קליטת סגל אקדמי מצטיין

‫ממללגגוותת אאלון|ממללגגוותתממעעווףף‬

‫קליטת סגל אקדמי מצטיין‬

‫טקס שנתי להענקת מלגות לשנת תשע"ט‬

‫המועצה להשכלה גבוהה | הוועדה לתכנון ולתקצוב‬
‫מאי ‪2019‬‬

‫‪ 1‬קליטת סגל אקדמי מצטיין‬

‫דברי יו”ר הוועדה לתכנון ולתקצוב – פרופ׳ יפה זילברשץ‬

‫מלגאים ומלגאיות יקרים‪,‬‬

‫הוועדה לתכנון ולתקצוב והמועצה להשכלה גבוהה פועלות במישורים ורבדים שונים‬
‫לקידום‪ ,‬ביסוס וחיזוק מערכת ההשכלה הגבוהה בישראל‪ .‬בתכנית הרב שנתית הנוכחית‬
‫הושם דגש בין השאר על קידום המחקר‪ ,‬על חיזוק וביסוס מעמדה של האקדמיה‬
‫הישראלית בזירה הגלובלית‪ ,‬על קידום הוראה ולמידה דיגיטליים ושיפור איכות ההוראה‬
‫תוך שימוש בטכנולוגיות למידה חדשניות ועל הנגשה רחבה של ההשכלה הגבוהה לכל‬

‫חלקי האוכלוסיה בישראל‪.‬‬

‫במסגרת קידום המחקר האקדמי‪ ,‬פועלת הות”ת לעידוד ותמיכה במצויינות אקדמית‪ .‬אתם‬
‫מלגאים יקרים מייצגים יותר מכל מצויינות יוצאת דופן זו‪.‬‬

‫מלגות אלון ומלגות מעוף המקבילות להן והמיועדות לבני החברה הערבית הן נדבך חשוב‬
‫בפעילות הות”ת לעודד ולתמוך במצויינות אקדמית ולקדם את דור העתיד של החוקרים‬

‫במערכת ההשכלה הגבוהה בישראל‪.‬‬

‫ב‪ 20-‬השנים האחרונות העניקה הות”ת ‪ 565‬מלגות אלון ומעוף בסכום של כ‪ 250-‬מליון‪.₪‬‬
‫המלגה הנדיבה‪ ,‬בגובה של כ‪ ₪ 300,000-‬לשנה‪ ,‬מכסה את עלות השכר של המלגאי‬

‫לתקופה של ‪ 3‬שנים ובנוסף לה מקבלים המלגאים מענק מחקר ניסויי או עיוני‪.‬‬

‫תכנית מלגות אלון החלה לפעול בשנת תשל”ט (‪ )1978‬במטרה לעודד ולתמוך במדענים‬
‫צעירים מצטיינים ולהקל על קליטתם באוניברסיטאות המחקר‪ .‬זה כ‪ 40-‬שנה התכנית‬
‫פועלת במתכונות שונות ובעשרים השנים האחרונות מעניקה הות”ת מידי שנה ‪ 25‬מלגות‬

‫לתחומים‪ :‬מדעי הרוח‪ ,‬מדעי החברה‪ ,‬מדעי החיים והרפואה ומדעים מדוייקים והנדסה‪.‬‬

‫תכנית מלגות מעוף פועלת החל משנת ‪ 1995‬לאותן מטרות ובאותם תחומים‪ .‬ות”ת‬
‫מעניקה מדי שנה ‪ 6‬מלגות מעוף לחוקרים צעירים מבני החברה הערבית לסיוע בקליטתם‬

‫הן באוניברסיטאות והן במכללות‪.‬‬

‫כמי ששמה את נושא קידום הנשים בהשכלה הגבוהה בישראל כיעד מרכזי‪ ,‬חשוב לי לציין‬
‫כי בשנים הראשונות של הפעלת תכנית מלגות אלון‪ ,‬אחוז הנשים הזוכות במלגות היה נמוך‬

‫מ‪ 2-‬אחוז‪ ,‬ואילו כיום למעלה מ‪ 35-‬אחוז מזוכי המלגות הן נשים‪.‬‬

‫רבים מחברי ועדות הות”ת והמל”ג‪ ,‬ורבים מחברי הסגל הבכירים והמובילים במערכת‬
‫ההשכלה הגבוהה בישראל‪ ,‬זכו בתחילת דרכם האקדמית במלגת אלון או מעוף‪.‬‬

‫מלגאים יקרים‪ ,‬מערכת ההשכלה הגבוהה בישראל התברכה במצויינות ובפוטנציאל‬
‫האקדמי שאתם מביאים עימכם‪ ,‬ואני מברכת אתכם ומאחלת לכם הצלחה רב בהיותכם‬

‫הקטר שיוביל את המחקר האקדמי על כל תחומיו במערכת ההשכלה הגבוהה בישראל‪.‬‬

‫עלו והצליחו!‬

‫‪ 2‬קליטת סגל אקדמי מצטיין‬

‫דברי סיו״ר המועצה להשכלה גבוהה – פרופ׳ אדו פרלמן‬

‫מלגאיות ומלגאים יקרים‪.‬‬
‫מדינת ישראל התברכה במערכת אקדמית מצוינת ואיכותית ביותר המהווה את הבסיס‬
‫ליצירת הידע‪ ,‬קידומו והנחלתו במדעי הרוח‪ ,‬מדעי החברה‪ ,‬מדעי החיים והרפואה וההנדסה‪.‬‬
‫מערכת ההשכלה הגבוהה כוללת אוניברסיטאות ומכללות‪ ,‬ובתוכן מבנים‪ ,‬מעבדות‬
‫ותשתיות מחקר‪ ,‬ספריות ועוד‪ .‬אבל יותר מכל‪ ,‬מה שהופך מערכת אקדמית לאיכותית‬
‫ומצוינת זה ההון האנושי המקיים אותה ומניע אותה קדימה‪ .‬אתם מלגאים יקרים מייצגים‬

‫את ההון האנושי המצוין בו התברכה מערכת ההשכלה הגבוהה בישראל‪.‬‬
‫המועצה להשכלה גבוהה והוועדה לתכנון ולתקצוב משקיעות משאבים רבים לקידום‬
‫ועידוד המצוינות האקדמית ועידוד המחקר ובין היתר מפעילות מזה שנים תכניות מלגות‬
‫מצוינות שונות‪ ,‬לתואר שני מחקרי‪ ,‬לדוקטורט‪ ,‬לבתר‪-‬דוקטורט ותוכניות מלגות לקליטת‬

‫סגל חדש‪.‬‬
‫תכניות המלגות אלון ומעוף נחשבות כ”יהלום שבכתר” בין תכניות המלגות השונות‪ ,‬הן‬

‫מבחינת גובה המלגה והן מבחינת היוקרה הנלוות לה‪.‬‬
‫מידי שנה מעניקות המועצה להשכלה גבוהה והוועדה לתכנון ולתקצוב למעלה מ‪30-‬‬
‫מלגות אלון ומלגות מעוף‪ ,‬כל אחת בגובה עלות שכר ממוצעת של “מרצה” או “מרצה בכיר”‬
‫או “פרופסור חבר” במוסד‪ ,‬בהתאם למינוי האקדמי אותו מקבל‪/‬ת המלגאי‪/‬ת‪ .‬בנוסף‪ ,‬כל‬
‫מלגאי‪/‬ת מקבל‪/‬ת בשנה הראשונה מענק מחקר כדי להקל על ההיקלטות במערכת‪,‬‬

‫מענק מיועד לצרכי מחקר‪.‬‬
‫בחירת הזוכים נעשית על ידי וועדות אקדמיות הנבחרות בקפידה ע”י הות”ת ועל בסיס‬
‫של הצטיינות אקדמית אישית בלבד ובכלל זה‪ :‬פרסום מאמרים בעיתונות מדעית נבחרת‪,‬‬
‫זכיה בפרסים אקדמיים ובמלגות הצטיינות‪ ,‬השתתפות בכנסים בינלאומיים‪ ,‬המלצות‬
‫של חוקרים בעלי שם בעולם האקדמי‪ ,‬חשיבות ופריצת דרך מדעית בתחום המחקר של‬

‫המלגאי ועוד‪.‬‬
‫כמערכת אשר עוסקת רבות בתכנון ובהסתכלות קדימה‪ ,‬אנו רואים בכם מלגאים יקרים‬

‫קבוצה מצוינת ואיכותית אשר תוביל את המחקר האקדמי העתידי בישראל‪.‬‬
‫יישר כוח ובהצלחה!!‬

‫‪ 3‬קליטת סגל אקדמי מצטיין‬





‫מלגת אלון‬

‫מטרות‪:‬‬
‫תכנית זו מיועדת לתמיכה במדענים צעירים מצטיינים‬
‫ומטרתה לאפשר לאוניברסיטאות לקלוט את המלגאים‬
‫במשרה מלאה‪ .‬האוניברסיטאות מתחייבות לקלוט המלגאים‬

‫כחברי סגל במשרה מלאה בתום תקופת המלגה‪.‬‬

‫תקופת המלגה‪:‬‬
‫במסגרת התכנית מוענקות לזוכים מלגות‪-‬סגל תלת‪-‬שנתיות‬

‫של שלוש שנים אקדמיות‪.‬‬

‫גובה המלגה‪:‬‬
‫כ‪ ₪ 300,000-‬בשנה‪ ,‬כגובה עלות השכר הממוצעת בדרגה‬

‫בה נקלט המלגאי (מרצה ‪ /‬מרצה בכיר ‪ /‬פרופ׳ חבר)‪.‬‬
‫בנוסף מוענק למלגאים בשנה הראשונה מענק מחקר חד‬
‫פעמי בגובה של ‪ 170‬אלף ש״ח לתחומים הניסויים ובגובה‬

‫של ‪ 50,000‬ש״ח לתחומים העיוניים‪.‬‬

‫מס׳ המלגות‪:‬‬
‫מידי שנה מעניקה הות״ת ‪ 25‬מלגות אלון למלגאים‬
‫מהתחומים‪ :‬מדעי הרוח‪ ,‬מדעי החברה‪ ,‬מדעי החיים‪ ,‬מדעים‬

