAlphouseNkala ofthe to the body of knowledge concerning
Integrative Medical Research the safety and efficacy of African
Unit (IMRU) in the Faculty of traditional medicine. The focus of the
Health Sciences is passionate about Unit will be to draw on indigenous
indigenous knowledge systems and knowledge systems in the treatment
their role in treating disease. One of the top five diseases encountered
of Dr Nkala’s many successes has in the Eastern Cape. Importantly,
involved the establishment of an researchers will seek to go beyond
African Traditional Medicine (ATM) simply treating indigenous knowers
Research Unit within the IMRU, as knowledge holders to be used
accompanied by the development as sources of information. The aim
is to involve them in the studies
themselves, a goal which gives
meaning to claims that indigenous
knowledge should be valued and
brought into the university. Another
aim is to ensure that indigenous
knowers are able to benefit from any
financial gains that result from the
application of their knowledge.

35 | University of Fort Hare

HEALTH SCIENCES

Also important is the fact that the on traditional medicine common The next stage of the project will
to a locality in order to compile a involve the discovery and repurposing
research programme designed by database. It will also involve collecting, of the traditional medicines identified,
classifying and allocating specimen through documenting, characterising
Dr Nkala will involve Master’s and numbers to samples of leaves, bark and determining their efficacy. Finally,
and herbs which will be stored in the new or useful established drugs
doctoral students from a range of University’s herbarium. identified in previous studies can be
drawn upon for commercial use.
disciplines, including Biochemistry, Studies will then move on to
determining and characterising The exciting and innovative
Biotechnology, Environmental the efficacy of traditional medicine programme set out by Dr Nkala aims
by drawing on modern techniques to attract local and international
Studies, Clinical Medicine and including antibiotic testing and clinical collaborators who want to contribute
testing. This stage of the research to the quality of life of those living
Pharmacology. Students will produce will involve Master’s and doctoral in the Eastern Cape and beyond,
students working in Biochemistry, once again showing the ability and
studies that will contribute to Biotechnology and Environmental commitment of UFH researchers to
Science. work at a global level with the local
developing the knowledge necessary firmly in focus.

to fulfil the goals of the ATM Unit.

The first step in the research
programme will involve documenting
existing knowledge by gathering
anecdotal evidence and using this
to construct systematic bodies
of knowledge. In this phase of
the research, studies will focus

Research Report 2021/2022 | 36

HEALTH SCIENCES

Keeping active: promoting the
benefits of physical activity and
exercise for pregnant women

