BIOE 103 - Montana State University

BIOE 103
Evolution

Review

Galapagos Islands: Cape Verde 2
birds similar to S. Islands: birds
America similar to Africa

Our question for today:

“How do species change?”

Darwin figured out how.

Charles Darwin
1809 - 1882

Lecture outline

1. Selective breeding
2. Natural selection
3. Requirements for natural selection
4. Definitions
5. An example
6. Origin of variation
7. Avoiding misunderstanding

4

1. Darwin argued
evolution was
caused by a
natural process
similar to plant
and animal
breeding.

Charles Darwin
1809 - 1882

Selective Breeding example #1
All dog are descended from wolves* and have
been bred by people into existing breeds

Thousands of
years later

*Or an extinct wolf-like animal

Selective breeding example #2
Modern corn is much larger than corn raised by
Native Americans

Hundreds of
years later

7

Evolution in nature is similar to this

So we are going to examine how this occurs in some detail
8

Basic biology information you need to
understand natural selection

The physical characteristics of any living organism are affected
by its genes and by its environment.

Examples: Height
-Height affected by genes
- This is why tall parents tend to have tall children
- Height is also affected by nutrition
-This is why people in well-fed countries tend to be taller
than people in less well-fed countries

9

Examples of genes and environment
(in humans)

Trait Genes or environment?

Skin color Both genes and environment

Native language All environment

Number of fingers All genes (excepting accidents)

Athletic performance Both genes and environment

Academic performance Both genes and environment

10

Wolves are larger, have
thicker fur, different
shape, bigger teeth, etc.
than Chihuahuas
because they have
different genes.

Modern corn is
genetically different
than native corn

12

These are genetic transformations

13

How would you do this?

Please give me step-by-step instructions for doing this that
you conceivably do yourself.
(E.g., Don’t tell me you are going to use genetic engineering)

14

How to turn a wolf into a Chihuahua

1. Start with a population of
wolves that have varying
sizes and shapes.

2. Select the wolves that are
smallest, or look at least a
little like a Chiuahua.

3. Breed these “Chihuahua-like”
dogs.

4. These dogs have Chihuahua-
like” puppies

5. Continue until you have a
Chihuahua.

When you select short wolves to breed, you
are selecting individuals with certain genes

Wolves TTCTGTTCGCCAGCCGGGCCCTGGCAAGCTGAGAC

Small dogs ...............A...................

For example, chihuahuas and other miniature dog breeds
have a different version of the gene insulin-like growth
factor I receptor.

Selectively breeding small dogs will increase frequency of 16
the gene sequence having an “A” (above) in population.
Remove “G’s”.

Examples of selective breeding

Wild jungle fowl Domestic hen
Lay 30 eggs / year Lays 300 eggs / year

Examples of selective breeding

Broccoli, cabbage, kale, cauliflower, kohirabi all bred
from wild mustard

Selective
breeding can
change almost
any trait in any
organism

E.g. Colors in
carrots

See “Selective breeding”

2. Natural selection causes evolution in
a similar way

(except nature selects who reproduces)

20

Alaskan winter “breeds” musk ox to
have warm wool

Some oxen have warmer wool than others.
Musk ox without warm wool do not survive to reproduce.
Offspring of surviving musk ox inherit warm wool.
This changes the population of musk ox.

Mountains “breed” sheep to be surefooted

Sheep that are not surefooted do not survive to reproduce

Cheetahs “breed” dik diks to be fast

Cheetah’s don’t want dik diks to be fast. But cheetahs eat
the slow dik diks, so only the fast dik diks survive to
reproduce.

Desert climate “breeds” cactus to conserve water
Desert animals “breed” cacti to have spines

3. Requirements for natural selection

Hypothetical case study:
Giraffes feeding from acacia trees

During a drought, there is a food shortage

The shortest giraffes die

Surviving (tall) giraffes have tall calves

And the average height of the
population has increased

Requirements for natural selection

1. Variable trait

2. Trait is heritable
(genetically based)

3. Differential
survival/reproduction
(“selection”)

If these three conditions are met,
a population WILL evolve

If these conditions are NOT met, a population will NOT evolve.