‫מדוייקים והנדסה‪.‬‬

‫‪ 6‬קליטת סגל אקדמי מצטיין‬

‫מלגת אלון‬

‫תחום המדעים המדוייקים וההנדסה‬

‫שם הזוכה‬

‫ד״ר עמית דניאלי האוניברסיטה העברית בירושלים‬

‫ד״ר אוהד נוי פלדהיים האוניברסיטה העברית בירושלים‬

‫האוניברסיטה העברית בירושלים‬ ‫ד״ר זוהר רינגל‬

‫הטכניון‬ ‫ד״ר איתי אייל‬

‫אוניברסיטת תל אביב‬ ‫ד״ר לירון ברק‬

‫אוניברסיטת תל אביב‬ ‫ד״ר יאיר הרכבי‬

‫אוניברסיטת תל אביב‬ ‫ד״ר אורי להב‬

‫אוניברסיטת בן‪-‬גוריון בנגב‬ ‫ד״ר ערן אדרי‬

‫ד״ר גלעד אנטלר אוניברסיטת בן‪-‬גוריון בנגב‬

‫אוניברסיטת בן‪-‬גוריון בנגב‬ ‫ד״ר עידן הוד‬

‫אוניברסיטת בן‪-‬גוריון בנגב‬ ‫ד״ר מירב זהבי‬

‫קליטת סגל אקדמי מצטיין ‪7‬‬ ‫חברי הוועדה‬

‫פרופ׳ יהודית גלעזר ‪ -‬יו"ר‬
‫פרופ׳ נירית דודוביץ‬
‫פרופ׳ טאלב מוקארי‬
‫פרופ׳ נרי מרחב‬
‫פרופ׳ אהוד נקר‬
‫פרופ׳ שרית קראוס‬

‫‪ 7‬קליטת סגל אקדמי מצטיין‬

‫ד״ר עמית דניאלי‬ ‫מלגת אלון ‪ -‬תחום המדעים המדוייקים וההנדסה‬

‫האוניברסיטה העברית בירושלים ‬

‫‪ 8‬קליטת סגל אקדמי מצטיין‬

Online Thinning to Reduce Discrepancy

Raaz Dwivedi, Ohad Feldheim, Ori Gurel-Gurevich and Aaditya Ramdas

[email protected], [email protected], [email protected], [email protected]

Notation Main Result Haar Greedy-Thinning Strategy

Xi ∈ [0, 1)d, XN = {X1, . . . , XN }, X∞ = {X1, X2, . . .}, For a streaming sequence X∞ of i.i.d. U [0, 1)d random variables, Conjecture: A simplified greedy strategy with O(d logd N ) space-
R = Set of axis-aligned hyper-rectangles in [0, 1)d,
Haar 2-Thinning strategy outputs a streaming sequence Z∞ such time complexity outputs a thinned sequence Z∞ from a streaming
vol(·) = Lebesgue Measure.
sequence of i.i.d. U [0, 1)d random variables, such that

that    logd N 
 N 
Quantity of interest: Rate of the discrepancy sequence Dis(Z N ) = O d log2d+1(N ) ∀N ∈ N, almost surely. Dis(Z N ) = O d ∀N ∈ N, almost surely.
N
Dis(XN) = 1 |R ∩ XN| − vol(R) Greedy Strategy: Winner takes it all. Keep x deterministi-
sup N . The strategy has O(d logd N ) space-time complexity to output N cally if # votes in favor of x > # votes against x. Reject otherwise.

R∈R points and keeps at least one out of every two consecutive points
of the sequence X∞.
Set-up and Objectives Numerical Experiments

Goal: Design a strategy, which selects a subset Z∞ from a Haar 2-Thinning Strategy 10−1 R = [0, 1/2] 10−1 R = [1/3, 2/3]
streaming sequence X∞ of i.i.d. U [0, 1]d random variables such 10−2 10−2
that Dis(ZN) Dis(XN). • Given ZN and a new candidate point x, each Haar wavelet of order Discrepancy 10−3 Monte Carlo Discrepancy 10−3 Monte Carlo
10−4 2-Thinning 10−4 2-Thinning
Requirements: We can keep or reject any point in X∞. The up-to log2 N votes whether to keep x or reject it. 10−5 Greedy-Thinning Greedy-Thinning
sequence Z∞ should be dense in X∞. The strategy should be • Haar functions vote to maintain balance of points in their support. 101 102 103 10−1 101 102 103
10−1
N N
R = [0, 1/2]2 R = [1/3, 2/3]2
‫ד״ר אוהד נוי פלדהיים‬online and time and space efficient.• Based on votes, the point x is kept randomly with probability 104 104

‫האוניברסיטה העברית בירושלי ם‬
Dis(X N ) √1
‫ קליטת סגל אקדמי מצטיין‬9Remark:=MonteCarlo Discrepancy = O  N  . P(keep x) =12 + 1 · #votes in favor of x − #votes against x;
2 #total votes
Discrepancy Discrepancy
if x is rejected, the next candidate point is kept. 10−2 10−2

Inspiration: Power of Two Choice 10−3 Monte Carlo Monte Carlo
2-Thinning 2-Thinning
Voting Regions of Haar Wavelets afterZ1, . . . , Z15 Greedy-Thinning 10−3 Greedy-Thinning

N Balls, N Bins Heaviest Bin Z1, . . . , Z15 101 102 103 104 101 102 103 104
N N
Random Assignment log N Against
Randomly sample a bin. Assign the new ball to it. log log N Order 1 In favor Figure 2: Plots of discrepancy for two different rectangles R in one and two

dimensions (averaged over 20 experiments). Axes are in logarithmic scale.

Proof Techniques

Neutral • Decompose arbitrary rectangles in terms of “diadic rectangles”
• Express diadic rectangles in terms of “Haar wavelets”
log log N • Exploit exponential concentration of self-regulating processes to

Two Choice Assignment
? Order 2 maintain the balance of points in Haar wavelets up-to some
Randomly sample two bins. Assign the new ball to the better resolution
? ?? ?
one. References
? ?? ? ? ? ? ? ?
[1] Y. Azar, A. Broder, A. Karlin and E. Upfal, Balanced allocations. SIAM Journal of Computing
log log N 29 no. 1 (1999).

Two Thinning Assignment ……. Order 3 [2] O. N. Feldheim and O. Gurel-Gurevich, The power of one-retry in reducing discrepancy.
Randomly sample a bin. With some probability assign the preprint arXiv:1608.02895 (2016).
new ball to it. Else, assign the ball to the next random bin.
[3] Chazelle, Bernard, The discrepancy method: randomness and complexity, Cambridge
Idea: Extend the two thinning strategy to our set-up. Darker Shade at x = Higher P(keep x) University Press, 2000.
Difficulty: The cardinality of R and heavy dependence across its
elements. Figure 1: Illustration of Haar 2-thinning strategy after obtaining 15 samples in two [4] P. Maillard and E. Paquette, Choices and intervals. Israel Journal of Mathematics (2014).
Tool: Use of Haar Wavelet Basis. dimensions. For clarity, P(keep x) is averaged on diadic squares of side 1/4. The
strategy favors to keep points in regions that are deficient in samples so far. [5] A. B. Owen, Statistically efficient thinning of a Markov chain sampler, preprint
arXiv:1510.07727 [stat.CO].

[6] R. Dwivedi, O. N. Feldheim, O. Gurel-Gurevich and A. Ramdas, Online thinning to reduce
discrepancy., arXiv:version, coming soon.

‫ תחום המדעים המדוייקים וההנדסה‬- ‫מלגת אלון‬







‫ד״ר יאיר הרכבי‬ ‫מלגת אלון ‪ -‬תחום המדעים המדוייקים וההנדסה‬

‫אוניברסיטת תל אביב‬

‫סופרנובות‬
‫חורים שחורים‬

‫וגלי כבידה‬

‫ד״ר יאיר הרכבי‬
‫ביה״ס לפיזיקה ולאסטרונומיה‪ ,‬אוניברסיטת תל‪-‬אביב‬

‫אילו כוכבים מתפוצצים כסופרנובות ומדוע? עבודתו של ד״ר הרכבי משתמשת‬
‫בטלסקופים חדשניים להשגת תצפיות מיידיות של סופרנובות )שעות לאחר‬

‫הפיצוץ(‪ ,‬המאפשרות הצצה למבנה הפנימי של כוכבים מאסיביים רגע לפני שהם‬
‫קורסים ומתפוצצים‪ ,‬ולפיזיקה של הפיצוץ עצמו‪.‬‬

‫כיצד גדלים חורים שחורים סופר מאסיביים במרכזי גלקסיות? ד״ר הרכבי‬
‫זיהה סוג חדש של ארועים אסטרונומיים שמשוייך לקריעה של כוכבים שמתקרבים‬

‫לחורים שחורים סופר מאסיביים‪ .‬תופעות אלו חושפות חורים שחורים חדשים וכן‬
‫את תהליכי גדילתם ע״י ספיחת חומר‪.‬‬

‫מה קורה ככשני כוכבי נויטרונים מתמזגים? ד״ר הרכבי הוביל את אחת‬
‫הקבוצות שגילו את ה״קילונובה״ הראשונה ‪ -‬הבזק האור ממיזוג של כוכבי‬
‫נויטרונים ‪ -‬בעקבות גלי כבידה שהגיעו מאותו ארוע‪ .‬זו היתה הפעם הראשונה‬
‫)ובינתיים היחידה( שאור וגלי כבידה התגדלו ממיזוג כוכבי נוטירונים וחשפו את‬
‫הפיזיקה של האובייקטים המסתוריים הללו ושל תהליכי יצירת היסודות הכי‬

‫כבדים בטבע‪.‬‬

‫‪ 13‬קליטת סגל אקדמי מצטיין‬

‫ד״ר אורי להב‬ ‫ תחום המדעים המדוייקים וההנדסה‬- ‫מלגת אלון‬

‫אוניברסיטת תל אביב‬

Relaxed Memory Concurrency: Semantics and Verification

Ori Lahav, The Blavatnik School of Computer Science, Tel Aviv University

My research focuses on relaxed memory concurrency (a.k.a. weak memory models). This is a
general term for concurrency models provided by modern multi-core architectures and high-
level programming languages, that, for performance reasons, offer weak, often
counterintuitive, guarantees about the ordering of concurrent memory operations. While being
pervasive, relaxed memory concurrency breaks our basic understanding of concurrent
programming and poses new challenges to both theory and practice of programming
languages and verification.
My work is centred the following two foundational questions:
What is the right semantics for concurrent programs written in a high-level language?
A semantics defines the set of allowed behaviors of a given program, and constitutes a
contract between the programmer and the language implementation. The challenge lies in
simultaneously allowing efficient implementation on modern hardware with various compiler
optimizations, while exposing a reasonably simple and well-behaved programming model.
Mainstream programming languages, such as Java, C and C++, already include concurrency
semantics in their specifications; however, these were quickly discovered to be flawed.
Recent proposals, after years of research, provide partial solutions, but they are still
unsatisfactory. I aim to develop novel concurrency semantics that will address the
weaknesses of existing proposals (e.g., lack of support for global compiler analysis, lack of
liveness guarantees, and amenability to verification).
How to perform software verification under relaxed memory concurrency?
This question tackles a major gap between theory and practice. The vast majority of
verification methods for concurrent programs completely ignore the relaxed memory
concurrency semantics, but rather assume the unrealistic sequential consistency semantics.
Formal verification, however, is a necessity in these circumstances: programming under
relaxed memory concurrency is notoriously error-prone, and testing is very unlikely to find
various subtle bugs. In particular, in my work I will address the following questions:
- What is the complexity of software verification under relaxed memory concurrency? Here

I am interested in the theoretical complexity of the general verification problem (which is
open for central concurrency models), and based on the results, in tools and techniques
for (unbounded) verification of safety properties under weak memory models.
- How to effectively perform bounded verification for relaxed memory concurrency? This
verification task concerns proving the absence of bugs for all executions of a program up
to a certain length. We have preliminary results for one particular model, and we are
interested in other major models, as well as in necessary and sufficient conditions on
declarative memory models that will allow efficient bounded verification.
- How to dynamically check for data races under relaxed memory concurrency? Here I will
focus also on dynamic race prediction, that can be used for effectively monitoring a
concurrent program during its testing phase.
Besides advancing our understanding, the success of this research will improve the
applicability of verification for realistic high-performance concurrent programs, resulting in
increase in the correctness of software, as well as its performance, as given good verification
support, more programmers will dare to utilize fine-grained weak memory constructs.