Dr Uchenna Okafor and Professor Daniel Ter Goon

Ashared awareness of the of the published work being reviewed. provision of conflicting information,
relationship between physical Using different databases, Dr Okafor along with tiredness, discomfort, lack of
activity and exercise and health and Professor Goon retrieved original time, low energy, a lack of opportunity
brought together doctoral candidate peer-reviewed research articles to exercise and safety concerns for
Dr Uchenna Okafor of the Department reporting on the prenatal physical both the mother and the baby, all
of Nursing Science and supervisor activity and exercise practices of functioned to limit their participation
Professor Daniel Ter Goon of the healthcare providers published in physical exercise and activity.
Department of Public Health at the between 2010 and 2020. The original
University of Fort Hare for a study search identified 82 articles of which As a result of this part of their project,
focused on the development of 13 were eventually judged to meet the Dr Okafor and Professor Goon were
an intervention that would benefit criteria for inclusion in the study. able to identify the need for an
pregnant women and their babies. The approach to providing information
study not only resulted in the award The review of published work showed about the benefits of physical activity
of a doctoral degree but also the that, although healthcare providers and exercise involving multidisciplinary
publication of four journal articles. accepted responsibility for counselling health teams drawing on both printed
pregnant women about physical materials and social media. The next
Over the years, a wealth of evidence activity and exercise, advice was step was for the two researchers to
has been produced showing that offered infrequently, with insufficient study some of the healthcare providers
physical activity and exercise during time, a lack of knowledge and skills, themselves by engaging in a series of
pregnancy are highly beneficial. The inadequate or insufficient training, and interviews with 15 midwives working
need for prenatal healthcare providers a lack of resources being most often at health care facilities in the Eastern
to create awareness and encourage cited as reasons for this. As a result of Cape.
pregnant women to engage in physical this review, Dr Okafor and Professor
activity is therefore very important. The Goon came to conclude that prenatal The findings of this stage in the project
project conducted by Dr Okafor and exercise and activity was a neglected showed that midwives rarely provided
Professor Goon began with a scoping component in efforts to improve the advice on physical activity and exercise
review of published work in order to health of pregnant women. to women attending antenatal clinics.
achieve two goals. The first goal was When information on physical activity
to assess the knowledge, attitudes The next step in the project involved a and exercise was provided, it was
and practices of prenatal healthcare study involving more than a thousand often inadequate as midwives had
providers in offering advice about pregnant women receiving antenatal received no training on the benefits of
prenatal physical activity and exercise. care in selected health facilities in physical activity during pregnancy. The
The second was to identify barriers to Buffalo City Municipality. The aim of shortage of midwives only exacerbated
the provision of this advice. this part of the project was to identify the situation with participants in the
the barriers to women engaging in study noting that they worked to busy
In order to conduct the review, the physical activity and exercise. Dr schedules and carried many official
researchers drew on the Preferred Okafor and Professor Goon drew on responsibilities. In spite of this, the
Reporting Items for Systematic a mixed methods approach, which midwives did recognise the importance
Reviews and Meta-analyses (PRISMA), showed that the women in the study of physical activity in improving the
a 27-item checklist covering all aspects claimed that a lack of advice or the health of the mothers attending the

37 | University of Fort Hare

HEALTH SCIENCES

clinics and expressed a willingness Economic Growth, Socio-Cultural, Pregnancy can be a trying time for
to engage in education and training Technological Environmental (PESTLE) many mothers-to-be regardless of
programmes that would allow them to framework, and the Build, Overcome, whether they are pregnant for the
counsel pregnant women. Importantly, Explore and Minimise (BOEM) first time or have already given birth
the midwives recommended the use of framework. These frameworks were to other children. Although all women
an app, called ‘Mom-Connect’, designed first used in discussions with academic want to maintain their health and
by the National Department of Health and professionals with a background eventually give birth to healthy babies,
in order to provide information about and interest in maternal health. Dr in busy lives with multiple demands it
maternal and child health. Currently Okafor and Professor Goon then can be only too easy to overlook the
the Mom-Connect app does not carry proceeded to use the frameworks as need for conscious attention to be
any content related to physical activity a basis for research with stakeholders paid to keeping active and exercising.
and exercise. that included antenatal health clinic There is no doubt, however, that the
managers, antenatal midwives, and project undertaken by Dr Okafor and
Engagement with the midwives as pregnant women themselves. Professor Goon will go a long way in
research participants allowed Dr Okafor promoting the benefits of physical
and Professor Goon to identify the As a result of this study, the two activity and exercise amongst pregnant
need for research to develop content researchers were able to identify a women thanks to the evidence-based
on physical activity and exercise for number of strategies that could be approach of their research.
the app. They were also able to note used to develop an overall intervention
the need for healthcare providers to promoting the benefits of physical References:
prioritise advice on physical exercise activity and exercise for pregnant
and activity in antenatal sessions and women. Strategies included the: Okafor UB, Goon DT. Physical
for more information in the form of
pamphlets, posters and DVDs to be • Use of apps such as Mom-Connect to activity advice and counselling
developed. provide information on the benefits
of physical activity and exercise to by healthcare providers: A
Dr Okafor and Professor Goon then pregnant women;
moved on to developing a strategy to scoping review. Healthcare, 2021,
promote physical activity and exercise • Establishment of partnerships with
amongst pregnant women. In order the various cell phone and network 9:609. https://doi.org/10.3390/
to do this, the two researchers drew companies operating in South Africa
on three frameworks: the Strength, to assist in sharing information on healthcare9050609
Weakness, Opportunity and Threat the benefits of physical activity and
(SWOT) framework, the Political, exercise; Okafor UB, Goon DT. Uncovering
barriers to prenatal physical activity
• Integration of prenatal physical and exercise among South African
activity and exercise training into pregnant women: A cross-sectional,
medical and health curricula to mixed-methods analysis. Frontiers
equip healthcare providers with the in Public Health, 2022.
knowledge and skills necessary to
prescribe prenatal physical activity Okafor UB, Goon DT. Providing
and provide counselling on it; physical activity advice during
pregnancy: A qualitative study of
• Development of campaigns to nurses’ perspectives. Nigeria Journal
address the lack of awareness, of Clinical Practice, 2021, 24:718-28.
misrepresentations, and other DOI:10.4103/njcp.njcp_486_20.
concerns about the safety and
benefits of prenatal physical activity; Okafor UB, Goon DT. Development
and validation of prenatal physical
• Incorporation of antenatal physical activity intervention strategy for
activity and exercise classes into women in Buffalo City Municipality,
routine antenatal clinics. South Africa. Healthcare, 2021,
9(11):1445. https://doi.org/10.3390/
healthcare9111445.