Natural selection practice problem

The giant anteater of South America eats only ants and

termites. Anteaters eat ants by sticking their tongue into

anthills and slurping up ants. Anteaters have an elongated

snout and their tongue is two feet long. According to the theory

of evolution, anteaters evolved from animals that did not have

such a long tongue. How would an evolutionary biologist

explain how this change occurred? 32

Answer:
There was variation in the ancestral population of anteaters;
some of the ancestral anteaters had longer tongues than
others. The anteaters with longer tongues were more likely to
survive and reproduce than anteaters with shorter tongues.
The surviving anteaters had offspring that inherited the long
tongue.

33

Natural selection practice problem

Sequoia trees live in mountains
in California where forest fires
are common. Sequoia trees have
very thick bark that protects
them from forest fires. According
to the theory of evolution,
sequoias evolved this thick bark
from ancestors that did not have
it. How would an evolutionary
biologist explain how this change
occurred?

34

Natural selection practice problem

Whales are large mammals with streamlined bodies
that allow them to swim easily in the ocean. Unlike
most mammals, whales do not have hind limbs. How
would a biologist explain how whales lost their hind
limbs, assuming their ancestors had hind limbs?

35

4. Definitions

selection
An environmental influence that gives
some individuals in a population a
reproductive or survival advantage over
others.

Principal cause of evolution.

36

Evolution: 2 definitions

1. The theory that all species are descended
from a common ancestor, and have changed
with time

2. A change in genetic composition of a
population.

37

This population has
different genes after
the drought.

Therefore it has
evolved.

“Evolving” in everyday speech means
something different than in biology

Evolve (everyday speech) : To undergo gradual change; develop

“Britney had to evolve since the music industry …”
“How did Ford evolve from one of the most admired companies…”
“…people need to evolve with the changing markets…”
“Lance Armstrong’s brand is evolving…”

5. An example of evolution in nature:

Beak depth in Darwin’s Finch in Galapagos Islands

Beak depth
40

Finches with wide
beaks are better at
cracking open large
seeds.

Finches with narrow
beaks are better at
eating small seeds.

41

Beak depth is a genetic trait

Parents with deep beaks have offspring with
deep beaks

42

Bill depth in Darwin’s finches before and after a
drought makes small seeds scarce

NN 80

60 Before
drought Avg = 9.59mm

40

20

0
7 8 9 10 11 12 13

80

60

40

After drought Avg = 10.09 mm

20

0 43
7 8 9 10 11 12 13

Beak depth

This may seem like a trivial change…

…but changes like this can transform a species if they

keep occurring over a long time. 44

(Similar to plate tectonics).

6. Origin of new variation

• Natural selection changes proportions of

individuals in a population.

• It won’t work unless there are some tall

individuals.

• So where do the tall giraffes come from in the first

place? 45

Mutation creates individuals with new traits

This giraffe has a • Mutations are random changes
mutation that makes
it taller. in genes.
• Mutations are caused by

mistakes copying genes when

cells reproduce or by the effect

of radiation or chemicals.
• “Random” means mutations

happen by chance—not because

they are needed.
• Most mutations are harmful; but

some are beneficial.

7. Avoiding common misunderstandings

Evolution does not happen
through a process similar to sun
tanning in which individuals
change.

Getting a sun tan may darken
your skin, but it will not change
your genes (and therefore does
not affect your children).

47

Shivering doesn’t change genes of individual musk ox.

Evolution occurs when environment changes genes in a
population by selecting who survives and who
reproduces.

Giraffes didn’t evolve long necks by
stretching to reach branches

Stretching may lengthen a giraffe’s neck, but will not change a

giraffe’s genes. This change will not be inherited. 49

Species don’t evolve just because they
“need to”

All of the finches
“needed” larger
beaks, but that
didn’t cause any
finch to change.
Finches with
narrow beaks died.

50