‫ קליטת סגל אקדמי מצטיין‬14

‫ד״ר גלעד אנטלר‬

‫גוריון בנגב‬-‫אוניברסיטת בן‬

What is Bioturbation? The sulfur cycle throughout Earth history

More bioturbation Bioturbation starts Oxygen appears

34S From Canfield and Farquhar (2009)

34SBioturbation intensity increased through-

Bioturbation refers to a wide ‫ תחום המדעים המדוייקים וההנדסה‬- ‫מלגת אלון‬out the Phanerozoic influencing

range of processes by Experiment: the redox state of the
sediment and the cycling
which biological
of sulfur and other
activity displaces
redox- sensitive
sediment. Question:
elements.

Can we model
how the onset of
bioturbation
affected the
sulfur isotope
record?

Bioturbation-driven Results:
changes in the sulfur cycle
60
50

Gilad Antler, Sydney Riemer 40 SO4 No worms
30
SO4 With worms
20 H2S No worms

1Department of Geological and 60 10 H2S with worms
Environmental Sciences Ben-Gurion 0 Water column SO4
-10
University of the Negev Model Equati5o0 n: -20
2Interuniversity Institute For
0
Marine Sciences in Eilat 40 2 4 6 8 10 12 14
Time (days)
f= flux from water to the sediment

C= concentrat3io0n of SO4,w , SO4,s , H2S SO4 No worms
R= sulfate reduction rate
fox = fraction o2f0sulfide that is oxidized SO4 With worms
ε = isotope fra1c0tionation H2S No worms 3D plot

H2S with worms
Water column SO4

Sulfur isotopes:0 [ 34S] = ˆ ȗ ሾCሺ–ሻሿȗ shows the

change in isotopic
ሺ 34Sሺ–ሻ•-1Ǧ0 34Sሺ–ሻ™ሻ ± ሺ ȗ ( 34Sሺ–ሻ• – εሻሻ ±
-20 ሺ 34Sሺ–ሻ ʹ ȗ ʹ ‘š ሻȀ ሺ–ሻ composition of sulfur
Model results :
0 2 4 6 8 10 12 14 species over time as

Time (days) bioturbation (flux) increases.

Increasing bioturbation levels increases the
fractionation between sulfate and sulfide.

Bioturbation changes the sedimentary system from
closed to open, where supply of sulfate is increased

References: Canfield, Donald E., and James Farquhar. "Animal evolution, bioturbation, and the sulfate concentration of the oceans." Proceedings of the National Academy of Sciences 106.20 (2009)

‫ קליטת סגל אקדמי מצטיין‬15

‫ תחום המדעים המדוייקים וההנדסה‬- ‫מלגת אלון‬

‫ד״ר עידן הוד‬

‫גוריון בנגב‬-‫אוניברסיטת בן‬

‫ קליטת סגל אקדמי מצטיין‬16
Research in Idan Hod’s Lab:
New Approaches for Solar Fuel Generation

Metal-Organic
Frameworks (MOFs)

V

CO2
Fuel

H2O
O2

MOF-Based Electrocatalysis MOF-Based Photo-Electrochemistry

MOF C@metal

MOF-Derived Materials 1

Parameterized Complexity New Horizons

NP-hard problems are unlikely to be solvable in time Broaden the input domain.
nc where n is the input size and c is a fixed constant. Beyond graphs: geometric objects, matrices, strings.

Identify a parameter k that is much smaller than n. Enrich the algorithmic toolkit.
Relax the meaning of a reduc-
FPT: solvable in time f(k)nc. 2kn versus 2n ed instance.
Reduce measures other than
Which problems are 2kn k = 5, n = 100 k = 10, n = 105 the input size.
FPT? 2n 3,200 102,400,000
Explore other types of kerneli-
For problems that are > 1030 zation.
FPT, what is the best f? Turing kernels, lossy kernels,
kernels for counting.

Branching Out

Parameterized Complexity and...

Computational Geometry.
Computational Social Choice.
Bioinformatics.
Approximation Algorithms.
‫ד״ר מירב זהבי‬

‫גוריון בנגב‬-‫אוניברסיטת בן‬

‫ קליטת סגל אקדמי מצטיין‬17
Kernelization

Preprocessing is an integral part of applications.

How to measure the quality of data reductions?

Kernelization is a subfield of Parameterized Complexity
that analyzes the theory behind preprocessing.
Kernel: size n time nc size f(k).
The output size is independent of n!
Which problems have a polynomial kernel? What is
the best f?

‫ תחום המדעים המדוייקים וההנדסה‬- ‫מלגת אלון‬

‫‪ 1188‬קליטת סגל אקדמי מצטיין‬

‫מלגת אלון‬

‫תחום מדעי החיים והרפואה‬

‫האוניברסיטה העברית בירושלים‬ ‫שם הזוכה‬
‫אוניברסיטת תל אביב‬
‫אוניברסיטת תל אביב‬ ‫ד"ר נעמי חביב‬
‫מכון וייצמן למדע‬ ‫ד"ר דוד בורשטיין‬
‫מכון וייצמן למדע‬ ‫ד"ר מארק שיין‪-‬אידלסון‬

‫ד"ר אסף גל‬
‫ד"ר יונתן שטלצר‬

‫חברי הוועדה‬

‫פרופ׳ חיה קלכהיים ‪ -‬יו״ר‬
‫פרופ׳ גיל אסט‬

‫פרופ׳ מיכאל גליקמן‬
‫פרופ׳ אברהם זיסויין‬
‫פרופ׳ מאיה שולדינגר‬

‫קליטת סגל אקדמי מצטיין ‪19‬‬

‫ד״ר דוד בורשטיין‬

‫אוניברסיטת תל אביב‬

Treasures from the microbial world:
‫ תחום מדעי החיים והרפואה‬- ‫מלגת אלון‬
Discovery of new CRISPR-Cas systems using metagenomics


David (Dudu) Burstein

George S. Wise Faculty of Life Sciences, Tel Aviv University

Metagenomics, the sequencing of DNA extracted directly CRISPR-Cas systems provide microbes with adaptive immunity

from natural microbial communities, provides access to the to infectious nucleic acids and are widely employed as genome
genetic material of a huge array of uncultivated organisms. editing tools. I mined hundreds of millions of proteins from
metagenomic data seeking novel CRISPR-Cas systems, that could
expand the genome editing toolkit

potential new Cas Cas1

Environmental
DNA extraction
Assembly Genome
CRISPR
array
sampling and sequencing reconstruction Crispr ASsociated proteins

I identiÞed within uncultivated microorganisms a number of CRISPRÐCas systems, including the previously unknown
CRISPR-CasX and CRISPR-CasY systems, the Þrst archaeal Cas9, and a family of miniature Cas proteins named Cas14.

CasX was identiÞed in two evolutionary distant bacteria, CasY was identiÞed exclusively in lineages with no isolates. CRISPR-
both of which were sampled from groundwater in Riße, CasYs are the most compact active systems known to
Colorado date, requiring only two proteins: CasY and Cas1.
Most of these systems were found in samples from
Planctomycetes a cold CO2-driven, geyser in Utah.

Parcubacteria

Kerfeldbacteria

Deltaproteobacteria

Katanobacteria

CasX 4 Cas1 2

We synthesized the CRISPR-CasX locus and demonstrated it
mediates programmable DNA interference in E. coli.

Cas CasX CasX no CasX Cas1 CasY.1
spacer targeting sX.1 targeting sX.2 targeting sX.2 Cas1 CasY.2
CasY.3
target sX.1 sX.2 NT sX.1 sX.2 NT sX.1 sX.2 NT Cas1 CasY.4
Helicase CasY.5
1 CasY.6
Helicase
antibiotic selection Dilutions 0.1 Organisms
for targeted plasmid with CasX

0.01 Organisms
with CasY
0.001
0.0001 Lineage with
no isolated
representative

Cas14 is a novel and diverse family of tiny Cas proteins (400Ð750aa). We further demonstrated Cas14 can be applied for high-Þdelity
We discovered that Cas14a targets single-stranded DNA. SNP detection
CCaaCssCp11fp4f41a1aAGGAvSSSSNNNNPPPPBkgd-subtracted fluorescence (AU)
Cas1 2 Cas4 529aa kObs (min-1) 0.1 10000
Cas14a 0.01 5000
0.001
614aa ● 0.0001
Cas14b ●●

Cas1 2 Cas4 1500 ●● ●
1000 ●● ●●●
Cas1 2 Cas4 518aa
Cas14c ●● ●
●●● ●●
650aa Cas1 Length ●●●● ●● PPeerfrfeectc,t,11111TA913579------C7531A----111121GA8460224608TTMMMMMMMMMM33′MMMMMMMMMM′ 0
Cas14d ●●●●●●●●●●● ●●●●●●
●●●●●●●●●●●●●●●●●●● ●●●●
●●●●●●●●●●● ●●●●●●●●●●●●
●●●●●●●●●
● ●●●●●●●●●●
● ●●●●●●●
●
●● ●●●
●●● ●●●●
●●
●●●●●●●●●●● ●●
●●●
●●●●●
●●●●●●●●●●●●●
●●●●●●●●●●●

●●
●●

415aa ●● HERInCt2eGrneanleseed
Cas14e Cas1 ● Brown-eye SNP: TTCATTTGAGCATTAAATGTCAAGTTCTGC

Cas14f 712aa Cas1 2 ● ● ●● ● ● Blue-eye SNP: TTCATTTGAGCATTAAGTGTCAAGTTCTGC
●
500 ●● crRNA: AACTCGTAATTCACAGTTCA

Cas1+4 2 744aa Cas9 Cas12 ●●●●●● References Burstein, et al. Nature communication (2016)
Cas14g Cas_effector ●●●●
●● Burstein*, Harrington*Haertriangl.toNn*a, tBuurreste(2in0* 1et7a)l. Science
Harrington*, Burstein* et al. Science (2018)
●