Research Report 2021/2022 | 38

HEALTH SCIENCES

Promoting exercise and
healthy eating amongst
farmers

Professor Leon van Niekerk and Professor Daniel Ter Goon

Professor Leon van Niekerk The Covid-19 pandemic affected all
sectors of society in all countries
across the world. As the virus
spread, concerns were raised in the
international media about its impact on
food security because of disruptions to
global supply chains and work in food
processing plants. In spite of this concern
for food production and distribution
at a global level, little attention was
paid to the effects of the virus and
attempts to control it on the very farming
communities that produce the food we
eat, especially in developing countries
such as South Africa.

However, the need to understand the
consequences of the pandemic for the
physical and mental health of farmers
and farm workers did not escape the
attention of two eminent University of
Fort Hare researchers, Professor Leon
van Niekerk of the Department of Human
Movement Science and Professor Daniel
Ter Goon of the Department of Public
Health.

Specialist in sport psychology Professor
Leon van Niekerk has a long history of
research into the impact of physical
inactivity on mental health. This interest
in the effects of activity is shared by
Professor Daniel Ter Goon who, amongst
other things, has researched and
published on the epidemiology of activity
and the relationship between levels of
physical activity and chronic disease for
many years. Both researchers quickly
identified the need to know more about

39 | University of Fort Hare

HEALTH SCIENCES

the effects of the pandemic on the to moderate levels of psychological was that physical activity and exercise
farmers and farm workers engaged distress. Although most of the benefited the farmers at a time when
in producing the food that would farmers (69% of those sampled) they were experiencing enormous
feed into supply chains and would be reported engaging in enough physical stress. As a result, Professors van
processed for consumption. activity and exercise, only 22.2% Niekerk and Goon recommend the
achieved the 150 to 300 minutes of promotion of exercise for farming
This then resulted in the design moderate aerobic activity or exercise communities.
of a study which used a survey per week recommended by the World
administered to 212 commercial, Health Organisation (WHO). All the Apart from its contribution to
small-scale and emerging farmers farmers who reported in engaging in scientific knowledge, this study
with an average age of 37.5 years enough physical activity or exercise demonstrates a commitment to
engaged in livestock, poultry, noted that this benefited their mental research with the potential to impact
vegetable and crop production. The health. However, those who reported on local communities. It also provides
survey showed that, although only only engaging in ‘enough’ physical lessons for anyone reading this
about 20% of those who participated activity or exercise found that this article. The pandemic led to increased
contracted the virus (and an even did not contribute to physical health stress levels for everyone, regardless
smaller proportion were ill enough to benefits. of their occupation. How many of us
require hospitalisation), the impact of used physical exercise and activity
activity and exercise on their mental The two researchers also found to reduce stress and improve our
well-being was very important. that 36.5% of the farmers in their physical health even within the
study were overweight and 30.7% constraints of lockdown? Thanks are
The pandemic affected food were obese. Although they identify due to Professors van Niekerk and
production and trading and, as a the potential impact of diet in their Goon for providing us all with food
result, income dropped, leading to paper reporting on the study, the for thought about what we can do to
one in three of the farmers who took study itself did not assess this improve and maintain our health in
part in the survey reporting that they, specifically. However, what was clear the future.
and their workers, experienced mild