Cas14

565aa Cas1 2
Cas14h

‫ קליטת סגל אקדמי מצטיין‬20









‫מלגת אלון‬

‫מדעי החברה‬

‫האוניברסיטה העברית בירושלים‬ ‫שם הזוכה‬
‫האוניברסיטה העברית בירושלים‬
‫ד״ר דבורה מנקין‬
‫אוניברסיטת תל אביב‬ ‫ד״ר אייל קלנטרוף‬
‫אוניברסיטת חיפה‬
‫ד״ר בועז ברק‬
‫אוניברסיטת בן‪-‬גוריון בנגב‬ ‫ד״ר טלי רווה‬
‫ד״ר רון דודאי‬

‫חברי הוועדה‬

‫פרופ׳ יוסי שיין ‪ -‬יו״ר‬
‫פרופ׳ ליאת איילון‬

‫פרופ׳ תמר רות הורוביץ‬
‫פרופ׳ אריאל כנפו‬
‫פרופ׳ טליה פישר‬
‫פרופ׳ אורית קידר‬

‫קליטת סגל אקדמי מצטיין ‪2255‬‬

‫ד״ר דבורה מנקין‬

‫האוניברסיטה העברית בירושלים‬

Group Identity and Non-Violent Activism ‫ מדעי החברה‬- ‫מלגת אלון‬

Devorah Manekin

International Relations Department, Hebrew University of Jerusalem

Abstract Preliminary Results

Scholars of conflict processes have turned to the
systematic analysis of the determinants and
consequences of nonviolent activism, finding that
nonviolent campaigns are far more effective than
violent campaigns in achieving their stated goals.
However, little is known about the conditions that make
some non-violent campaigns more successful than
others, and why some fail altogether. Using research
hypotheses that draw on literature in political science,
social psychology, and sociology, this study focuses on
one such factor – the group identity of the protestors –
examining non-violent activism in the United States
and in Israel to study variation in public perceptions of
the tactics and goals of non-violent campaigns, as well
as variation in their outcomes.

Methods

1) Micro-level study of public perceptions of non-violent
activism in Israel and the United States

2) Macro-level analysis of the role of group identity in Bibliography
violent and non-violent campaign outcomes
1. Chenoweth, Erica, and Kathleen Gallagher Cunningham. 2013.
www.postersession.com “Understanding Nonviolent Resistance An Introduction.” Journal of
Peace Research 50 (3): 271–76.

2. Chenoweth, Erica, and Maria J. Stephan. 2011. Why Civil Resistance
Works: The Strategic Logic of Nonviolent Conflict. New York: Columbia
University Press.

3. Davenport, Christian, Rose McDermott, and David A. Armstrong. 2014.
“Protest, Policing and Public Perception.” Working paper

www.postersession.com

‫ קליטת סגל אקדמי מצטיין‬26

‫ד״ר אייל קלנטרוף‬

‫האוניברסיטה העברית בירושלים‬

The Underlying Neuro-Cognitive Mechanism of

Personalized Inhibitory Training in OCD

The Clinical Neuropsychology Lab ›ƒŽ ƒŽƒ–Š”‘ˆˆ
The Hebrew University of Jerusalem
Š‡ ‡„”‡™ ‹˜‡”•‹–› ‘ˆ
‡”—•ƒŽ‡ǡ •”ƒ‡Ž
‫ מדעי החברה‬- ‫מלגת אלון‬
• Stimuli can evoke the performance of a fMRI
task that has a strong association with VS.
those stimuli.

• A proactive task control mechanism
allows suppressing “stimulus-driven”
behaviors 1,2,3.

• In obsessive compulsive disorder (OCD),
Task control deficit might play a role in
the vicious cycle of obsessions and
compulsions.

• Task control deficit might preclude
successful treatment.

• The current study tested the efficiency
and underlying mechanism of a
personalized computerized task control
program to enhance the effect of
cognitive behavioral therapy to OCD.

+

+

+

• Participants were treatment refractory • Conditioning task control to personalized
OCD patients. OCD related stimuli proved efficient in
augmenting common treatment for OCD.
• Participants completed 1 week of training
with the computerized program. • The rIFG, a brain area known to be
associated with inhibition, displayed
• Participants completed 2 more weeks of higher activation to OCD related stimuli
training + 8 hours of in person after training.
psychotherapy sessions.

• A group of participants were tested in the
fMRI after the first week.

1. Kalanthroff, E., Goldfarb, L., & Henik, A. (2013). Evidence for interaction between the stop signal and the Stroop task conflict. Journal of
Experimental Psychology: Human Perception and Performance, 39, 579-592.
Eyal Kalanthroff 2. Kalanthroff, E., Avnit, A., Henik, A., Davelaar, E. J., & Usher, M. (2015). Stroop proactive control and task conflict are modulated by
Department of Psychology concurrent working memory load. Psychonomic Bulletin & Review, 22, 869-875.
The Hebrew University of Kalanthroff, E., Davelaar, E. J., Henik, A., Goldfarb, L., & Usher, M. (2018). Task conflict and proactive control: A computational theory
Jerusalem 3. of the Stroop task. Psychological Review, 125, 59-82.
Kalanthroff, E., Steinman, S. A., Schmidt, A. B., Campeas, R., & Simpson, H. B. (2018). Piloting a personalized computerized inhibitory
[email protected] 4. training program for individuals with Obsessive-Compulsive Disorder. Psychotherapy and Psychosomatics, 87, 52-54.

27 ‫קליטת סגל אקדמי מצטיין‬

‫ד״ר בועז ברק‬

‫אוניברסיטת תל אביב‬

Myelination deficits as novel pathophysiological findings in
Williams syndrome
Boaz Barak1,2
1The Sagol School of Neuroscience, Tel Aviv University, Tel Aviv, Israel;
2The School of Psychological Sciences, Tel Aviv University, Tel Aviv, Israel.

Introduction Transcriptome analysis of human frontal cortex from WS patients similarlyMyelin ultrastructure
revealed significant downregulation of myelination-related genes.in human cortex
Williams syndrome (WS) is a neurodevelopmental disorder caused by a
heterozygous microdeletion of about 25 genes from chromosomal region B MBP intensity ‫ מדעי החברה‬- ‫מלגת אלון‬C Myelinating Dg-ratio
7q11.23, characterized by hypersociability and unique neurocognitive in human cortex oligodendrocytes
abnormalities. Of the deleted 25 genes, general transcription factor II-i (GTF2I) A Genes with significantly decreased expression in human cortex
has been linked to hypersociability in WS, though the molecular and cellular in WS human cortex
mechanisms mediated by GTF2I deletion are poorly understood.

AB E WS Control
Figure 1. Morphology and genetics
characteristic of WS subjects
(A) Facial morphology of WS subjects. (B)
A diagram of frontal cortical region (BA9)
of human brain (top panel) and an
illustration of WS chromosomal region
(bottom panel).

A. Nir and B. Barak, In preparation 200nm
AB
Figure 6. Myelination-related alterations in the frontal cortex of WS subjects
Figure 2. Altered white matter regions and tracts in WS (A) Gene expression heatmap table with all the myelination-related genes that were significantly
Neuroanatomical regions and tracts presenting white matter abnormalities. White matter reduction is downregulated in WS subjects compared to typically-developed controls. In bold are genes that were also
marked with red arrow; elevation of white matter is marked with green arrow. (A) WS altered regions - significantly downregulated in Gtf2i cKO mice compared to controls. (B) Significantly reduced MBP intensity in
white matter volume. (B) White matter tracts and pathways presenting aberrations in WS. frontal cortex postmortem tissue of WS subjects compared to controls. (C) Significantly reduced myelinating
oligodendrocytes number in WS human cortex tissue compared to controls. (D) Significantly reduced myelin
Previous Results thickness in the frontal cortex of WS subjects, as measured by increased g ratio WS subjects compared to
controls. (E) Myelin ultrastructure in human cortex in WS and controls.
To dissect the neural function of Gtf2i and its relevance to WS, we conditionally Later on the study, 4-aminopyridine (4-ap), an FDA-approved drug, which is a
deleted Gtf2i in forebrain excitatory neurons and found this recapitulates some potassium channel blocker, was given to the mutant mice in order to improve axonal
features of WS, including neuroanatomical defects, increased sociability and conductivity.
anxiety.
A Peak latency B Peak amplitude C Peak latency D Peak amplitude E Irregular ladder F Social preference
CST EMG – 4-AP CST EMG – 4-AP CC - 4-AP CC – 4-AP walking – 4-AP index - 4-AP

A TFII-I in Brain weight C Cortical thickness Dendritic tree
whole cortex B 1 month-old 1 month-old D 4-month old

TFII-I

Tubulin

Figure 7. Gtf2i cKO mice show impaired neuronal conductivity and motor skills that are rescued
following acute administration of 4-ap
(A) Neuronal conductivity deficits in the cortico-spinal tract (CST) of cKO mice, demonstrated by significantly
longer response latency. Following 4-ap acute administration, latency deficits were significantly decreased
E Social preference F Tube test G Open field H Zero maze and normalized to control levels. (B) Peak amplitude in the CST of cKO was not significantly different
Duration Wins Total distance Time in open arms compared to controls, and was increased following 4-ap acute administration. Insets below are representative

traces of evoked field potentials. (C) Neuronal conductivity deficits in the CC of cKO mice, demonstrated by
significantly longer response latency. Following 4-ap acute administration, latency deficits were significantly
decreased and normalized to control levels. (D) Peak amplitude in the CC of cKO was significantly lower in cKO
compared to controls, and was increased following 4-ap acute administration and normalized to control
levels. (E) The fine motor deficits in cKO were rescued following 4-ap acute administration in both forelimb
and hindlimb. (F) Social preference index, as measured in the three chambers social interaction test, was
decreased and normalized to control levels in cKO following 4-ap acute administration.