Research Report 2021/2022 | 40

41 | University of Fort Hare

Management
and
Commerce

Research Report 2021/2022 | 42

MANAGEMENT AND COMMERCE

Using technology in teaching
and learning: Important
insights from Fort Hare study

Wendy Terblanche, Lubbe, I., Papageorgiou, E. & van der Merwe, N

Wendy Terblanche pronouncements sit in well-resourced The study drew on the Unified Theory
countries and know very little about of Acceptance and Use of Technology
Claims that higher education will the challenges experienced by (UTAUT2) developed by Viswanath
never be the same following students and academic teachers in Venkatesh and colleagues at Virginia
the shift to online learning less developed parts of the world. Tech in the United States. UTAUT2
during the pandemic abound in the The second problem is that we have holds that the adoption of technology
press as well as in the academic very little ‘hard’, rigorously reviewed is affected by users’ expectations
literature on teaching and learning. academic research to back up the about the way it will work for them, by
For many, the shift to online learning claims. the effort they will have to put in, by
means that residential universities will social and cultural factors influencing
be challenged in the future as more These observations about the status users themselves and, also, by the
and more students come to prefer of claims make a paper published by extent to which the conditions in
e-learning. However, we should not a team of researchers led by Wendy which the technology is introduced
accept these claims unquestioningly Terblanche of the Nkuhlu Department facilitate its use.
for at least two reasons. The first is of Accounting at the University of Fort
that many of those making these Hare (UFH) investigating the adoption The aim of the study was to identify the
of technology by students at four determinants of students’ acceptance
South African universities, all the more of e-learning applications and, also,
important. Other members of the how these determinants could be
team were Ilse Lubbe of the College moderated in some way. An original
of Accounting at the University of UTAUT2 questionnaire had to be
Cape Town, Elmarie Papageorgiou adapted for the South African context
of the School of Accountancy at in order to conduct the research, and
the University of the Witwatersrand Structural Equation Modelling (SEM)
and Nico van der Merwe of the was used to analyse the results. The
School of Accounting Sciences at the study confirmed the UTAUT2 model
North-West University. The multi- in a cross-institutional setting using
institutional nature of the team and a larger sample size than had been
the fact that the study was conducted drawn upon in previous studies. This
at four South African universities in itself constituted an important
during the Covid-19 lockdown contribution to knowledge.
period means that the sample of
1864 students who participated in More importantly for teaching and
the study not only drew on various learning, the study showed that, for
demographic variables but also on blended or online learning models
experiences of individuals studying at to succeed in contexts such as those
different institutions. studied, students need to be exposed