Figure 3. Neuroanatomical and behavioral deficits in Gtf2i cKO mice Current Study
(A) Significantly reduced expression of TFII-I in whole cortex of 1 month-old cKO compared to controls,
as measured by Western-blot. (B,C) One month-old cKO mice have significantly reduced brain weight (B) The current study aims-
and cortical thickness (C) compared to controls. (D) Representative 2D traces of dendritic trees from 4  To elucidate Gtf2i roles in myelination deficits in WS, and how these deficits
months-old mice. (E) In the three-chamber social interaction test, cKO mice showed significantly higher
social preference compared to controls, interacting significantly longer with a stranger mouse compared affect behavior
to controls. (F) Decreased levels of social dominance in cKO mice, demonstrated by significantly lower  To determine how axonal conductivity properties affect myelination and behavior
percentage of wins in the tube test compared to controls. (G,H) cKO mice showed significantly increased  To validate our basic research findings in clinical environment with human
levels of anxiety-like behaviors compared to controls as demonstrated by significantly shorter total
exploration distance in the open field test (G) and zero maze test (H). patients
Unexpectedly, we found that in the mutant mouse cortex 70% of the  To identify the safe and life-improving drug to treat behavioral and physiological
significantly downregulated genes were involved in myelination. Furthermore,
we found reduced mature oligodendrocyte cell number, disrupted myelin deficits in psychiatric disorders
ultrastructure, impaired axonal conductivity, and fine motor deficits.
Methods
A Genes with significantly decreased expression B Biological pathways significantly affected
in 1 month-old cKO cortex in 1 month-old cKO cortex Clinical trial
Nerve conduction study | Nerve ultrasound | Neurological tests | GAITRite

Basic research
Chronic administration of 4-ap through water | Diffusion tensor imaging (DTI) of
Gtf2i cKO mice | Single-nucleus RNA sequencing

Results FA MD

MRI-DTI of 1 month-old Gtf2i cKO AA CC CC
mice compared to controls was BB
Figure 4. Myelination-related transcriptomic changes in Gtf2i cKO mice analyzed. Fractional anisotropy (FA, CC Hippo Hippo
(A) Gene expression heatmap table including all the genes that were significantly downregulated in the in RED) and mean diffusivity (MD, in
cortex of cKO mice compared to controls. Myelination-related genes are labeled by a # sign. (B) BLUE) are presented. cKO mice
Significantly downregulated cellular pathways in cKO mice cortex compared to controls. Myelination- present altered white matter
related pathways are labeled by a # sign. properties in several brain regions,
compared to controls.
Myelinating oligodendrocytes B Myelin ultrastructure in CC C g-ratio D % axons Figure 8. DTI analysis of Gtf2i cKO mice
A in cortex and CC midline myelinated compared to controls
Coronal and sagittal planes with altered FA and
Control Cortex CC Control MD properties in cKO mice compared to controls.
Major white matter alterations are found in (A) the
cKO cKO CC (B) the hippocampus (C) the frontal cortex.
These regions were previously found altered in
myelin ultrastructure measured in cKO mice and in
human tissue samples.

CC1/Olig2 100µm Conclusions

Figure 5. Gtf2i cKO mice show impaired cellular properties and myelin ultrastructure Our research identified the first molecular and cellular pathology of WS, and a
(A) Representative images of immunofluorescence labeling demonstrating reduced number of mODCs novel pathophysiological mechanism in WS linked to neuron-oligodendrocytes
in the cortex and CC midline of 1 month-old cKO mice compared to controls. (B) Representative images signaling deficits .
of myelin ultrastructural abnormalities in the CC midline of cKO mice compared to controls. (C) Together these data suggest new paths to explore the neurobiological
Significantly reduced myelin thickness in the CC midline of cKO mice, as measured by increased g ratio in mechanisms and potential therapeutic targets for social and cognitive
cKO mice compared to controls. (D) Significantly lower percentage of myelinated axons in the CC midline abnormalities in WS .
of cKO mice compared to controls.
www.posters essi on.com

‫ קליטת סגל אקדמי מצטיין‬28

‫מלגת אלון‬

‫תחום מדעי הרוח‬

‫שם הזוכה‬

‫ד״ר מיכל מרמורשטיין האוניברסיטה העברית בירושלים‬

‫ד״ר חנה פולין‪-‬גלאי אוניברסיטת תל אביב‬

‫אוניברסיטת בר‪-‬אילן‬ ‫ד״ר נטליה מאיר‬

‫אוניברסיטת חיפה‬ ‫ד״ר יצחק יפה‬

‫חברי הוועדה‬

‫פרופ׳ יאיר זקוביץ ‪ -‬יו״ר‬
‫פרופ׳ אלה בלפר‬

‫פרופ׳ רוני הנקין‪-‬רויטפרב‬
‫פרופ׳ מוסטפא כבהא‬
‫פרופ׳ רותם קובנר‬
‫פרופ׳ ישי רוזן‪-‬צבי‬
‫פרופ׳ זיוה שמיר‬

‫קליטת סגל אקדמי מצטיין ‪29‬‬

‫ תחום מדעי הרוח‬- ‫מלגת אלון‬

‫ד״ר מיכל מרמורשטיין‬

‫האוניברסיטה העברית בירושלים‬

‫ קליטת סגל אקדמי מצטיין‬30
Discourse Markers in Spoken, Written, and Digital Discourse
Michal Marmorstein

Department of Linguistics, The Hebrew university

§ Discourse markers (DMs) are window onto the processes, actions, In written Egyptian Arabic, the DM yaʕni
attitudes, and relations that underlie and motivate discourse undergoes various forms of adaptation:
design.
§ acquiring of symbolic function
§ Due to their tight connection to context, DMs also become § semantic-rhetorical specification
indexical of the discourse types in which they are used. § intensification of evocative force

§ DMs which constantly recur in conversation become indices of These adaptations are indicative of the
conversational interaction as a whole and hence impart a difference between colloquial and
conversational flavor also to other discourse types in which they conversational language. In developing more
occur. monologic written uses, the colloquial drops
its most obvious indicators of intersubjectivity
§ DMs, therefore, do not only disclose the internal workings of including a large set of DMs.
spoken or written discourse, but also enable insight into the
conceptual traits associated with each mode of communication. In quasi-synchronous forms of digital discourse, socio-cognitive DMs are
strategic (rather than symptomatic) devices that help negotiate
In spoken language, DMs have socio-cognitive functions. They index interpretations and implications of the exchange.
two key dimensions: temporality and interactionality.
In Hebrew WhatsApp dialogues, the item emm, replicating a spoken
In spoken Egyptian Arabic, the DM yaʕni (lit. ’it means’) has two hesitation marker, emerged as a DM which registers a challenge in the
main functions: (1) to facilitate effortful processing (line 2), and (2) upcoming or following sequence .
to frame elaborations of previous discourse in order to enhance
mutual-understanding (line 5).

Marmorstein, Michal. 2016. “Getting to the point: The discourse marker yaʕni (lit. ‘it means’) in unplanned discourse in
Cairene Arabic.” Journal of Pragmatics 96: 60-79.
Marmorstein, Michal and Yael Maschler. 2019. “Stance-taking via ya'ani /ya'anu: A discourse marker in a Hebrew-Arabic
language contact situation.” Language in Society.
Marmorstein, Michal. 2019. “What do discourse markers mark? Arabic yaʕni (‘it means’) and Hebrew ya'ani across
modalities and sociolinguistic systems”. In: Approaches to Discourse.
Marmorstein, Michal. Forthcoming. “Discourse markers as a lens to variation across speech and writing: Egyptian Arabic
yaʕni (lit. ‘it means’) as a case study.”

‫מלגת אלון ‪ -‬תחום מדעי הרוח‬ ‫ד״ר חנה פולין‪-‬גלאי‬

‫אוניברסיטת תל אביב‬

‫''חורבן–יידיש''‬

‫ד''ר חנה פולין–גלאי‬
‫החוג לספרות‪ ,‬אוניברסיטת תל אביב‬

‫וההנשיפסעיותנוהתשלותאעהדעאולתשהפת היידיש‬
‫בלקסיקונים שנכתבו בתקופת‬
‫המלחמה ומיד אחריה‪.‬‬
‫באישננוטלתקהט–ו‪0‬א‪4‬ליוםה–מ‪0‬ו‪5‬ביהליעיםדו‬
‫מהקהילות היהודיות במזרח‬

‫אהיתרוקפדיה‪,‬םכישההיואנליחמלותת וםהבגסטבלאוחתסרי‬
‫ובמחנות הכריחו את דוברי היידיש‬

‫להמציא מילים וביטויים חדשים‬
‫רבים‪.‬‬

‫מילונים של יידיש מהשואה‪:‬‬
‫נחמן בלומנטל‪'' ,‬ווערטער און ווערטערלעך פֿון דער חורבן תקופֿה'' )מילים וביטויים‬

‫מתקופת השואה(‪ ,‬ניו–יורק ‪1959-1956‬‬
‫ישראל קפלן ד ָאס ֿפאָלקסמויל אין נ ַאצי–קלעם )לשון העם תחת הנאצים(‬

‫מינכן‪1949 ,‬‬
‫אליה ספיבק די שּפראַך אין די טעג פֿון דער ֿפאָטערלענדישער מלחה )השפה בימי המלחמה‬

‫הפטריוטית הגדולה( קייב‪1945 ,‬‬

‫נושאים עיקריים ודוגמאות‪:‬‬

‫'' ָארגאַניזירן‪'' '',‬שאַבערן‪'' '',‬ש ַאברעווען''‬ ‫‪ .1‬גניבה‪ ,‬שוחד‬

‫''לויזן אַליי'' ''לויזערין''‬ ‫‪ .2‬בעלי חיים‬

‫''ּפיּפעל‪'' '',‬קוזינקע''‬ ‫‪ .3‬זנות‪ ,‬ניצול מיני‬

‫‪1‬‬

‫קליטת סגל אקדמי מצטיין ‪31‬‬

‫ד״ר נטליה מאיר‬

‫אילן‬-‫אוניברסיטת בר‬

Heritage Language (HL) grammar development: ‫ תחום מדעי הרוח‬- ‫מלגת אלון‬
the case of Heritage Russian in contact with Hebrew

Natalia Meir (Bar-Ilan University)

‫ שלום‬дом Heritage Language and Heritage Language Speakers
‫תודה‬ ‫בית‬
семья • Heritage Language (HL) - a language that is spoken at home but is not the majority language of the society
спасибо (Benmamoun, Montrul, & Polinsky, 2013).
мазган ‫חברים‬
• HL speakers are typically the 2nd or 3rd generation of immigrants who acquire their HL from birth until the onset of
привет schooling (via naturalistic exposure to native input.

• The linguistic performance of HL speakers varies significantly within groups and across the lifespan of each individual.
• Between 40 to 50 HLs are spoken by immigrants of the 1st, 2nd, and 3rd generations (see Spolsky & Shohamy, 1999).
• Russian is the most frequently spoken language in Israel after Hebrew and Arabic.

Aims of the proposed project

The proposed study aims to develop a model of HL attainment trajectory by connecting the beginning of HL development with its ultimate attainment. in
Current models suggest:

• “incomplete acquisition”, i.e., a scenario under which a grammatical phenomenon was simply not acquired (Montrul, 2008);
• “attrition”, i.e., a scenario under which a grammatical phenomenon was acquired in childhood and then lost over time (Polinsky, 2007);.
• HL grammars cannot be viewed as “broken” or “incomplete”, but rather constitute the emergence of a new linguistic variety

in a contact situation (Kupisch & Rothman, 2016).

HL grammar evolvement: child speakers HL end-state grammar: adult speakers

End-state HL grammars differ from baseline grammars and these
divergences are linked to the properties of Hebrew and age of Hebrew
onset (Meir & Polinsky, submitted)

Typical HL development in HL-Russian speakers aged 5-6: Adjectival Phrases Numerical Phrases
HL-Russian grammar undergoes re-structuring under the influence of the
dominant language (Hebrew) (Meir, 2018; Meir & Janssen, forthcoming; Russian bel-yj samolet 2 samolet-a
Meir, Walters & Armon-Lotem, 2016, 2017) bel-ye samolet-y 5 samolet-ov

Hebrew matos lavan 2/5 matos-im
matos-im lavan-im

[ACC] Verbal Similar (agreement in Different
Case Aspect Inflections number and gender)

Russian + + +
Hebrew + - +
Different Different Similar
Errors
Results

HLchildren HLchildren HLchildren
> mono > mono = mono

Atypical language development in HL-Russian speakers aged 5-6 HL speakers (i.e., acquisition of Hebrew before the age of 5) and early
(children with Specific Language Impairment and children with Autism). L2 learners (i.e., acquisition of Hebrew between the ages of 5-13) were
show quantitative differences and different error patterns than HL- more sensitive to mismatches on adjectival conditions as compared to
speakers with typical language development (Armon-Lotem & Meir, 2016; numerical conditions.
Meir & Novogrodsky, in preparation).

Theoretical and Societal Implications

Theoretical Implications Societal Implications for language pedagogy, clinical assessment and intervention.
HL outcome grammars pose several fundamental Research on adult, end-state HL grammars is expected to:
questions: (i) provide insights into the nature of the linguistic input that is available to child HL
(i) how do these grammars differ from the “baseline” speakers;
grammars of monolingual speakers; (ii) serve as a benchmark for understanding language development in child HL speakers
(ii) which mechanisms are associated with HL ultimate with typical and atypical language development (e.g., Specific Language Impairment
attainment. [SLI], Autistic Spectrum Disorder [ASD], Hearing Impairments).

Contact Information: Natalia Meir ([email protected])

‫ קליטת סגל אקדמי מצטיין‬32

‫ תחום מדעי הרוח‬- ‫מלגת אלון‬

‫ד״ר יצחק יפה‬

‫אוניברסיטת חיפה‬

33 ‫קליטת סגל אקדמי מצטיין‬
What do Barbarians Eat? - Food and Society at the Fringes of Bronze Age China

Dr. Yitzchak Jaffe Ceramic analysis Cooking experiment
‫ד"ר יצחק יפה‬
This paper presents the results of our culinary investigation of the Our experiments were geared towards understanding how the
‫החוג לארכיאולוגיה‬ unique pattern observed on Siwa ceramic vessels could be made
with a millet-based dish. We experimented with whole-grain
Intro Ma’an jars - the main ceramic vessel of the Siwa culture. millet and millet flour dishes cooked in water and varying
degrees of heat sources and intensities. The remains of the
Exploring the ceramic assemblage from the recently excavated following three cooking methods most closely resembled the
observed use-wear pattern:
Zhanqi cemetery in Gansu

province involved usewear

The cultures inhabiting the Western fringes of the Shang and analysis (which reflects how
Zhou world ~1250-771 BCE are mostly seen as inferior and
uncivilized. When they are mentioned in historical texts, food vessels were used to cook
often plays an important role in their characterization as bar-
barians: They are those who consume more meat than grain food), together with chemical
and know little about good dining etiquette.
residue analysis studies, in

order to uncover food ingredi-

ents.

Preserved carbonized food

“the Eastern Yi eat their food without it being cooked with fire Externally, soot - the by-

.... the western Rong wore skins... Some of them did not eat products of fuel combus-

grain-food” (Liji , Rites Records, translated by James Original color tions, can be found on the Millet flour in water, flame on side Carbonization neck to base
Soot upper part of the vessel, + water ring
Legge)

while oxidization marks -

evidence of intense heat ex-

posure, were found beneath

Culture Approximate them on the body, but only
Dates BCE
Yangshao 5000-3000 on two opposite sides.
Majiayao 3300-2650 Internally, carbonized food
2800-2300 oxidation remains, which occur when
Banshan
2300-1950 little fat is used were found Millet grains braised on side first Heavy carbonization neck to base
Machang
Qijia 2200-1800 Visual distribution of external usewear patterns on the inverse of the oxi-
Siba 1950-1550 dized side but not on the
Kayue 1800-1500 on a ma’an jar
Xindian 1600-600 base
Siwa 1400-500 o A dry mode of cook-

ing, perhaps roasting,

or one where little

liquid remained in the

dish, can be inferred.

o The pattern is confus- Millet cakes toasted on side Carbonization in area of contact

ing, as it seems to pre- The Siwa Ma’an jar is a pot, griddle and oven all in
one. It is a versatile and portable utensil that can be
clude direct placement placed near the fire or on a bed of coals for various
dishes, quite possibly where the development of
of the vessel in the fire, crunchy socarrat was of primary importance.

as the base is devoid of

Distribution of Siwa culture sites remains. Schematic drawing of usewear pattern

The Siwa archaeological culture (1400-500 BCE), is Carbonized deposits from ten potsherds
were sampled to extract and identify lipids
often identified as the barbarian tribes on the Western bor- trapped during use. GCMS analysis revealed Millet stew with millet crisps
the presence of miliacin, a pentacyclic triter-
ders of the ancient Chinese world. pene abundant in grains
of broomcorn millet.
Foodways assumptions C16:0 Ingredients Instructions
Relative intensity C18:0 Amyrin
o Diet high in Meat and low in Grain Unknown terpene Stigmastanol 1/2 pound fatty pork, cubed Place pork, 1/2 the spice mixture and the oil in
o Pastoralists: Sheep & Goat 1/2 cup spice mixture a bowl to marinate. Add the pork to hot vessel
o Uncooked food Miliacin 2 Tbsp vegetable oil (on its side) and sear well on one side then add
o Simple, unsophisticated cuisine 1 cup whole grain millet millet, eggplant, ginger, garlic and scallions.
o Inferior ceramic vessels 27.4 27.6 27.8 28 28.2 1 medium-sized eggplant, diced cook until crust forms. Turn pot on base, add
4 Tbsp minced garlic half of the stock to deglaze. Bring to boil, add
C14:0 C17C1br7:0 2 Tbsp minced ginger the remaining stock as needed. Cook until the
C18:1 1 cup finely chopped scallions, millet is slightly al dente and season to taste.
C10:0
DC7 C19:0 white part only Serve with millet crisps - Add millet flour and
DC8 C20:0 1 quart soy flvoured chicken stock water mixture to hot griddle and fry until
10 whole dried apricots, diced crispy and slightly charred.
C12:0 C21:0 4 Tbsp Chinese 5 spice powder
DC9 C22:0
DC10
DC11 C23:0
C1C51b5r:0 C24:0
C26:0

10 12 14 16 18 20 22 24 26 28 30

Retention time

‫מלגת מעוף‬

‫מטרות‪:‬‬
‫מלגות “מעוף” מיועדות למדענים צעירים מצטיינים‪ ,‬בני‬
‫החברה הערבית‪ ,‬אזרחי מדינת ישראל‪ .‬מטרתן לאפשר לזוכים‬
‫להיקלט במערכת המוסדות להשכלה גבוהה המתוקצבים ע”י‬
‫ות”ת בישראל‪ ,‬אוניברסיטאות ומכללות אקדמיות‪ .‬המוסדות‬
‫מתחייבים לקלוט המלגאים כחברי סגל במשרה מלאה בתום‬

‫תקופת המלגה‪.‬‬

‫תקופת המלגה‪:‬‬
‫המלגות הן תלת‪-‬שנתיות‪ ,‬לשלוש שנים אקדמיות‪.‬‬

‫גובה המלגה‪:‬‬
‫כ‪ ₪ 300,000-‬בשנה‪ ,‬כגובה עלות השכר הממוצעת בדרגה‬
‫בה נקלט המלגאי (מרצה ‪ /‬מרצה בכיר ‪ /‬פרופ’ חבר)‪ .‬בנוסף‬
‫מוענק למלגאים הנקלטים באוניברסיטאות בשנה הראשונה‬
‫מענק מחקר חד פעמי בגובה של ‪ 170‬אלף ש”ח לתחומים‬

‫הניסויים ובגובה של ‪ 50,000‬ש”ח לתחומים העיוניים‪.‬‬
‫למלגאים הנקלטים במכללות מענק קליטה חד פעמי בגובה‬
‫‪ 100,000‬ש”ח לתחומים הניסויים ו‪ 30,000-‬ש”ח לתחומים‬

‫העיוניים‪.‬‬

‫מס׳ המלגות‪:‬‬
‫מידי שנה מוענקות ‪ 6‬מלגות מעוף כאשר ‪ 4‬מהן מתוקצבות‬

‫ע”י הות”ת ו‪ 2-‬מלגות מתוקצבות ע”י קרן יד הנדיב‪.‬‬

‫‪ 3344‬קליטת סגל אקדמי מצטיין‬

‫מלגת מעוף‬

‫שם הזוכה‬

‫המכללה האקדמית תל‪-‬חי‬ ‫ד״ר לואי בשיר‬
‫מכון טכנולוגי חולון‬ ‫ד״ר האשם זועבי‬
‫ד״ר מוהנד מחאג׳נה‬
‫המכללה האקדמית בית‪-‬ברל‬
‫הטכניון‬ ‫ד״ר קיזל פאדי‬
‫ד״ר נדים כרכבי‬
‫אוניברסיטת חיפה‬ ‫ד״ר חנין קרוואני‪-‬חורי‬
‫אוניברסיטת חיפה‬

‫חברי הוועדה‬

‫פרופ׳ אהרן צ׳חנובר ‪ -‬יו״ר‬
‫פרופ׳ ג׳האד אסנע‬
‫פרופ׳ מונא מארון‬

‫פרופ׳ פאדיה נאסר אבו אלהיג׳א‬
‫פרופ׳ שרה סטרומזה‬
‫פרופ׳ אורי סיון‬

‫קליטת סגל אקדמי מצטיין ‪3355‬‬

‫ד״ר לואי בשיר‬

‫חי‬-‫המכללה האקדמית תל‬

Identification of functional compounds from botanical sources, and
development of their production processes and applications in foods

Loai Basheer, Ph.D. ‫מלגת מעוף‬

Department of Food Sciences, The Faculty of Sciences and Technology, Tel-Hai Academic College, Upper Galilee, Israel

Background: The increasing consumer's demand of high-quality, safe and healthy food products and the rejection
of synthetic additives are driving the scientific community and food industry to pursue natural alternatives that can fulfill
functional properties. This research focuses on the novel use of plant-derived compounds from agricultural waste for
food production, while the added compounds may provide both technological and health promoting properties.

Functional Compounds Methodology
Research Flow
Properties related to Properties related to
food technology and health and/or • Searching for natural compounds with
. potential functional properties from plants
production, e.g., nutritional benefits,
thickening, gelling, e.g., antioxidants, and agricultural waste/residues.

stabilizing, etc. prebiotics, etc. • Extraction and separation processes.

Compounds of interest • Identification and determination of the
compounds using analytical methods.

• Characterization of the compounds and their
functional and technological properties.

• Using the derived compounds in food
production and studying the effects on the
food product properties.