43 | University of Fort Hare

MANAGEMENT AND COMMERCE

to technology on an ongoing basis. It to questions about the price value when it allows for their engagement
would seem that the more familiar of e-learning applications. What the with academic teachers and other
students are with using technology, research shows, therefore, is that if students and is ‘safe’ as it does so.
the more willing they are to use it. universities want to continue to use Given the potential of social media
Also of interest to academic teachers technology in teaching and learning, to impact on psychological well-
was that analysis of results showed they will need to provide support for being, this insight into the need to
that 34% of students responded the acquisition of devices and use of make e-learning environments ‘safe’
negatively to the idea that using data and not see this as something and unstressful is really important.
technology would result in higher that only happened in the emergency Also important was the finding that
marks. conditions of the pandemic. a digital gap between males and
females could not be identified.
Generally, students agreed with Given the enormous concern about
statements in the questionnaire the environments in which students This important study by Wendy
about the value of resources and learn, the finding that questions Terblanche and her colleagues has
having the knowledge and assistance about the impact of social context on important implications going forward
available to use it. During the students’ learning generally received for a range of people including
pandemic, all the universities involved a positive response is very important. higher education policy-makers
in the study had made laptops and Only one third of respondents and leaders as well as university
data available to students and also indicated that social factors impacted teachers themselves. The publication
sought to accommodate those negatively on using technology for of results in a leading South African
whose home environments made learning. journal contributes to what is still a
studying difficult. This could explain relatively small volume of rigorously
the relatively low number of students Interestingly, students provided produced knowledge on the move
reporting that conditions during the neutral to slightly negative responses to using e-learning technologies and
pandemic were not conducive to their about the fun and enjoyment to highlights the role of UFH in producing
learning. The fact that students in be gained from using e-learning knowledge on teaching and learning
need received laptops and data could applications. Students reported with the potential to contribute to
also explain the positive response experiencing e-learning as fun global understandings.

Reference:

Terblanche, W., Lubbe, I.,
Papageorgiou, E. & van der Merwe,
N. 2022. Acceptance of e-learning
applications by accounting
students in an online learning
environment at residential
universities. South African Journal
of Accounting Research. https://0-
doi.org.wam.seals. ac.za/10.1080/
10291954.2022.2101328

Research Report 2021/2022 | 44

MANAGEMENT AND COMMERCE

Forging partnerships for
excellence - The role of the
African University

Professor Willie Chinyamurindi

The newly formed Human Capital Management research for the role of universities on the
interest group at Mulungushi University in Zambia continent in the pursuit of economic
and political liberation. Key to his
An important influence on understanding of the way indigenous argument is the need for Africa-
the thinking of Professor knowledge systems had been set Africa partnerships. According to
Willie Chinyamurindi of aside in order to privilege Western Professor Chinyamurindi, during
the Department of Business ‘science’, a point taken up by those the Covid-19 pandemic, technology
Management is the late Ali Mazrui, the arguing for the decolonization of the allowed collaborations to emerge
Kenyan born thinker who advocated universities in South Africa today. and thrive when travel and in-
for a transformed role for African Also central to his arguments was person meetings were impossible.
universities in the liberation of the the role African universities needed Post pandemic, the uncertainties
African. Mazrui was an ardent critic to play in changing the material that have emerged across the world
of Western economic systems and conditions of African people. For mean that it is important that these
saw African universities as serving Mazrui, the universities are part of technology-driven collaborations
these systems and their offshoots. the economic and political liberation continue.
In an age where globalization has of the continent itself.
seen universities across the world In Professor Chinamurindi’s opinion,
moving towards one vision of what Professor Chinyamurindi, well known in Africa the situation remains
they could and should be, Mazrui because of his travels throughout ominous and attention to three foci is
was at the forefront of some of the Africa funded by the National needed to allow the continent to fulfil
critiques of higher education that are Institute for the Humanities and its potential. Firstly, universities need
only emerging elsewhere now. Social Sciences’ (NIHSS) African to contribute to the development
Pathways Programme, has taken up of a skilled workforce of a world-
Key to Mazrui’s thinking was an Mazrui’s ideas in work making a case class standard. The training of this
workforce has to be focused on
the ability to solve local challenges.
This is especially important in the
context of the Fourth Industrial
Revolution. The development of
a skilled workforce will need to be
accompanied by talent management
programmes. Remuneration will also
need attention if the so called ‘brain
drain’ involving the loss of African
intellectual capacity to Western
economies is to be halted.