Results

The effect of an extracted Viscosity [Pa·s] 0.35 The emulsifying ability of Turbidity (OD500nm) 2.5
compound from agricultural 0.30 the extracted compound 2.0
waste (Com-1, green bars) 0.25 (Com-1, green curve), 1.5
on rheological and texture 0.20 compared with known 1.0
properties of tomato sauce, 0.15 emulsifier (Lecithin, black 0.5
as compared with known 0.10 curve), as reflected from the 0.0
thickening agent (Starch, 0.05 turbidity value. Data are
black bars). Data are mean ± 0.00 mean ± S.E. 0.2 0.3 0.5 1.0
S.E. = Com-1 , = Starch Concentration (%)
0 0.05 0.15 0.3 0.5
0.30 Concentration (%) The antioxidant activity of the extracted compound (Com-

0.25 14.0 1) as evaluated by the assays of FRAP and free radical
12.0
0.20 Toughness (Nmm) 10.0 scavenging activity. Data are mean ± S.E.

Hardness (N)0.15 8.0 50 50
6.0 Trolox Equivalent Radical Scavenging
0.10 4.0 (µg/ml) 40 40 Activity (%)
2.0
0.05 0.0 30 30

0.00 0 0.05 0.15 0.3 0.5 1 20 20
0 0.05 0.15 0.3 0.5 1 Concentration (%)
Concentration (%) 10 10
0.10
1.2 0 0
0.08 012345
1.0 Com-1 Concentration (%) 012345
0.06 Com-1 Concentration (%)
0.8
Cohesiveness Adhesive force (N)0.04 Conclusions:
0.6 The extracted compound (Com-1) acts as thickening
0.02
0.4 agent in the tested food products, with high similarity to
0.00
0.2 0 0.05 0.15 0.3 0.5 1 the reference compound (Starch).
Concentration (%) Com-1 shows remarkable emulsifying ability as
0.0
0 0.05 0.15 0.3 0.5 1 compared to lecithin.
Concentration (%) Com-1 represents antioxidant activity.
Neglected agricultural waste might be a rich source for

beneficial compounds for foods and nutrition.

‫ קליטת סגל אקדמי מצטיין‬36

‫ד״ר האשם זועבי‬

‫מכון טכנולוגי חולון‬

‫מלגת מעוף‬ Quantum Phenomena of Interactiong Photons and Phonons
in Nanoscale Structures
Hashem Zoubi

Department of Physics, Holon Institute of Technology

Quantum Nonlinear Optics with Photons Slowing Light using Sound (without gain or loss)

• Non-interacting Photons: efficient for communication
• Information processing implies interacting photons
• Classical nonlinear optics negligible on the level of

single photons

Photon-Phonon Interactions

• Stimulated Brillouin Scattering: Scattering of
photons from phonons

• Electrostriction: Materials get compressed in the
presence of light

• Radiation Pressure: Light forces on the boundaries

Nanoscale Waveguides

A signal with two counter-propagating pump fields
involving acoustic phonons

Photon-Photon Effective Interactions mediated
by phonons

Quantum Logic gates Z-Controlled Gate:

Experiments: Van Laer et al. Nature Photonics 9, 199 (2015) Outlook
Kittlaus et al., Nature Phot. 10, 463 (2016)
• Quantum information processing with photons
Free Hamiltonian: • Quantum computing involving photons
• Memory devices for photons
Interaction Hamiltonian: • Nano-phononics: Phonon Laser, Source of single phonons
• Non-classical states of photons and phonons
• Radiation Pressure dominant at nanoscale structures
• Solid State Setup: Easily integrated into all-optical

on-chip platform

References: H Zoubi & K Hammerer, PRA 94, 053827 (2016)

H Zoubi & K Hammerer, PRL 119, 123602 (2017)
H Zoubi, JOPT 20, 095001 (2018)

37 ‫קליטת סגל אקדמי מצטיין‬

‫ד״ר קיזל פאדי‬

‫הטכניון‬

SPATIALLY ADAPTIVE HYPERSPECTRAL UNMIXING BASED ON SUMS OF
2D GAUSSIANS FOR MODELLING ENDMEMBER FRACTION SURFACES

Fadi Kizel1, Maxim Shoshany1, and Nathan S. Netanyahu2, 3

1 Dept. of Civil and Environmental Engineering, Technion Israel Institute of Technology, Haifa 32000, Israel
2 Dept. of Computer Science, Bar-Ilan University, Ramat-Gan 52900, Israel

3 Center for Automation Research, University of Maryland at College Park, MD 20742, USA

OVERVIEW
We present a new method for spatially adaptive spectral unmixing, called the Gaussian based spatially adaptive unmixing
(GBSAU) method. GBSAU takes advantage of both the spatial and spectral relations of the image pixels to determine the
actual subset of endmembers (EMs) per pixel. It is based on spatial localization of the EMs by fitting, for each EM, the
parameters of the series of spatial Gaussians whose sum represents the EM's fraction surface over the image.
RMSE
1 Identification of EM cores 2 Fitting a sum of 2D Gaussians for modeling of
‫מלגת מעוף‬ spatial fraction surfaces

Input Step 1 Step 1 Place a narrow 2D Gaussian around each spectral core, and model the
Hyperspectral image and a set of EMs Calculate spectral similarity surfaces

D(x,y,i) = 1 − SAM (m, Ei ) spatial fraction distribution of each EM over the image as the sum of such 2D

Gaussians, i.e.,

∑fi (x,y) = hi Gij (x,y)
j =1

whereGij (x,y) is the j-th Gaussian (out opfarhaimGeatuesrssia(an0s,au1,sσedx , to represent the fraction
surface of the i-th EM), defined by the 7 σy , θ, x0,y0 )

Step 2: For each EM, find regional maxima on Output : Set (C = C1 ∪C2) of candidate spectral representing the offset, magnitude, axial standard deviations, rotation and location,
the spectral similarity surfaces core points for each EM
respectively.

Step 2 Define the objective function to be maximized as the overall spectral
similarity between the source image and the reconstructed images (by the EM set and
the estimated fractions) as follows:

∑ ∑c r where φ(x,y) = m(x,y)T Eˆf(x,y)
m(x,y) ⋅ Eˆf(x,y)
Ω = φ(x, y)

x =1 y =1

Set C1: Extracted as regional maxima Set C2: Extracted as multi-layer regional maxima c = # columns m(x,y) is the image spectral signature at(x, y)
r = # rows ˆf(x,y) is the estimated fraction vector at(x, y)

• Regional maxima have a maximal intensity value relative to their spatial surrounding neighborhood Step 3 Denote the estimated vector of all unknowns (i.e. the Gaussian
• Multi-layer regional maxima have a maximal intensity value relative to their surrounding parameters) as Pˆ and iterate according to the gradient descent optimization, i.e.,
neighborhood and the corresponding neighborhoods in other intensity layers.
Pˆk +1 = Pˆk + γ∇Pˆk
∂Ω
3 Semi-synthetic image for visualization and quantitative where γ is the step size, ∇Pˆk ≡ ∂Pˆ k is the objective function gradient at Pˆk
assessment
∇Pˆ =  ∇Pˆ11 , ∇Pˆ12 ,…, ∇Pˆ1h1 , ∇Pˆ21 , ∇Pˆ22 ,…, ∇Pˆ2h2 ,…, ∇PˆL1 , ∇PˆL2 ,…, ∇PˆLhL T ,

To evaluate the algorithm's performance, a semi-synthetic image (with simulated ground-truth Pˆij = a0ij ,a1ij , σx j , σy j , θij , x j , y0ij Ta,nd
fractions) was created from a (234 × 284) AisaDUAL sub-image and the spatial distribution of 11 of i i 0i

its EMs.  T

Semi-synthetic image Algorithm’s progress ∂Gij (x, y) = ∂Gij (x, y ) , ∂Gij (x, y ) , ∂Gij (x, y ) , ∂Gij (x, y ) , ∂Gij (x , y ) , ∂Gij (x, y ) , ∂Gij (x, y )
∂Pˆij ∂a1ij ∂σyij ∂θij ∂y0ij
∂a j ∂σx j ∂x j
0i i 0i

An iterative process adjusts the Gaussian parameters while maximizing the objective
function. Gaussians surrounding an EM's real cores are expected to evolve during the
iterative process and converge approximately to the real fraction distribution of the EM
around the cores.

selected spatial profile Selected region A 4 Applying to real image
The performance of the GBSAU was evaluated relatively to the three unmixing
The comparative performance of the GBSAU was evaluated relatively to FCLSU [4], SUnSAL [5],
and VCGDU [3, Ch. 3] by calculating the root mean square error (RMSE), for each EM: methods by qualitative visual analysis of fraction maps obtained (relatively to the real

image). Fraction maps

GBSAU Ordinary unmixing Vegetation Red roof Vegetation Red roof

∑ ∑RMSEi = r 1 c c r y) − fi (x, y))2
⋅ =1
x (fˆi (x,

y =1

EM# 1 2 3 4 5 6 7 8 9 10 11 FCLSU SUnSAL
FCLSU 0.078 0.068 0.053 0.067 0.029 0.016 0.034 0.015 0.030 0.054 0.011 VCGDU GBSAU
SUnSAL 0.078 0.068 0.053 0.067 0.029 0.016 0.034 0.015 0.030 0.054 0.011
VCGDU 0.036 0.056 0.058 0.057 0.023 0.021 0.027 0.012 0.027 0.049 0.009
GBSAU 0.014 0.028 0.030 0.026 0.010 0.005 0.011 0.005 0.012 0.025 0.008

Fraction surface visualization (red roof)

References

[3] F. Kizel, "Novel methods for stepwise analytical and spatially adaptive hyperspectral unmixing," Ph.D. thesis, Department of Civil and Environmental Engineering, Technion, Israel Institute of Technology, September 2014.
[4] D. Heinz and C.-I. Chang, “Fully constrained least squares linear mixture analysis for material quantification in hyperspectral imagery,” IEEE Transactions on Geoscience and Remote Sensing, vol. 39, pp. 529–545, 2000.
[5] J. Bioucas-Dias and M. Figueiredo, “Alternating direction algorithms for constrained sparse regression: Application to hyperspectral unmixing,” in Proceedings of the IEEE GRSS Workshop on Hyperspectral Image Signal Processing: Evolution in
Remote Sensing, 2010, vol. 1, pp. 1–4.