A second priority for Professor
Chinamurindi is investment in
technologies and universities. The

45 | University of Fort Hare

MANAGEMENT AND COMMERCE

development of new technologies, Deloitte in 2021. However, the Chinyamurindi’s own efforts to forge
and not simply the adoption of focus needs to be on investment Africa-Africa partnerships have
those that exist already, is key to the in infrastructure that encourages included participation in the Human
future of the continent. Affordable connectivity, especially between Capital Management Research
high speed internet connectivity is African universities. Interest group at Mulungushi
a basic if development needs are University in Zambia and in a writing
to be addressed. Also important is The critical role of partnerships in retreat at the University of Lusaka.
the need for technology in sectors achieving these three steps is critical. Universities targeted in the UFH
where people trade informally. Collaboration on the continent strategy include Makerere University
The role of the African university maximises economies of scale, Business School in Uganda, the
in developing technology, and not fosters synergies and is beneficial to University of Gondar in Ethiopia, the
simply adopting it, and promoting all involved. Investment which allows University of Kigali in Rwanda and the
innovations in its use is key to this the universities to collaborate on a University of Lusaka and Mulungushi
process. As many African countries continental scale will not only benefit University in Zambia.
have young populations, investment the institutions themselves but also
in this demographic and the ability the communities in which they are Africa-Africa research partnerships
of young people to engage with located. attest to the need for those on
technology is essential especially as the continent to work together
many see universities as a means of The University of Fort Hare is espoused by intellectuals and social
attaining the skills necessary to gain prioritizing Africa-Africa partnerships. activists such as Mazrui. In spite of
the workforce. At the core of these partnerships obstinate challenges, Africans can
is collaboration in research, joint rescript their identity by answering
A third task involves addressing teaching, the development of new the clarion call outlined by Professor
challenges related to infrastructure, curricula, the development and Chinyamurindi and, in doing so, they
identified as an obstacle to economic delivery of short courses, and the can hasten their steps towards the
growth in a report published by training of undergraduate and liberation of the continent.
postgraduate students. Professor

Delegates attending South Africa – Zambia Writing Workshop at the University of Lusaka

Research Report 2021/2022 | 46

MANAGEMENT AND COMMERCE

Improving service delivery
through e-government

Dr Ayanda Madyibi and Professor Roxanne Piderit

Service delivery’ is a term on the country means that many lack the
lips of many South Africans as knowledge and skills to do so.
they try to access provision
Professor Roxanne Piderit from the government and rarely Thusong Service Centres were
a day goes by when news reports set up in an attempt to bring
do not show protests objecting information and services closer to
to failures in this area. However, the people. However, a 2018 review
a doctoral study conducted Dr conducted by the Department of
Ayanda Madyibi, Information and Public Service and Administration
Digital Technology Specialist at (DPSA) showed that the Centres
the Eastern Cape Socio-Economic were not functioning as well as
Consultative Council (ECSECC) and intended for a number of reasons
a member of the Advisory Board including the state of their physical
of the Department of Information infrastructure and the model of
Systems, supervised by Professor funding used to support them.
Roxanne Piderit of the Department An earlier study had identified
of Information Systems has gone perceptions that Thusong Service
some way in addressing problems Centres suffered from poor service
in the way the government goes delivery, were not user friendly and
about providing public services via also noted the limited use of the ICT
what is known as ‘E-government’. related services they offered.

E-government is a way of interacting The study conducted by Dr Madyibi
with citizens using Information and Professor Piderit aimed to
and Communication Technologies address the lack of research on
(ICTs). Government departments e-Government in less developed
have websites but not all are as well countries and, more practically, to
developed as they could be in the develop a framework to enhance its
sense of allowing citizens to access implementation in Thusong Service
the services they need online. Centres. The research project
Although E-government has been began with a review of the literature
studied in developed countries, in order to construct a conceptual
much less is known about its framework that was then applied to
adoption and use less developed the Thusong Service Centres in the
nations where the situation is very Eastern Cape as a case study so as
different. Many South Africans do to confirm and refine it.
not have access to the devices or
data that will allow them to access Confirming and refining the
services provided electronically.
In addition, the history of our framework then involved

collecting empirical data from

twenty-two organisational and

47 | University of Fort Hare