‫ קליטת סגל אקדמי מצטיין‬38

‫מלגת מעוף‬ ‫ד״ר נדים כרכבי‬

‫אוניברסיטת חיפה‬

‫תקציר מחקר לחוברת ופוסטר בטקס הענקת מלגות מעו"ף‬
‫ד"ר נדים כרכבי (החוג לאנתרופולוגיה‪ ,‬אוניברסיטת חיפה)‬
‫עבודת הדוקטורט שלו עסקה בסצנת המוסיקה הפלסטינית האלטרנטיבית בישראל ובגדה‬
‫המערבית‪ .‬במחקר הוא בחן כיצד צעירים פלסטינים נאבקים הן בסוגיות לאומיות הקשורות‬
‫לאזרחות מודרת וחיים תחת כיבוש‪ ,‬והן בסוגיות חברתיות ותרבותיות בתוך קהילותיהם‪ .‬מבחינה‬
‫היסטורית ההוא התייחס לאופן שבו ייצוגים לאומיים של גבורה וקורבנות מוחלפים בייצוגים של‬
‫אנושיות והרצון לנורמאליות‪ .‬בלב המחקר נמצאת הפוליטיקה של ההנאה כביטוי של אנושיות‪ ,‬של‬
‫סוכנות פוליטית‪ ,‬ושל הכמיהה לשחרור אישי ולאומי‪ ,‬בצל השפעת הכלכלה הניו‪-‬ליבראלית‬
‫והקיפאון במשא ומתן הפוליטי‪-‬לאומי כיום‪ .‬סוגיות אלה הובילו לניתוח מרחבי של הסצנה‬
‫והאסתטיקה של תוכן ופרפורמנס‪ ,‬יחד עם שאלות על כינון הסובייקט‪ ,‬התנגדות‪ ,‬נורמליזציה‬

‫וריבונות עצמית‪.‬‬

‫בהמשך לכך‪ ,‬לאחרונה הוא התחיל לעבוד על סצנת המוזיקה הישראלית בשפה הערבית‪.‬‬
‫סצנה זו כוללת בעיקר מוסיקאים וקהלים יהודים‪-‬ישראלים בני הדור השלישי למהגרים ממדינות‬
‫ערב וגם מעט פלסטינים אזרחי ישראל‪ .‬מדובר בשדה תרבותי שהולך ומתרחב בשנים האחרונות‬
‫בארץ וכולל ביצוע מוסיקה קלאסית ערבית לסוגיה (טרב‪ ,‬מוסיקה אנדלוסית‪ ,‬וכד')‪ ,‬מגוון של‬
‫מוסיקת פולקלור מרחבי העולם הערבי‪ ,‬ומוסיקה פופולארית הכוללת עיבודים ואף מילים‬
‫מקוריות‪ ,‬שביחד צוברים קהלים מגוונים בארץ ובעולם‪ .‬העבודה התיאורטית בשדה מוסיקלי זה‬
‫מתמקדת באופני השימוש בשפה הערבית ומשמעויותיה למוסיקאים והקהלים היהודים‬
‫בישראלים‪ ,‬וכן גם בבניית הערביות כזהות תרבותית בישראל‪ ,‬ולאו דווקא אתנית‪ .‬מתוך כך עולות‬
‫גם סוגיות חברתיות חשובות על הבניה דתית‪ ,‬לאומית ומעמדית‪ .‬למרות ששאלות אלו נידונו‬
‫במחקרים רבים מתחום הסוציולוגיה‪ ,‬ההיסטוריה והספרות‪ ,‬שדה המוסיקה מציע רבדים נוספים‬
‫לדיון בגלל האופי הפרפורמטיבי שלו‪ .‬למעשה המוסיקה בשפה הערבית מאפשרת השתתפות בייצוג‬
‫והאזנה גם בקרב הדור השלישי של יוצאים מדינות ערב שברובם כבר אינם דוברים את השפה‪.‬‬
‫פרקטיקה זו משקפת את השינויים בייצוג זהות ערבית (ומתוך כך גם זהות ישראלית וזהות יהודית)‬

‫בקרב צעירים בארץ ובשדה התרבותי בישראל בשנים האחרונות‪.‬‬

‫קליטת סגל אקדמי מצטיין ‪39‬‬

‫חורי‬-‫ד״ר חנין קרוואני‬

‫אוניברסיטת חיפה‬

Restoration of Sensory Input Improves Neural and Cognitive Processing

Hanin Karawani-Khoury1 & Samira Anderson2

1Department of Communication Sciences and Disorders, University of Haifa, Haifa, Israel
2Hearing and Speech Sciences Department, University of Maryland, College Park, MD, USA

Contact: [email protected]

Introduction ‫מלגת מעוף‬

• Adult aging is associated with hearing loss1, speech perception difficulties2,3, and declines in • The present study focuses on neural and behavioral changes due to the use of
episodic memory4, processing speed5, and working memory resources6. amplification over the course of six months 15,16.
• Subcortical15 and cortical16 neural changes induced by hearing aid use, using
• Hearing loss is independently associated with accelerated cognitive decline in older adults7. frequency-following responses (FFRs) and cortical auditory evoked potentials
(CAEPs).
• The connection between hearing loss and decreased higher level speech processing motivated • Effects of hearing aid use on cognitive processing of older adults.
us to examine whether increased audibility through the use of hearing aids can positively
affect or offset cognitive declines. For more information about the study, please refer to:
Karawani et al. 2018, Neuropsychologia, 114, 203–213;
• Hearing aids offer the potential to mitigate the effects of sensory loss, restoring some aspects Karawani et al., 2018, Clinical Neurophysiology, 129, 1254–1267
of sensory functioning8,9.

• Electrophysiological studies in older adults have assessed amplification effects on subcortical
10,11 and cortical 12 auditory regions during a single session.

• Previous studies have investigated the effects of hearing aid use on cortical evoked potentials
after a period of four13 to twelve weeks14.

Methods

Participants Pre- & Post-test sessions (24 weeks apart) included:
• 32 older adults (60-84 years old, 72.3 ± 7 years; 21 F) Cognitive Testing
• Mild to severe symmetrical SNHL. • Cognitive- NIH Toolbox19
• No history of neurological disorders; no middle ear pathology
• Normal IQ (114.6 ± 15.55) on WASI 17 • List Sorting Working Memory Test 20
• Screened for dementia (criterion score of 22/30) using MOCA18 • Flanker Inhibitory Control and Attention Test
• Pattern Comparison Processing Speed Test
Hearing Aid Fitting
• Widex Dream BTE-RIC bilateral hearing aids Electrophysiological Recording
• Matched NAL-NL2 prescriptive targets for • 170 ms /ga/ presented in sound field with alternating polarities.
• Participants tested in aided and unaided conditions:
55, 65, and 75 dB SPL inputs
Quiet (80 dB SPL) and Noise (+10 signal to noise ratio (SNR) six-talker babble noise)
Protocol FFR was recorded with Biosemi ActiABR-200 acquisition system.
• All participants fit with Hearing Aids (HAs), tested in aided and unaided conditions at pre-test, and tested 6 CAEP recorded with Biosemi acquisition system.

months after pre-test. FFR Analysis Cortical Analysis
 Experimental group (n=18) wore HAs during acclimatization period and were tested in 4 additional testing
• Raw data filtered from 70 to 2000 Hz using • The P1-N1- P2 complex was used
sessions. zero-phase, 4th order Butterworth filter
 Control group (n=14) was fit and tested with HAs but did not wear them during the intervening 6 months. • Mean response amplitudes at the Cz electrode
• Automatic peak-picking algorithm was used were calculated for the expected time regions for
Statistical Analysis for latency each of the prominent cortical peaks: P1 (35-75
• Repeated measures ANOVA. Between subject factor (Group). Within subject factors (Session, Amplification). ms), N1 (80-150 ms), and P2 (160-250 ms) in the
• Means and SEMs are shown on the graphs. quiet condition and P1 (35-75 ms), N1 (150-200
• Pearson correlations between response amplitude changes and working memory change. ms), and P2 (225-275 ms) in the noise condition.

Results

Cognitive: The use of HAs improves working memory Subcortical: The use of HAs offsets delays in latency

Quiet

Quiet

Experimental group’s ** P < 0.01
working memory
improved significantly The Control group showed delayed peak latencies in the
after the use of HAs for 6 quiet condition at six months, relative to the pre test.
months, while controls While the peak latencies of the Experimental group did not
did not show any change. change.
No changes in Flanker and
Pattern Comparison tests.

* P < 0.05, ** P < 0.01

CAEPs: The use of HAs increases amplitude Summary & Conclusions

• The use of HAs may offset neural timing delay.
• FFR peak latencies remained stable in the hearing-aid users group but were significantly
delayed in the control group after six months.

N1 & P2 • There were significant HA-induced changes in cortical processing of speech stimuli and
amplitudes working memory in the experimental group.
increased • Increased auditory experience through hearing aid use gained during the 24-week period
significantly after enabled increased attentional resources to the signal (reflected by N1).
the use of HAs for 6 • P2 amplitudes were more robust after the use of hearing aids, and changes in amplitude
months. were related to improvement in working memory.
• P2 amplitudes may represent facilitation of implicit memory for an auditory object21
Cognitive & CAEPs Correlation
• Therefore, a possible mechanistic association between auditory perception and working
memory was demonstrated in the current study.
• HA amplification intervention can be used to lessen the amount of cognitive resources
required for effective auditory communication.
• Increasing audibility of the incoming signal could reduce the consumption of resources
needed to achieve success on some listening tasks.

References

1.Yueh et al. (2003) JAMA, 289:1976-85 11. Easwar et al. (2015) Ear Hear,36,635–652

2.Pichora-Fuller et al. (1995) J Acoust Soc Am, 97:593-608 12. Tremblay et al. (2006) Trends Amplif, 10(3), 155-162

13. Rao et al. (2017) Ear Hear, 38, 28-41
3.Fitzgibbons & Gordon-Salant (2010) New York: Springer,p. 111-34 14. Dawes et al. (2014) J Acoust Soc Am, 135, 3560-3569
4.Wingfield & Kahana (2002) Can J Exp Psychol, 56, 187
15. Karawani et al. (2018) Neuropsychol, 114, 203–213
5.Salthouse, (1996) Psychol rev, 103, 403
16. Karawani et al. (2018) Clin Neurophysiol, 129, 1254–1267
6.Salthouse, (1994). Neuropsychol, 8, 535
17. Zhu and Garcia (1999)New York: Psychol Corp
7.Lin et al. (2013) JAMA intern med, 173, 293-299
Working memory positively correlated 18. Nasreddine et al. (2005) J Am Geriatr Soc, 53, 695-699
with increases in cortical amplitudes 8.Gil and Iorio (2010) Clinics, 65(2),165-174
Working memory improvement was 19. www.nihtoolbox.org
related to higher P2 peak amplitudes in 9.Lavie et al. (2015) JSLHR, 58, 1601-1610
quiet 20. Tulsky et al. (2013) Monogr Soc Res Child Dev, 78, 70–87
N1 changes did not correlate with 10. Anderson and Kraus (2013) Int J Otolaryngol, 10
working memory changes. 21. Ross et al. (2013). BMC neurosci, 14, 151

Acknowledgments

* P < 0.05 This study was supported by 1) the Hearing Health Foundation for support of this study, Francis
Kuk, Widex USA, for feedback on the project, and Widex USA for providing hearing aids and
participant funds. 2) The Planning and Budgeting Committee for Higher Education in Israel for
the postdoctoral fellowship awarded to H.K. 3) The National Institute on Deafness and other
Communication Disorders (R21DC015843, awarded to S.A.) also contributed to postdoctoral
fellowship support for H.K.

‫ קליטת סגל אקדמי מצטיין‬40

‫מלגת מעוף‬

‫קליטת סגל אקדמי מצטיין ‪41‬‬

2019

88